Starting /dee2/code/volunteer_pipeline.sh SRR5579222 current disk space = 1522908995584 free memory = 1597757540 SRR5579222 SRAfilesize 04d362ae962885fd4ab94a0693b7d9b7 SRR5579222.sra SRR5579222.sra file validated SRR5579222 is paired end SRR5579222 is conventional basespace SRR5579222 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579222_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.624 34.0 34.0 34.0 33.0 34.0 2 33.48775 34.0 34.0 34.0 33.0 34.0 3 33.59825 34.0 34.0 34.0 33.0 34.0 4 33.66925 34.0 34.0 34.0 33.0 34.0 5 33.71825 34.0 34.0 34.0 33.0 34.0 6 37.65225 38.0 38.0 38.0 38.0 38.0 7 37.76125 38.0 38.0 38.0 38.0 38.0 8 37.78075 38.0 38.0 38.0 38.0 38.0 9 37.78825 38.0 38.0 38.0 38.0 38.0 10-14 37.7697 38.0 38.0 38.0 38.0 38.0 15-19 37.7823 38.0 38.0 38.0 38.0 38.0 20-24 37.7923 38.0 38.0 38.0 38.0 38.0 25-29 37.74980000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.7502 38.0 38.0 38.0 38.0 38.0 35-39 37.67705 38.0 38.0 38.0 38.0 38.0 40-44 37.62785 38.0 38.0 38.0 38.0 38.0 45-49 37.59845 38.0 38.0 38.0 38.0 38.0 50-54 37.642199999999995 38.0 38.0 38.0 38.0 38.0 55-59 37.63105 38.0 38.0 38.0 38.0 38.0 60-64 37.6617 38.0 38.0 38.0 38.0 38.0 65-69 37.57685 38.0 38.0 38.0 38.0 38.0 70-74 37.565450000000006 38.0 38.0 38.0 38.0 38.0 75-79 37.48585 38.0 38.0 38.0 38.0 38.0 80-84 37.44635 38.0 38.0 38.0 38.0 38.0 85-89 37.4354 38.0 38.0 38.0 38.0 38.0 90-94 37.416900000000005 38.0 38.0 38.0 38.0 38.0 95-99 37.366200000000006 38.0 38.0 38.0 37.8 38.0 100-104 37.218199999999996 38.0 38.0 38.0 36.8 38.0 105-109 37.151149999999994 38.0 38.0 38.0 36.6 38.0 110-114 37.031850000000006 38.0 38.0 38.0 36.0 38.0 115-119 37.00565 38.0 38.0 38.0 36.0 38.0 120-124 37.01279999999999 38.0 38.0 38.0 36.0 38.0 125-129 36.8778 38.0 38.0 38.0 35.4 38.0 130-134 36.78135 38.0 38.0 38.0 35.0 38.0 135-139 36.6171 38.0 38.0 38.0 35.0 38.0 140-144 36.411150000000006 38.0 38.0 38.0 34.2 38.0 145-149 36.0281 38.0 38.0 38.0 33.0 38.0 150-151 32.344625 35.5 33.0 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 1.0 17 1.0 18 1.0 19 4.0 20 0.0 21 1.0 22 1.0 23 3.0 24 4.0 25 5.0 26 10.0 27 12.0 28 7.0 29 15.0 30 19.0 31 19.0 32 26.0 33 40.0 34 69.0 35 96.0 36 267.0 37 3396.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.15468184169684 14.433523021210554 9.41541645111226 28.99637868598034 2 22.7 20.7 33.625 22.975 3 19.775000000000002 27.400000000000002 25.6 27.224999999999998 4 25.7 31.525 21.224999999999998 21.55 5 22.975 34.8 22.825 19.400000000000002 6 19.1 35.225 24.349999999999998 21.325 7 16.45 20.075000000000003 42.525 20.95 8 20.275000000000002 20.225 27.875 31.624999999999996 9 20.525 20.275000000000002 30.9 28.299999999999997 10-14 21.95 27.465 25.185000000000002 25.4 15-19 22.595000000000002 25.71 26.63 25.064999999999998 20-24 22.626131306565327 26.071303565178262 26.306315315765787 24.996249812490625 25-29 22.79 26.06 26.305 24.845 30-34 22.375 26.405 25.885 25.335 35-39 22.345000000000002 26.450000000000003 26.474999999999998 24.73 40-44 22.439999999999998 