Starting /dee2/code/volunteer_pipeline.sh SRR5579223 current disk space = 1522928279552 free memory = 1600623036 SRR5579223 SRAfilesize 59b91812b95625f69e5e76c752ba7c15 SRR5579223.sra SRR5579223.sra file validated SRR5579223 is paired end SRR5579223 is conventional basespace SRR5579223 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579223_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.70775 34.0 33.0 34.0 32.0 34.0 2 33.1905 34.0 33.0 34.0 32.0 34.0 3 33.299 34.0 33.0 34.0 32.0 34.0 4 33.36525 34.0 33.0 34.0 33.0 34.0 5 33.4345 34.0 33.0 34.0 33.0 34.0 6 37.21975 38.0 38.0 38.0 36.0 38.0 7 37.476 38.0 38.0 38.0 37.0 38.0 8 37.5135 38.0 38.0 38.0 38.0 38.0 9 37.588 38.0 38.0 38.0 38.0 38.0 10-14 37.578649999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.55575 38.0 38.0 38.0 38.0 38.0 20-24 37.49444999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.42805 38.0 38.0 38.0 38.0 38.0 30-34 37.36215 38.0 38.0 38.0 37.8 38.0 35-39 37.272200000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.18235 38.0 38.0 38.0 36.8 38.0 45-49 37.09405 38.0 38.0 38.0 36.8 38.0 50-54 37.263549999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.118849999999995 38.0 38.0 38.0 37.0 38.0 60-64 37.1552 38.0 38.0 38.0 37.0 38.0 65-69 36.9077 38.0 38.0 38.0 36.0 38.0 70-74 37.075100000000006 38.0 38.0 38.0 36.4 38.0 75-79 37.050850000000004 38.0 38.0 38.0 36.4 38.0 80-84 37.007749999999994 38.0 38.0 38.0 36.0 38.0 85-89 36.8988 38.0 38.0 38.0 36.0 38.0 90-94 36.8159 38.0 38.0 38.0 35.2 38.0 95-99 36.67665 38.0 38.0 38.0 34.8 38.0 100-104 36.55495 38.0 38.0 38.0 34.4 38.0 105-109 36.4342 38.0 38.0 38.0 34.0 38.0 110-114 36.255700000000004 38.0 38.0 38.0 34.0 38.0 115-119 36.0131 38.0 37.8 38.0 33.2 38.0 120-124 36.17475 38.0 38.0 38.0 34.0 38.0 125-129 36.02295 38.0 37.8 38.0 33.2 38.0 130-134 35.766999999999996 38.0 36.4 38.0 32.2 38.0 135-139 35.53275 38.0 36.0 38.0 31.6 38.0 140-144 35.1158 38.0 36.0 38.0 30.2 38.0 145-149 34.29025 38.0 34.8 38.0 27.4 38.0 150-151 29.119125 35.5 26.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 1.0 6 0.0 7 3.0 8 5.0 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 2.0 15 1.0 16 1.0 17 3.0 18 2.0 19 2.0 20 1.0 21 3.0 22 6.0 23 9.0 24 4.0 25 10.0 26 16.0 27 26.0 28 18.0 29 26.0 30 34.0 31 43.0 32 78.0 33 69.0 34 117.0 35 195.0 36 568.0 37 2754.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.837787774543536 14.448266737232071 8.335538502249271 30.378406985975126 2 23.95 18.75 34.125 23.175 3 21.275 26.575 23.75 28.4 4 27.825 31.424999999999997 19.85 20.9 5 25.374999999999996 33.2 21.65 19.775000000000002 6 20.349999999999998 33.375 22.85 23.425 7 17.9 19.0 41.075 22.025 8 21.625 19.1 26.85 32.425 9 21.05 20.200000000000003 30.425 28.325 10-14 23.285 26.235000000000003 24.38 26.1 15-19 23.89 24.779999999999998 24.605 26.724999999999998 20-24 22.97114855742787 25.011250562528126 25.686284314215712 26.33131656582829 25-29 24.041829280496348 