Starting /dee2/code/volunteer_pipeline.sh SRR5579221 current disk space = 1522908958720 free memory = 1570832620 SRR5579221 SRAfilesize 538b274b85705d5fd496e992bc2a78cc SRR5579221.sra SRR5579221.sra file validated SRR5579221 is paired end SRR5579221 is conventional basespace SRR5579221 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579221_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.953 34.0 33.0 34.0 32.0 34.0 2 33.20675 34.0 33.0 34.0 32.0 34.0 3 33.34525 34.0 33.0 34.0 32.0 34.0 4 33.3755 34.0 33.0 34.0 33.0 34.0 5 33.4115 34.0 33.0 34.0 33.0 34.0 6 37.1905 38.0 38.0 38.0 36.0 38.0 7 37.4575 38.0 38.0 38.0 37.0 38.0 8 37.49 38.0 38.0 38.0 38.0 38.0 9 37.55675 38.0 38.0 38.0 38.0 38.0 10-14 37.56079999999999 38.0 38.0 38.0 38.0 38.0 15-19 37.53955 38.0 38.0 38.0 38.0 38.0 20-24 37.43405 38.0 38.0 38.0 37.8 38.0 25-29 37.354949999999995 38.0 38.0 38.0 37.6 38.0 30-34 37.30565 38.0 38.0 38.0 37.4 38.0 35-39 37.155800000000006 38.0 38.0 38.0 37.0 38.0 40-44 37.0887 38.0 38.0 38.0 36.8 38.0 45-49 37.04305 38.0 38.0 38.0 36.6 38.0 50-54 37.14684999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.018049999999995 38.0 38.0 38.0 36.6 38.0 60-64 37.01705 38.0 38.0 38.0 36.2 38.0 65-69 36.78895 38.0 38.0 38.0 35.4 38.0 70-74 36.827299999999994 38.0 38.0 38.0 36.0 38.0 75-79 36.70285 38.0 38.0 38.0 35.8 38.0 80-84 36.617549999999994 38.0 38.0 38.0 35.0 38.0 85-89 36.56745 38.0 38.0 38.0 35.0 38.0 90-94 36.46640000000001 38.0 38.0 38.0 35.0 38.0 95-99 36.2944 38.0 38.0 38.0 34.4 38.0 100-104 36.1403 38.0 38.0 38.0 33.8 38.0 105-109 35.97265 38.0 38.0 38.0 33.2 38.0 110-114 35.823699999999995 38.0 38.0 38.0 33.0 38.0 115-119 35.5452 38.0 37.2 38.0 32.0 38.0 120-124 35.598 38.0 37.6 38.0 32.2 38.0 125-129 35.438550000000006 38.0 36.8 38.0 31.6 38.0 130-134 35.096500000000006 38.0 36.0 38.0 30.0 38.0 135-139 34.7577 38.0 35.0 38.0 28.4 38.0 140-144 34.3077 38.0 34.6 38.0 26.4 38.0 145-149 33.54485 38.0 33.2 38.0 21.2 38.0 150-151 28.328500000000002 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 3.0 8 11.0 9 1.0 10 1.0 11 2.0 12 1.0 13 4.0 14 1.0 15 0.0 16 2.0 17 3.0 18 14.0 19 18.0 20 4.0 21 7.0 22 9.0 23 10.0 24 11.0 25 17.0 26 10.0 27 18.0 28 28.0 29 31.0 30 37.0 31 39.0 32 70.0 33 66.0 34 126.0 35 222.0 36 628.0 37 2606.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.30115424973767 13.53620146904512 10.886673662119623 29.275970619097585 2 25.074999999999996 17.45 30.625000000000004 26.85 3 23.225 23.0 24.175 29.599999999999998 4 27.075 30.25 19.35 23.325000000000003 5 26.375 30.425 22.85 20.349999999999998 6 21.7 31.275 24.875 22.15 7 17.575 22.1 38.1 22.225 8 20.674999999999997 21.75 28.65 28.925 9 21.125 22.400000000000002 30.2 26.275 10-14 24.115000000000002 25.905 24.099999999999998 25.88 15-19 24.044999999999998 24.945 24.825 26.185000000000002 20-24 23.871193559677984 