25.85 26.529999999999998 25.180000000000003 45-49 22.73 26.16 25.75 25.36 50-54 22.585 26.215 26.240000000000002 24.959999999999997 55-59 22.6 25.965 26.224999999999998 25.21 60-64 22.805 25.515 26.39 25.290000000000003 65-69 23.7 25.419999999999998 25.75 25.130000000000003 70-74 22.759999999999998 26.75 26.05 24.44 75-79 23.24 25.955000000000002 25.590000000000003 25.215 80-84 23.244999999999997 26.284999999999997 25.295 25.174999999999997 85-89 23.330000000000002 26.215 26.115 24.34 90-94 23.66 25.885 26.040000000000003 24.415 95-99 22.505 26.200000000000003 26.36 24.935 100-104 23.054985740731475 26.352128883774455 24.961224796117477 25.631660579376597 105-109 23.340010015022532 25.60340510766149 25.6935403104657 25.363044566850274 110-114 23.32516135488067 26.02191424425877 25.12633211587532 25.526592284985238 115-119 23.075000000000003 26.279999999999998 25.185000000000002 25.46 120-124 23.26 26.235000000000003 25.264999999999997 25.240000000000002 125-129 23.41 26.1 25.055 25.435000000000002 130-134 23.445 26.015 25.224999999999998 25.314999999999998 135-139 23.115 26.245 24.884999999999998 25.755 140-144 22.564999999999998 26.155 25.22 26.06 145-149 23.18 26.16 25.22 25.44 150-151 23.724999999999998 26.437500000000004 24.087500000000002 25.75 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 2.0 27 3.0 28 6.0 29 9.0 30 11.5 31 15.0 32 23.5 33 32.0 34 41.0 35 52.5 36 65.5 37 95.0 38 108.5 39 113.5 40 127.0 41 155.5 42 194.0 43 198.0 44 215.0 45 225.0 46 219.0 47 209.5 48 185.0 49 167.0 50 148.0 51 134.0 52 122.5 53 119.5 54 111.0 55 95.5 56 88.5 57 80.0 58 67.5 59 61.0 60 57.0 61 56.5 62 49.5 63 44.0 64 37.0 65 34.0 66 42.5 67 31.0 68 21.5 69 21.5 70 18.0 71 18.5 72 20.5 73 16.0 74 9.0 75 7.0 76 6.0 77 3.5 78 2.0 79 1.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.065 105-109 0.15 110-114 0.065 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47183098591549 98.875 2 0.4778672032193159 0.95 3 0.025150905432595575 0.075 4 0.025150905432595575 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.21250000000000002 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.8625 0.0 0.0 0.0 0.0 94-95 1.175 0.0 0.0 0.0 0.0 96-97 1.5125000000000002 0.0 0.0 0.0 0.0 98-99 1.8375 0.0 0.0 0.0 0.0 100-101 2.1625 0.0 0.0 0.0 0.0 102-103 2.425 0.0 0.0 0.0 0.0 104-105 2.875 0.0 0.0 0.0 0.0 106-107 3.275 0.0 0.0 0.0 0.0 108-109 3.625 0.0 0.0 0.0 0.0 110-111 4.1125 0.0 0.0 0.0 0.0 112-113 4.525 0.0 0.0 0.0 0.0 114-115 4.975 0.0 0.0 0.0 0.0 116-117 5.574999999999999 0.0 0.0 0.0 0.0 118-119 6.137499999999999 0.0 0.0 0.0 0.0 120-121 6.6875 0.0 0.0 0.0 0.0 122-123 7.1875 0.0 0.0 0.0 0.0 124-125 7.825 0.0 0.0 0.0 0.0 126-127 8.5 0.0 0.0 0.0 0.0 128-129 9.3625 0.0 0.0 0.0 0.0 130-131 10.075 0.0 0.0 0.0 0.0 132-133 10.675 0.0 0.0 0.0 0.0 134-135 11.25 0.0 0.0 0.0 0.0 136-137 11.9625 0.0 0.0 0.0 0.0 138-139 12.