25.242669868908234 24.897428199739817 25.8180726508556 30-34 24.06711745554721 25.259203606311043 24.903581267217632 25.77009767092412 35-39 23.781617831204606 25.269221136989735 24.898572501878288 26.05058852992737 40-44 24.226029455966337 24.882276325017532 25.102695120729386 25.788999098286748 45-49 23.92545837090472 25.498447049393846 24.706943192064923 25.869151387636506 50-54 23.55388471177945 25.087719298245613 25.127819548872182 26.230576441102755 55-59 24.276906110581983 25.02882349992481 24.773171587548248 25.921098801944957 60-64 24.574148296593187 25.06513026052104 24.183366733466936 26.177354709418836 65-69 24.056721952197226 24.983714987222527 24.6479931853485 26.31156987523175 70-74 24.62679090271516 24.010620178338844 24.867247770764454 26.495341148181545 75-79 24.846149997498372 24.646019912943412 24.500925601641065 26.006904487917147 80-84 24.516968665532087 24.531985183702073 24.67714485934528 26.273901291420565 85-89 24.401722238910583 25.393010914188448 24.111344748172627 26.093922098728346 90-94 25.296739620373614 24.810938047778837 24.395252166074023 25.49707016577353 95-99 25.48577724358974 24.689503205128204 24.19871794871795 25.626001602564102 100-104 25.27269088361853 24.992494746322425 23.606524567197038 26.128289802862003 105-109 24.97746619929895 24.69203805708563 24.611917876815223 25.718577866800203 110-114 24.59533951390629 25.10648960160361 24.424956151340517 25.873214733149585 115-119 25.182737558826474 24.957444678081504 24.021227595874635 25.838590167217383 120-124 24.715 24.66 24.08 26.545 125-129 25.115 25.205 23.575 26.105 130-134 24.925 25.64 23.645 25.790000000000003 135-139 25.230000000000004 25.635 22.634999999999998 26.5 140-144 25.1 25.135 23.685000000000002 26.08 145-149 25.369999999999997 25.09 23.400000000000002 26.14 150-151 25.387500000000003 25.137500000000003 23.95 25.525 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 1.0 25 1.5 26 0.5 27 0.5 28 2.0 29 5.0 30 7.5 31 9.0 32 18.0 33 21.0 34 26.0 35 36.5 36 44.5 37 62.0 38 82.0 39 98.5 40 117.0 41 139.5 42 158.0 43 176.0 44 180.0 45 180.0 46 181.5 47 178.0 48 175.5 49 163.0 50 143.5 51 140.5 52 137.0 53 116.5 54 105.5 55 102.0 56 97.0 57 93.5 58 84.5 59 86.0 60 88.5 61 84.0 62 77.5 63 72.5 64 68.0 65 62.5 66 58.5 67 51.0 68 48.5 69 41.5 70 34.0 71 25.5 72 18.5 73 20.5 74 22.5 75 17.0 76 11.5 77 6.0 78 4.5 79 5.5 80 2.5 81 0.5 82 1.0 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.06999999999999999 30-34 0.17500000000000002 35-39 0.17500000000000002 40-44 0.19 45-49 0.19 50-54 0.25 55-59 0.255 60-64 0.2 65-69 0.215 70-74 0.19 75-79 0.065 80-84 0.11 85-89 0.13 90-94 0.165 95-99 0.16 100-104 0.06999999999999999 105-109 0.15 110-114 0.22499999999999998 115-119 0.13 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09044972208186 98.05 2 0.7832238504295099 1.55 3 0.1010611419909045 0.3 4 0.025265285497726126 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.5625 0.0 