25.426271313565678 24.131206560328017 26.57132856642832 25-29 23.71490064567796 24.76099904900145 24.600830872416036 26.92326943290455 30-34 24.04029267314824 24.94737897163476 24.436203267515285 26.576125087701712 35-39 24.342072284325027 24.80826106571758 23.966113589653617 26.883553060303772 40-44 24.780712746228257 24.40980401984863 24.690491704676457 26.118991529246653 45-49 24.72687180515185 24.40112258193846 24.361030369850656 26.510975243059036 50-54 24.339499674136462 24.1891011179626 23.99859628014238 27.47280292775856 55-59 24.471071894114107 24.47608543066279 23.949664093051236 27.103178582171868 60-64 24.68677959306405 24.285857472186027 24.295880525207977 26.731482409541947 65-69 24.334486388930664 24.88093447636236 23.687772597383063 27.096806537323907 70-74 25.379642159073825 24.126697739688268 23.800932190648023 26.692727910589888 75-79 24.927405627315512 24.882347051166516 23.71583057975368 26.474416741764294 80-84 25.410657051282055 23.923277243589745 23.803084935897438 26.86298076923077 85-89 26.31156987523175 23.18484742195721 23.700957057674 26.802625645137045 90-94 25.420926037282022 23.82742032471437 23.94768490679495 26.80396873120866 95-99 25.583725824230886 23.845074656779236 23.72482212646558 26.8463773925243 100-104 26.072375994794534 23.995194954702438 22.623754942689825 27.308674107813204 105-109 25.93427512273319 23.890391744314197 23.10389740506963 27.071435727882974 110-114 25.89992981048832 24.68665396570741 22.961997392960996 26.451418830843277 115-119 24.858530722620063 24.352746757474083 22.960588912814863 27.828133607090994 120-124 25.979999999999997 23.825 22.884999999999998 27.310000000000002 125-129 25.240000000000002 24.72 22.825 27.215 130-134 25.814999999999998 24.6 22.08 27.505000000000003 135-139 25.495 24.445 22.485 27.575 140-144 25.445 24.265 22.445 27.845 145-149 25.215 25.014999999999997 22.395 27.375 150-151 26.35 23.9375 22.075 27.6375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 1.0 3 1.0 4 0.5 5 0.0 6 0.5 7 1.5 8 1.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.5 17 1.5 18 1.5 19 1.0 20 1.0 21 0.5 22 0.5 23 0.5 24 1.5 25 3.5 26 4.0 27 3.5 28 5.0 29 6.5 30 8.5 31 12.5 32 16.0 33 24.0 34 33.5 35 40.5 36 52.5 37 71.5 38 86.0 39 93.0 40 94.0 41 96.0 42 119.5 43 148.5 44 156.5 45 142.5 46 138.5 47 153.0 48 143.5 49 138.5 50 145.5 51 136.5 52 144.5 53 138.0 54 116.5 55 126.5 56 118.0 57 104.0 58 96.5 59 98.5 60 99.0 61 78.5 62 78.5 63 69.5 64 68.5 65 79.0 66 63.0 67 55.0 68 55.0 69 56.5 70 51.5 71 40.0 72 35.5 73 30.5 74 28.0 75 26.0 76 21.5 77 13.0 78 5.0 79 4.0 80 4.0 81 2.0 82 1.5 83 1.