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTGCC 10 0.0068343505 144.975 6 >>END_MODULE SRR5579222 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579222_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.13025 34.0 33.0 34.0 33.0 34.0 2 33.14875 34.0 33.0 34.0 33.0 34.0 3 33.2205 34.0 33.0 34.0 33.0 34.0 4 33.15625 34.0 33.0 34.0 33.0 34.0 5 33.217 34.0 33.0 34.0 33.0 34.0 6 37.3775 38.0 38.0 38.0 38.0 38.0 7 37.3165 38.0 38.0 38.0 38.0 38.0 8 37.318 38.0 38.0 38.0 38.0 38.0 9 37.36325 38.0 38.0 38.0 38.0 38.0 10-14 37.3331 38.0 38.0 38.0 38.0 38.0 15-19 37.35079999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.33485 38.0 38.0 38.0 38.0 38.0 25-29 37.33905 38.0 38.0 38.0 38.0 38.0 30-34 37.32955 38.0 38.0 38.0 38.0 38.0 35-39 37.3409 38.0 38.0 38.0 38.0 38.0 40-44 37.2895 38.0 38.0 38.0 38.0 38.0 45-49 37.310500000000005 38.0 38.0 38.0 38.0 38.0 50-54 37.30155 38.0 38.0 38.0 38.0 38.0 55-59 37.29505 38.0 38.0 38.0 38.0 38.0 60-64 37.26775 38.0 38.0 38.0 38.0 38.0 65-69 37.198299999999996 38.0 38.0 38.0 38.0 38.0 70-74 37.1109 38.0 38.0 38.0 38.0 38.0 75-79 37.0778 38.0 38.0 38.0 38.0 38.0 80-84 36.974199999999996 38.0 38.0 38.0 37.8 38.0 85-89 37.004850000000005 38.0 38.0 38.0 37.6 38.0 90-94 37.0248 38.0 38.0 38.0 37.8 38.0 95-99 36.9907 38.0 38.0 38.0 37.4 38.0 100-104 36.892900000000004 38.0 38.0 38.0 36.8 38.0 105-109 36.766949999999994 38.0 38.0 38.0 36.0 38.0 110-114 36.78075 38.0 38.0 38.0 36.2 38.0 115-119 36.6462 38.0 38.0 38.0 35.8 38.0 120-124 36.393699999999995 38.0 38.0 38.0 34.8 38.0 125-129 36.267250000000004 38.0 38.0 38.0 34.8 38.0 130-134 36.197900000000004 38.0 38.0 38.0 34.2 38.0 135-139 35.844899999999996 38.0 38.0 38.0 33.4 38.0 140-144 35.5561 38.0 38.0 38.0 31.8 38.0 145-149 35.005 38.0 37.2 38.0 30.4 38.0 150-151 30.972625 35.5 29.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 2.0 4 2.0 5 3.0 6 3.0 7 1.0 8 1.0 9 1.0 10 1.0 11 3.0 12 4.0 13 0.0 14 2.0 15 1.0 16 2.0 17 2.0 18 4.0 19 1.0 20 5.0 21 4.0 22 8.0 23 8.0 24 7.0 25 13.0 26 8.0 27 10.0 28 10.0 29 13.0 30 19.0 31 16.0 32 36.0 33 40.0 34 55.0 35 104.0 36 335.0 37 3256.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.663316582914575 16.70854271356784 10.829145728643216 24.798994974874372 2 25.962264150943398 23.144654088050316 30.08805031446541 20.80503144654088 3 22.982147347246666 25.06914759869248 28.086497359818956 23.862207694241892 4 28.265794110244148 31.86508935313365 19.05361188019129 20.815504656430907 5 27.121631830773108 33.946109292369684 18.58473936036263 20.347519516494586 6 20.521826392373306 36.50275965880582 20.446562970396386 22.528850978424487 7 20.583061070620758 15.707464186981653 39.95978889168133 23.749685850716258 8 21.87578576816696 20.593412119688207 25.29544883077697 32.23535328136787 9 24.00903161063723 22.12744606121425 25.639739086803814 28.22378324134471 10-14 25.46468401486989 26.147895107002917 23.53059379081684 24.85682708731036 15-19 25.72761942994781 25.28101164191088 24.603572862304297 24.387796065837016 20-24 25.337346375721093 25.854025583145223 24.70027589666416 24.108352144469524 25-29 26.009733580853943 25.638452661682802 24.69519843459937 23.656615322863882 30-34 25.01882057716437 26.062735257214552 24.707653701380174 24.2107904642409 35-39 25.501806503412283 25.853071055800886 25.14050582095544 23.504616619831392 40-44 25.471982325768227 25.366539465756176 25.54227756577626 23.619200642699337 45-49 25.186932302905607 25.56330606714508 25.00627289607066 24.243488733878657 50-54 24.584567498368394 25.889853908328732 25.558511973492642 23.967066619810232 55-59 25.623651056567788 25.774230788535863 24.936003613913567 23.666114540982782 60-64 25.10414052697616 25.917189460476784 25.209535759096614 23.76913425345044 65-69 24.949809275245936 25.702670146556915 25.70768921903232 23.639831359164827 70-74 25.34029835752675 26.359937716610577 25.20468129991461 23.095082625948063 75-79 25.783447167537165 25.225994375251105 25.391723583768584 23.59883487344315 80-84 25.454911028450788 25.58057705840957 25.113099426962904 23.851412486176738 85-89 25.59598494353827 25.611041405269763 25.49560853199498 23.29736511919699 90-94 25.76289901626179 25.787994378638828 25.090343304557315 23.35876330054206 95-99 25.67228577162352 25.54685932169376 25.401364639775238 23.379490266907485 100-104 25.593177827940806 25.70353649360421 25.82392776523702 22.87935791321796 105-109 25.683197111768543 26.550669407812265 24.810710524996242 22.955422955422954 110-114 26.414242728184554 25.86760280842528 25.140421263791374 22.577733199598796 115-119 26.886626886626885 25.994083136940283 24.394524394524396 22.72476558190844 120-124 26.475311120032114 26.3398233641108 24.744078683259733 22.44078683259735 125-129 26.22309197651663 26.363590747152394 24.878318029002962 22.534999247328013 130-134 26.719204899106515 26.22226684067865 24.95733360104407 22.101194659170766 135-139 26.934083036297 26.878859380490987 24.6197098247904 21.567347758421608 140-144 27.74148155593527 26.228766710222136 24.655744295909138 21.37400743793346 145-149 27.67219708396179 27.003519356460533 24.444444444444443 20.879839115133233 150-151 27.69327467001886 27.341294783155245 24.676304211187933 20.289126335637963 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 10.0 1 5.5 2 1.5 3 1.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 1.0 24 1.0 25 1.0 26 2.0 27 3.0 28 5.0 29 7.5 30 11.5 31 12.5 32 17.5 33 21.0 34 20.5 35 35.0 36 46.0 37 56.5 38 80.5 39 101.5 40 135.0 41 145.5 42 147.0 43 179.0 44 207.5 45 208.5 46 201.0 47 200.0 48 187.0 49 176.5 50 160.0 51 151.0 52 128.5 53 105.5 54 113.5 55 109.0 56 90.0 57 84.0 58 85.0 59 88.5 60 79.5 61 63.5 62 64.0 63 57.5 64 53.5 65 50.5 66 47.0 67 43.0 68 36.5 69 31.5 70 30.0 71 26.0 72 19.0 73 17.0 74 12.0 75 10.0 76 7.5 77 3.5 78 2.0 79 1.