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.7 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.105 30-34 0.22999999999999998 35-39 0.255 40-44 0.245 45-49 0.22999999999999998 50-54 0.265 55-59 0.27 60-64 0.22999999999999998 65-69 0.265 70-74 0.23500000000000001 75-79 0.13 80-84 0.16 85-89 0.215 90-94 0.22 95-99 0.21 100-104 0.105 105-109 0.19 110-114 0.27 115-119 0.155 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.775 #Duplication Level Percentage of deduplicated Percentage of total 1 96.84155572957452 92.75 2 2.6363873662229182 5.050000000000001 3 0.28713129731140696 0.8250000000000001 4 0.20882276168102323 0.8 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026102845210127904 0.575 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGC 23 0.575 TruSeq Adapter, Index 11 (100% over 50bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.2125 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.4 0.0 0.0 0.0 0.0 80-81 0.575 0.0 0.0 0.0 0.0 82-83 0.8875 0.0 0.0 0.0 0.0 84-85 1.1375 0.0 0.0 0.0 0.0 86-87 1.2999999999999998 0.0 0.0 0.0 0.0 88-89 1.6 0.0 0.0 0.0 0.0 90-91 1.85 0.0 0.0 0.0 0.0 92-93 2.3 0.0 0.0 0.0 0.0 94-95 2.6375 0.0 0.0 0.0 0.0 96-97 3.1 0.0 0.0 0.0 0.0 98-99 3.45 0.0 0.0 0.0 0.0 100-101 3.8875 0.0 0.0 0.0 0.0 102-103 4.4 0.0 0.0 0.0 0.0 104-105 5.0125 0.0 0.0 0.0 0.0 106-107 5.725 0.0 0.0 0.0 0.0 108-109 6.2875 0.0 0.0 0.0 0.0 110-111 6.825 0.0 0.0 0.0 0.0 112-113 7.475 0.0 0.0 0.0 0.0 114-115 8.3875 0.0 0.0 0.0 0.0 116-117 9.25 0.0 0.0 0.0 0.0 118-119 9.9375 0.0 0.0 0.0 0.0 120-121 10.6875 0.0 0.0 0.0 0.0 122-123 11.399999999999999 0.0 0.0 0.0 0.0 124-125 12.375 0.0 0.0 0.0 0.0 126-127 13.7625 0.0 0.0 0.0 0.0 128-129 14.600000000000001 0.0 0.0 0.0 0.0 130-131 15.325 0.0 0.0 0.0 0.0 132-133 16.225 0.0 0.0 0.0 0.0 134-135 17.049999999999997 0.0 0.0 0.0 0.0 136-137 18.1 0.0 0.0 0.0 0.0 138-139 19.012500000000003 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGAAA 10 0.0068378756 144.95 5 TTGAAAA 20 0.005945122 28.99 140-144 TTCTGCT 40 0.0076702754 18.11875 135-139 >>END_MODULE SRR5579221 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579221_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.768 33.0 33.0 34.0 32.0 34.0 2 32.76675 34.0 33.0 34.0 32.0 34.0 3 32.70675 34.0 33.0 34.0 32.0 34.0 4 32.659 34.0 33.0 34.0 32.0 34.0 5 32.64725 34.0 33.0 34.0 32.0 34.0 6 36.59675 38.0 38.0 38.0 36.0 38.0 7 36.72575 38.0 38.0 38.0 36.0 38.0 8 36.669 38.0 38.0 38.0 36.0 38.0 9 36.70525 38.0 38.0 38.0 36.0 38.0 10-14 36.689049999999995 38.0 38.0 38.0 36.0 38.0 15-19 36.660900000000005 38.0 38.0 38.0 36.0 38.0 20-24 36.70005 38.0 38.0 38.0 36.4 38.0 25-29 36.652699999999996 38.0 38.0 38.0 36.0 38.0 30-34 36.683949999999996 38.0 38.0 38.0 36.4 38.0 35-39 36.654199999999996 38.0 38.0 38.0 36.4 38.0 40-44 36.63250000000001 38.0 38.0 38.0 36.0 38.0 45-49 36.55415000000001 38.0 38.0 38.0 35.8 38.0 50-54 36.502300000000005 38.0 38.0 38.0 35.8 38.0 55-59 36.4644 38.0 38.0 38.0 35.6 38.0 60-64 36.4595 38.0 38.0 38.0 35.8 38.0 65-69 36.18705 38.0 38.0 38.0 34.6 38.0 70-74 35.8437 38.0 38.0 38.0 33.8 38.0 75-79 35.8452 38.0 38.0 38.0 