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.625 3 0.575 4 0.675 5 0.7250000000000001 6 0.35000000000000003 7 0.525 8 0.575 9 0.35000000000000003 10-14 0.47000000000000003 15-19 0.36 20-24 0.325 25-29 0.345 30-34 0.375 35-39 0.36 40-44 0.42 45-49 0.365 50-54 0.40499999999999997 55-59 0.385 60-64 0.375 65-69 0.38 70-74 0.455 75-79 0.44 80-84 0.53 85-89 0.375 90-94 0.38 95-99 0.33999999999999997 100-104 0.325 105-109 0.28500000000000003 110-114 0.3 115-119 0.28500000000000003 120-124 0.36 125-129 0.35500000000000004 130-134 0.38999999999999996 135-139 0.40499999999999997 140-144 0.51 145-149 0.5499999999999999 150-151 0.5625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01340753857829 97.85000000000001 2 0.9359979762205919 1.8499999999999999 3 0.0 0.0 4 0.025297242600556536 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025297242600556536 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.8875 0.0 0.0 0.0 0.0 94-95 1.225 0.0 0.0 0.0 0.0 96-97 1.5750000000000002 0.0 0.0 0.0 0.0 98-99 1.9375 0.0 0.0 0.0 0.0 100-101 2.2625 0.0 0.0 0.0 0.0 102-103 2.5250000000000004 0.0 0.0 0.0 0.0 104-105 2.9625000000000004 0.0 0.0 0.0 0.0 106-107 3.3375 0.0 0.0 0.0 0.0 108-109 3.675 0.0 0.0 0.0 0.0 110-111 4.175 0.0 0.0 0.0 0.0 112-113 4.6 0.0 0.0 0.0 0.0 114-115 5.075 0.0 0.0 0.0 0.0 116-117 5.675 0.0 0.0 0.0 0.0 118-119 6.2875 0.0 0.0 0.0 0.0 120-121 6.8375 0.0 0.0 0.0 0.0 122-123 7.35 0.0 0.0 0.0 0.0 124-125 7.9625 0.0 0.0 0.0 0.0 126-127 8.6625 0.0 0.0 0.0 0.0 128-129 9.5 0.0 0.0 0.0 0.0 130-131 10.2 0.0 0.0 0.0 0.0 132-133 10.825 0.0 0.0 0.0 0.0 134-135 11.412500000000001 0.0 0.0 0.0 0.0 136-137 12.125 0.0 0.0 0.0 0.0 138-139 12.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCCGCC 10 0.006830828 145.0 6 AAGCAAT 10 0.006830828 145.0 145 >>END_MODULE Read 518492 spots for SRR5579222.sra Written 518492 spots for SRR5579222.sra Read 518492 spots for SRR5579222.sra Written 518492 spots for SRR5579222.sra Read 518492 spots for SRR5579222.sra Written 518492 spots for SRR5579222.sra Read 518492 spots for SRR5579222.sra Written 518492 spots for SRR5579222.sra Read 518492 spots for SRR5579222.sra Written 518492 spots for SRR5579222.sra Read 518492 spots for SRR5579222.sra Written 518492 spots for SRR5579222.sra Read 518492 spots for SRR5579222.sra Written 518492 spots for SRR5579222.sra Read 518492 spots for SRR5579222.sra Written 518492 spots for SRR5579222.sra Read 518492 spots for SRR5579222.sra Written 518492 spots for SRR5579222.sra Read 518492 spots for SRR5579222.sra Written 518492 spots for SRR5579222.sra Read 518492 spots for SRR5579222.sra Written 518492 spots for SRR5579222.sra Read 518492 spots for SRR5579222.sra Written 518492 spots for SRR5579222.sra Read 518492 spots for SRR5579222.sra Written 518492 spots for SRR5579222.sra Read 518492 spots for SRR5579222.sra Written 518492 spots for SRR5579222.sra Read 518492 spots for SRR5579222.sra Written 518492 spots for SRR5579222.sra Read 518492 spots for SRR5579222.sra Written 518492 spots for SRR5579222.sra Read 518492 spots for SRR5579222.sra Written 518492 spots for SRR5579222.sra Read 518492 spots for SRR5579222.sra Written 518492 spots for SRR5579222.sra Read 518492 spots for SRR5579222.sra Written 518492 spots for SRR5579222.sra Read 518492 spots for SRR5579222.sra Written 518492 spots for SRR5579222.sra SRR ids: ['SRR5579222.