34.0 38.0 80-84 35.8197 38.0 38.0 38.0 34.0 38.0 85-89 35.722699999999996 38.0 38.0 38.0 33.6 38.0 90-94 35.69265 38.0 38.0 38.0 33.4 38.0 95-99 35.5831 38.0 38.0 38.0 33.2 38.0 100-104 35.25605 38.0 38.0 38.0 31.0 38.0 105-109 35.1264 38.0 38.0 38.0 30.8 38.0 110-114 34.842499999999994 38.0 36.6 38.0 29.2 38.0 115-119 34.53565 38.0 36.2 38.0 26.2 38.0 120-124 34.0925 38.0 35.0 38.0 23.2 38.0 125-129 33.4625 38.0 34.0 38.0 19.8 38.0 130-134 33.0681 38.0 33.0 38.0 15.0 38.0 135-139 32.39385 38.0 33.0 38.0 12.2 38.0 140-144 31.46855 38.0 31.6 38.0 5.6 38.0 145-149 30.12595 38.0 29.0 38.0 2.0 38.0 150-151 24.059874999999998 31.5 14.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 30.0 3 3.0 4 5.0 5 3.0 6 4.0 7 8.0 8 7.0 9 2.0 10 8.0 11 6.0 12 7.0 13 6.0 14 12.0 15 13.0 16 12.0 17 14.0 18 10.0 19 11.0 20 12.0 21 7.0 22 12.0 23 13.0 24 16.0 25 20.0 26 23.0 27 23.0 28 41.0 29 40.0 30 52.0 31 60.0 32 84.0 33 114.0 34 153.0 35 287.0 36 684.0 37 2198.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.48687171792948 14.603650912728183 13.103275818954737 24.8062015503876 2 29.994992488733104 20.530796194291437 23.685528292438658 25.78868302453681 3 28.557139284821204 22.755688922230558 22.705676419104776 25.98149537384346 4 29.15728932233058 30.282570642660666 16.27906976744186 24.281070267566893 5 28.921691268451337 31.998999249437077 17.538153615211407 21.541155866900176 6 24.175 29.95 20.075000000000003 25.8 7 23.1 18.45 31.5 26.950000000000003 8 24.175 20.974999999999998 22.325 32.525 9 25.575 23.974999999999998 21.575 28.875 10-14 27.46 24.37 20.919999999999998 27.250000000000004 15-19 27.815 23.075000000000003 22.445 26.665 20-24 27.655 23.745 22.275 26.325 25-29 27.975 23.91 22.025 26.090000000000003 30-34 27.466373318665934 23.84619230961548 22.4161208060403 26.271313565678284 35-39 27.195000000000004 23.385 22.46 26.96 40-44 28.854999999999997 23.135 22.8 25.21 45-49 28.4 22.545 22.48 26.575 50-54 27.92 23.44 22.814999999999998 25.825 55-59 27.189999999999998 23.9 22.650000000000002 26.26 60-64 27.32 23.799999999999997 23.305 25.575 65-69 27.86278627862786 23.452345234523452 23.1023102310231 25.58255825582558 70-74 27.677767776777678 24.082408240824083 22.517251725172517 25.722572257225725 75-79 27.305 23.810000000000002 22.625 26.26 80-84 28.075 23.95 22.645 25.330000000000002 85-89 26.865 24.185000000000002 23.335 25.615 90-94 27.67 24.215 22.775000000000002 25.34 95-99 27.85 24.095 22.82 25.235000000000003 100-104 28.335 24.375 22.555 24.735 105-109 27.845 24.884999999999998 22.5 24.77 110-114 28.035 24.845 22.765 24.355 115-119 28.705000000000002 24.51 22.66 24.125 120-124 28.765 25.019999999999996 22.43 23.785 125-129 29.315 25.335 22.46 22.89 130-134 29.741487074353717 24.956247812390618 22.651132556627832 22.651132556627832 135-139 29.820964192838566 25.29005801160232 22.704540908181635 22.184436887377476 140-144 29.659999999999997 26.0 22.814999999999998 21.525 145-149 30.28605721144229 26.27025405081016 22.204440888177636 21.239247849569914 150-151 29.849999999999998 26.687499999999996 22.2125 21.25 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 1.5 24 1.5 25 0.0 26 0.5 27 1.0 28 2.5 29 3.0 30 3.5 31 5.5 32 7.0 33 9.5 34 17.0 35 22.0 36 24.0 37 33.0 38 52.0 39 65.0 40 74.5 41 84.0 42 87.5 43 101.0 44 124.5 45 141.0 46 133.5 47 139.5 48 154.5 49 144.5 50 124.0 51 131.0 52 150.0 53 143.0 54 138.5 55 140.5 56 128.5 57 121.5 58 123.5 59 121.0 60 114.0 61 100.0 62 99.0 63 94.0 64 79.5 65 84.0 66 82.0 67 81.5 68 93.5 69 76.0 70 60.0 71 52.0 72 44.5 73 45.5 74 37.5 75 27.0 76 19.5 77 17.0 78 13.0 79 8.0 80 5.0 81 3.0 82 1.5 83 1.0 84 0.5 85 0.5 86 1.0 87 0.5 88 0.0 89 0.5 90 0.5 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.15 3 0.025 4 0.025 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.01 70-74 0.01 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.02 140-144 0.0 145-149 0.02 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.65 #Duplication Level Percentage of deduplicated Percentage of total 1 96.06444796619124 90.925 2 3.1959852086634974 6.05 3 0.39619651347068147 1.125 4 0.21130480718436345 0.8 5 0.07923930269413629 0.375 6 0.0 0.0 7 0.0 0.0 8 0.02641310089804543 0.2 9 0.0 0.0 >10 0.02641310089804543 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 21 0.525 Illumina Single End PCR Primer 1 (100% over 50bp) GCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCC 8 0.2 No Hit GGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTC 5 0.125 No Hit CCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCCTATGG 5 0.125 No Hit GGGGACTTAAGCGCGGTGGCCTCCCCTATCCCCTACGAGGCTACCCGGAT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.2375 0.0 0.0 0.0 0.0 74-75 0.3 0.0 0.0 0.0 0.0 76-77 0.375 0.0 0.0 0.0 0.0 78-79 0.475 0.0 0.0 0.0 0.0 80-81 0.6000000000000001 0.0 0.0 0.0 0.0 82-83 0.8999999999999999 0.0 0.0 0.0 0.0 84-85 1.125 0.0 0.0 0.0 0.0 86-87 1.3375 0.0 0.0 0.0 0.0 88-89 1.6625 0.0 0.0 0.0 0.0 90-91 1.9 0.0 0.0 0.0 0.0 92-93 2.3875 0.0 0.0 0.0 0.0 94-95 2.7375 0.0 0.0 0.0 0.0 96-97 3.25 0.0 0.0 0.0 0.0 98-99 3.5875000000000004 0.0 0.0 0.0 0.0 100-101 4.05 0.0 0.0 0.0 0.0 102-103 4.625 0.0 0.0 0.0 0.0 104-105 5.225 0.0 0.0 0.0 0.0 106-107 5.95 0.0 0.0 0.0 0.0 108-109 6.5375 0.0 0.0 0.0 0.0 110-111 7.175000000000001 0.0 0.0 0.0 0.0 112-113 7.8125 0.0 0.0 0.0 0.0 114-115 8.7 0.0 0.0 0.0 0.0 116-117 9.55 0.0 0.0 0.0 0.0 118-119 10.225 0.0 0.0 0.0 0.0 120-121 10.975 0.0 0.0 0.0 0.0 122-123 11.675 0.0 0.0 0.0 0.0 124-125 12.65 0.0 0.0 0.0 0.0 126-127 14.05 0.0 0.0 0.0 0.0 128-129 14.8875 0.0 0.0 0.0 0.0 130-131 15.7375 0.0 0.0 0.0 0.0 132-133 16.65 0.0 0.0 0.0 0.0 134-135 17.5 0.0 0.0 0.0 0.0 136-137 18.475 0.0 0.0 0.0 0.0 138-139 19.