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5ga5k66y SRR5579222.sra spots: 10369840 blocks: [[1, 518492], [518493, 1036984], [1036985, 1555476], [1555477, 2073968], [2073969, 2592460], [2592461, 3110952], [3110953, 3629444], [3629445, 4147936], [4147937, 4666428], [4666429, 5184920], [5184921, 5703412], [5703413, 6221904], [6221905, 6740396], [6740397, 7258888], [7258889, 7777380], [7777381, 8295872], [8295873, 8814364], [8814365, 9332856], [9332857, 9851348], [9851349, 10369840]] SRR5579222 file size 3492298 SRR5579222 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579222 SRR5579222_1.fastq SRR5579222_2.fastq Input file: SRR5579222_1.fastq Paired file: SRR5579222_2.fastq trimmed: SRR5579222-trimmed-pair1.fastq, SRR5579222-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 22:40:39 2024 >> started Mon Dec 9 22:40:50 2024 >> done (11.512s) 10369840 read pairs processed; of these: 10045 ( 0.10%) short read pairs filtered out after trimming by size control 52402 ( 0.51%) empty read pairs filtered out after trimming by size control 10307393 (99.40%) read pairs available; of these: 5174716 (50.20%) trimmed read pairs available after processing 5132677 (49.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 20 0.00% 19 19 0.00% 20 12 0.00% 21 22 0.00% 22 24 0.00% 23 27 0.00% 24 22 0.00% 25 29 0.00% 26 29 0.00% 27 25 0.00% 28 18 0.00% 29 23 0.00% 30 37 0.00% 31 34 0.00% 32 37 0.00% 33 26 0.00% 34 26 0.00% 35 44 0.00% 36 34 0.00% 37 37 0.00% 38 44 0.00% 39 43 0.00% 40 44 0.00% 41 38 0.00% 42 54 0.00% 43 63 0.00% 44 55 0.00% 45 82 0.00% 46 75 0.00% 47 70 0.00% 48 97 0.00% 49 119 0.00% 50 112 0.00% 51 155 0.00% 52 161 0.00% 53 136 0.00% 54 184 0.00% 55 219 0.00% 56 242 0.00% 57 235 0.00% 58 293 0.00% 59 301 0.00% 60 397 0.00% 61 446 0.00% 62 474 0.00% 63 556 0.01% 64 613 0.01% 65 747 0.01% 66 778 0.01% 67 847 0.01% 68 1018 0.01% 69 1571 0.02% 70 1801 0.02% 71 1643 0.02% 72 1781 0.02% 73 2014 0.02% 74 2127 0.02% 75 2429 0.02% 76 2747 0.03% 77 2970 0.03% 78 3303 0.03% 79 3628 0.04% 80 4290 0.04% 81 5005 0.05% 82 5501 0.05% 83 5972 0.06% 84 6894 0.07% 85 7572 0.07% 86 7825 0.08% 87 8443 0.08% 88 9268 0.09% 89 9924 0.10% 90 10704 0.10% 91 11595 0.11% 92 12730 0.12% 93 13712 0.13% 94 14128 0.14% 95 15005 0.15% 96 15526 0.15% 97 16472 0.16% 98 16825 0.16% 99 17735 0.17% 100 18464 0.18% 101 19818 0.19% 102 21191 0.21% 103 22021 0.21% 104 23013 0.22% 105 23947 0.23% 106 24450 0.24% 107 24864 0.24% 108 25417 0.25% 109 25967 0.25% 110 27084 0.26% 111 28488 0.28% 112 29679 0.29% 113 30821 0.30% 114 32088 0.31% 115 32973 0.32% 116 33079 0.32% 117 33642 0.33% 118 33761 0.33% 119 34455 0.33% 120 35827 0.35% 121 36269 0.35% 122 37955 0.37% 123 39544 0.38% 124 40996 0.40% 125 41348 0.40% 126 42575 0.41% 127 42496 0.41% 128 42360 0.41% 129 43545 0.42% 130 43939 0.43% 131 44963 0.44% 132 46999 0.46% 133 49142 0.48% 134 50341 0.49% 135 52355 0.51% 136 53394 0.52% 137 53712 0.52% 138 55710 0.54% 139 56965 0.55% 140 58218 0.56% 141 61228 0.59% 142 64668 0.63% 143 68725 0.67% 144 75760 0.74% 145 83843 0.81% 146 97079 0.94% 147 123248 1.20% 148 179240 