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCGTTGC 10 0.006830828 145.0 5 AAAAAAA 120 2.6557245E-10 30.208334 145 >>END_MODULE Read 705871 spots for SRR5579221.sra Written 705871 spots for SRR5579221.sra Read 705871 spots for SRR5579221.sra Written 705871 spots for SRR5579221.sra Read 705871 spots for SRR5579221.sra Written 705871 spots for SRR5579221.sra Read 705871 spots for SRR5579221.sra Written 705871 spots for SRR5579221.sra Read 705871 spots for SRR5579221.sra Written 705871 spots for SRR5579221.sra Read 705871 spots for SRR5579221.sra Written 705871 spots for SRR5579221.sra Read 705887 spots for SRR5579221.sra Written 705887 spots for SRR5579221.sra Read 705871 spots for SRR5579221.sra Written 705871 spots for SRR5579221.sra Read 705871 spots for SRR5579221.sra Written 705871 spots for SRR5579221.sra Read 705871 spots for SRR5579221.sra Written 705871 spots for SRR5579221.sra Read 705871 spots for SRR5579221.sra Written 705871 spots for SRR5579221.sra Read 705871 spots for SRR5579221.sra Written 705871 spots for SRR5579221.sra Read 705871 spots for SRR5579221.sra Written 705871 spots for SRR5579221.sra Read 705871 spots for SRR5579221.sra Written 705871 spots for SRR5579221.sra Read 705871 spots for SRR5579221.sra Written 705871 spots for SRR5579221.sra Read 705871 spots for SRR5579221.sra Written 705871 spots for SRR5579221.sra Read 705871 spots for SRR5579221.sra Written 705871 spots for SRR5579221.sra Read 705871 spots for SRR5579221.sra Written 705871 spots for SRR5579221.sra Read 705871 spots for SRR5579221.sra Written 705871 spots for SRR5579221.sra Read 705871 spots for SRR5579221.sra Written 705871 spots for SRR5579221.sra SRR ids: ['SRR5579221.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8zlxuj9a SRR5579221.sra spots: 14117436 blocks: [[1, 705871], [705872, 1411742], [1411743, 2117613], [2117614, 2823484], [2823485, 3529355], [3529356, 4235226], [4235227, 4941097], [4941098, 5646968], [5646969, 6352839], [6352840, 7058710], [7058711, 7764581], [7764582, 8470452], [8470453, 9176323], [9176324, 9882194], [9882195, 10588065], [10588066, 11293936], [11293937, 11999807], [11999808, 12705678], [12705679, 13411549], [13411550, 14117436]] SRR5579221 file size 4762235 SRR5579221 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579221 SRR5579221_1.fastq SRR5579221_2.fastq Input file: SRR5579221_1.fastq Paired file: SRR5579221_2.fastq trimmed: SRR5579221-trimmed-pair1.fastq, SRR5579221-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 22:38:53 2024 >> started Mon Dec 9 22:39:10 2024 >> done (16.463s) 14117436 read pairs processed; of these: 57362 ( 0.41%) short read pairs filtered out after trimming by size control 165368 ( 1.17%) empty read pairs filtered out after trimming by size control 13894706 (98.42%) read pairs available; of these: 8939346 (64.34%) trimmed read pairs available after processing 4955360 (35.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 14 0.00% 20 27 0.00% 21 15 0.00% 22 21 0.00% 23 18 0.00% 24 26 0.00% 25 32 0.00% 26 34 0.00% 27 39 0.00% 28 37 0.00% 29 50 0.00% 30 29 0.00% 31 47 0.00% 32 38 0.00% 33 47 0.00% 34 48 0.00% 35 57 0.00% 36 68 0.00% 37 70 0.00% 38 95 0.00% 39 143 0.00% 40 440 0.00% 41 113 0.00% 42 146 0.00% 43 288 0.00% 44 175 0.00% 45 252 0.00% 46 266 0.00% 47 284 0.00% 48 340 0.00% 49 349 0.00% 50 371 0.00% 51 424 0.00% 52 509 0.00% 53 512 0.00% 54 539 0.00% 55 619 0.00% 56 731 0.01% 57 835 0.01% 58 940 0.01% 59 1038 0.01% 60 1142 0.01% 61 1265 0.01% 62 1475 0.01% 63 1631 0.01% 64 1833 0.01% 65 2206 0.02% 66 3213 0.02% 67 4919 0.04% 68 8030 0.06% 69 18434 0.13% 70 24679 0.18% 71 15397 0.11% 72 10813 0.08% 73 8799 0.06% 74 8177 0.06% 75 8365 0.06% 76 8623 0.06% 77 9140 0.07% 78 10031 0.07% 79 10647 0.08% 80 11958 0.09% 81 13840 0.10% 82 15140 0.11% 83 16602 0.12% 84 20314 0.15% 85 22472 0.16% 86 23318 0.17% 87 24841 0.18% 88 26585 0.19% 89 28516 0.21% 90 30199 0.22% 91 31680 0.23% 92 33933 0.24% 93 36295 0.26% 94 38265 0.28% 95 40283 0.29% 96 41229 0.30% 97 41242 0.30% 98 43240 0.31% 99 44563 0.32% 100 47116 0.34% 101 49324 0.35% 102 52682 0.38% 103 55465 0.40% 104 57670 0.42% 105 58075 0.42% 106 59536 0.43% 107 58621 0.42% 108 61261 0.44% 109 61447 0.44% 110 63070 0.45% 111 66367 0.48% 112 69317 0.50% 113 72069 0.52% 114 74610 0.54% 115 76174 0.55% 116 77021 0.55% 117 75407 0.54% 118 74921 0.54% 119 75947 0.55% 120 77750 0.56% 121 79493 0.57% 122 81542 0.59% 123 84633 0.61% 124 87235 0.63% 125 88095 0.63% 126 89912 0.65% 127 87973 0.63% 128 88531 0.64% 129 89584 0.64% 130 88479 0.64% 131 91636 0.66% 132 94574 0.68% 133 97940 0.70% 134 97515 0.70% 135 100521 0.72% 136 102998 0.74% 137 103165 0.74% 138 105292 0.76% 139 106646 0.77% 140 109623 0.79% 141 113538 0.82% 142 120559 0.87% 143 127957 0.92% 144 139125 1.00% 145 155740 1.12% 146 180939 1.30% 147 224957 1.62% 148 316406 2.28% 149 600000 4.32% 150 2967418 21.36% 151 4955360 35.66% 13894706 reads passed initial QC criterion=sequence-density sequence-density=1.04 sequence-density-rank=1 fanout-score=3.77 fanout-score-rank=18 prefix-density=1.27 prefix-fanout=3.1 sequence=CGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGCCTCAGGGTCGTCAGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=45.31 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=4.7 sequence=TTTTTTTTACGTTTCATCAATGGCACTCTCTCACAGCCAATAACTTCAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTGCCACCGAATATTCAGTCCTTTAAGAAATCGAACAGCATACCCAACATAGTAAAAACCATCAATAATGCAAATACCGTTACCACAAGTGCAAATACTCCCATTCCTACCTCTCCAAA criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=3.11 fanout-score-rank=21 prefix-density=0.97 prefix-fanout=2.5 sequence=CCATGTTCGGGT criterion=fanout-score sequence-density=0.18 sequence-density-rank=31 fanout-score=39.01 