1.74% 149 351912 3.41% 150 2304755 22.36% 151 5132677 49.80% 10307393 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=28 prefix-density=0.48 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=62.83 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=2.3 sequence=CATCAATGGCACTCTCTCACAGCCAATAACTTCAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTGCCACCGAATATTCAGTCCTTTAAGAAATCGAACAGCATACCCAACATAGTAAAAACCATCAATAATGCAAATACCGTTACCACAAGTGCAAATACTCCCAT criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=3.65 fanout-score-rank=23 prefix-density=0.58 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=132.59 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=9.2 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR5579222 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 22:41:45 Started mapping on | Dec 09 22:41:46 Finished on | Dec 09 22:43:53 Mapping speed, Million of reads per hour | 292.18 Number of input reads | 10307393 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 9641167 Uniquely mapped reads % | 93.54% Average mapped length | 289.27 Number of splices: Total | 10444355 Number of splices: Annotated (sjdb) | 9834885 Number of splices: GT/AG | 10308078 Number of splices: GC/AG | 124330 Number of splices: AT/AC | 5218 Number of splices: Non-canonical | 6729 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.36 Insertion rate per base | 0.00% Insertion average length | 1.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 144012 % of reads mapped to multiple loci | 1.40% Number of reads mapped to too many loci | 15895 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.04% % of reads unmapped: other | 0.88% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 530527 530527 530527 N_multimapping 144012 144012 144012 N_noFeature 437955 9331813 568796 N_ambiguous 213459 1560 35178 UnstrandedReadsAssigned:8989753 PositiveStrandReadsAssigned:307794 NegativeStrandReadsAssigned:9037193 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR5579222 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579222-trimmed-pair1.fastq SRR5579222-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,307,393 reads, 9,111,851 reads pseudoaligned [quant] estimated average fragment length: 239.542 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,174 rounds 52973 SRR5579222.ke.tsv 35125 SRR5579222.se.tsv 88098 total ==> SRR5579222.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 698.113 0 0 PNS24247 1044 805.458 31.6511 6.53005 PNS24249 1928 1689.46 24.6229 2.42194 PNS24246 1044 805.458 31.6511 6.53005 PNS24248 1044 805.458 31.6511 6.53005 PNS24244 1471 1232.46 61.4239 8.28202 PNS24243 293 108.825 0 0 KQK14069 1603 1364.46 847.233 103.184 KQK14071 474 255.503 17.1344 11.1441 ==> SRR5579222.se.tsv <== BRADI_1g14170v3 993 BRADI_1g53295v3 131 BRADI_1g59795v3 225 BRADI_1g07683v3 0 BRADI_1g00485v3 21 BRADI_1g20270v3 1022 BRADI_1g74790v3 55 BRADI_1g09890v3 0 BRADI_1g77505v3 202 BRADI_1g48960v3 0 SRR5579222 completed mapping pipeline successfully