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=9.6 sequence=CGCCGCCGCCTTCTCGGCGAAGCGCGTGCAGGTCAAGGACCGGCGGTCGGCGCTCCTCGGCCTGGCGGCCGTTATCGCCGTTACTGCCGGCGCCTCCGGGTCCGCCAGGGCCAGCGTCTTCGACGAGTACCTCGAGAAGAGCAAGCTCAACAAGGAGCTGAACGACAAGAAGAGGGCGGCAACCAGCGGCGCCAACTTCGCCCGGGCATACACCGTGCAGTTCGGCAGCTGCAAGTTCCCCTACAACTTCACCGGCTGCCAGGACCTTGCCAAGCAGAAGAAAGTGCCGTTCATCAGTGACGACCTGGAGATCGAGTGCGAGGGCAAGGAGAAGTACAAGTGCGGATCCAACGTCTTCTGGAAATGGTGAAGATGATACGAATATGCCGGCCGGGTGCTGATATTGTGATGCGTGTGTATGTGGCATGCCAGCGTTTGTACCTAGAAGATGTGAAAAACTGCAGAAATGTTTTGGATGTTAACTTGT SRR5579221 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 22:40:10 Started mapping on | Dec 09 22:40:10 Finished on | Dec 09 22:46:54 Mapping speed, Million of reads per hour | 123.81 Number of input reads | 13894706 Average input read length | 280 UNIQUE READS: Uniquely mapped reads number | 11133219 Uniquely mapped reads % | 80.13% Average mapped length | 280.35 Number of splices: Total | 8278619 Number of splices: Annotated (sjdb) | 7799895 Number of splices: GT/AG | 8178110 Number of splices: GC/AG | 90332 Number of splices: AT/AC | 2704 Number of splices: Non-canonical | 7473 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.34 Insertion rate per base | 0.00% Insertion average length | 1.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 356070 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 50416 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 14.98% % of reads unmapped: other | 1.96% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2431138 2431138 2431138 N_multimapping 356070 356070 356070 N_noFeature 396411 10768655 492799 N_ambiguous 332773 1204 64519 UnstrandedReadsAssigned:10404035 PositiveStrandReadsAssigned:363360 NegativeStrandReadsAssigned:10575901 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=130 echo kmer=125 SRR5579221 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579221-trimmed-pair1.fastq SRR5579221-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,894,706 reads, 10,670,163 reads pseudoaligned [quant] estimated average fragment length: 196.201 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,136 rounds 52973 SRR5579221.ke.tsv 35125 SRR5579221.se.tsv 88098 total ==> SRR5579221.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 740.908 0 0 PNS24247 1044 848.799 7.21366 0.859549 PNS24249 1928 1732.8 3.68418 0.215037 PNS24246 1044 848.799 7.21366 0.859549 PNS24248 1044 848.799 7.21366 0.859549 PNS24244 1471 1275.8 95.6748 7.58464 PNS24243 293 121.61 0 0 KQK14069 1603 1407.8 7273.39 522.535 KQK14071 474 283.506 120.426 42.9611 ==> SRR5579221.se.tsv <== BRADI_1g14170v3 7730 BRADI_1g53295v3 9 BRADI_1g59795v3 311 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 77 BRADI_1g74790v3 175 BRADI_1g09890v3 0 BRADI_1g77505v3 357 BRADI_1g48960v3 0 SRR5579221 completed mapping pipeline successfully