0.0 0.0 0.0 86-87 0.725 0.0 0.0 0.0 0.0 88-89 0.95 0.0 0.0 0.0 0.0 90-91 1.15 0.0 0.0 0.0 0.0 92-93 1.3250000000000002 0.0 0.0 0.0 0.0 94-95 1.575 0.0 0.0 0.0 0.0 96-97 1.925 0.0 0.0 0.0 0.0 98-99 2.3875 0.0 0.0 0.0 0.0 100-101 2.6875 0.0 0.0 0.0 0.0 102-103 3.0625 0.0 0.0 0.0 0.0 104-105 3.5875000000000004 0.0 0.0 0.0 0.0 106-107 4.0 0.0 0.0 0.0 0.0 108-109 4.6125 0.0 0.0 0.0 0.0 110-111 5.2625 0.0 0.0 0.0 0.0 112-113 5.8625 0.0 0.0 0.0 0.0 114-115 6.2375 0.0 0.0 0.0 0.0 116-117 6.675 0.0 0.0 0.0 0.0 118-119 7.225 0.0 0.0 0.0 0.0 120-121 7.8375 0.0 0.0 0.0 0.0 122-123 8.625 0.0 0.0 0.0 0.0 124-125 9.412500000000001 0.0 0.0 0.0 0.0 126-127 10.175 0.0 0.0 0.0 0.0 128-129 11.125 0.0 0.0 0.0 0.0 130-131 11.975 0.0 0.0 0.0 0.0 132-133 12.875 0.0 0.0 0.0 0.0 134-135 13.6875 0.0 0.0 0.0 0.0 136-137 14.4875 0.0 0.0 0.0 0.0 138-139 15.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5579223 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579223_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.00125 33.0 33.0 34.0 32.0 34.0 2 33.0535 34.0 33.0 34.0 32.0 34.0 3 33.119 34.0 33.0 34.0 32.0 34.0 4 33.0535 34.0 33.0 34.0 32.0 34.0 5 33.068 34.0 33.0 34.0 33.0 34.0 6 37.05675 38.0 38.0 38.0 36.0 38.0 7 37.318 38.0 38.0 38.0 37.0 38.0 8 37.174 38.0 38.0 38.0 37.0 38.0 9 37.202 38.0 38.0 38.0 37.0 38.0 10-14 37.21175 38.0 38.0 38.0 37.2 38.0 15-19 37.1976 38.0 38.0 38.0 37.0 38.0 20-24 37.2351 38.0 38.0 38.0 37.0 38.0 25-29 37.1623 38.0 38.0 38.0 37.0 38.0 30-34 37.2034 38.0 38.0 38.0 37.0 38.0 35-39 37.25865 38.0 38.0 38.0 37.8 38.0 40-44 37.25295 38.0 38.0 38.0 37.4 38.0 45-49 37.215999999999994 38.0 38.0 38.0 37.4 38.0 50-54 37.197500000000005 38.0 38.0 38.0 37.0 38.0 55-59 37.13365 38.0 38.0 38.0 37.0 38.0 60-64 37.0851 38.0 38.0 38.0 37.0 38.0 65-69 36.94775 38.0 38.0 38.0 36.4 38.0 70-74 36.750299999999996 38.0 38.0 38.0 35.8 38.0 75-79 36.7292 38.0 38.0 38.0 35.6 38.0 80-84 36.64855 38.0 38.0 38.0 35.0 38.0 85-89 36.67875 38.0 38.0 38.0 35.0 38.0 90-94 36.67999999999999 38.0 38.0 38.0 35.0 38.0 95-99 36.6278 38.0 38.0 38.0 35.0 38.0 100-104 36.3913 38.0 38.0 38.0 34.2 38.0 105-109 36.227850000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.0184 38.0 38.0 38.0 33.4 38.0 115-119 35.741600000000005 38.0 38.0 38.0 32.6 38.0 120-124 35.3966 38.0 36.6 38.0 31.0 38.0 125-129 34.8829 38.0 36.0 38.0 28.4 38.0 130-134 34.6636 38.0 36.0 38.0 27.8 38.0 135-139 34.062850000000005 38.0 35.0 38.0 24.0 38.0 140-144 33.204750000000004 38.0 33.4 38.0 17.8 38.0 145-149 31.944599999999998 38.0 33.0 38.0 7.8 38.0 150-151 26.302125 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 0.0 5 0.0 6 3.0 7 0.0 8 3.0 9 4.0 10 1.0 11 2.0 12 3.0 13 3.0 14 1.0 15 3.0 16 1.0 17 4.0 18 8.0 19 4.0 20 2.0 21 4.0 22 8.0 23 16.0 24 18.0 25 14.0 26 14.0 27 29.0 28 28.0 29 40.0 30 43.0 31 63.0 32 64.0 33 114.0 34 183.0 35 220.0 36 588.0 37 2504.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.88672168042011 14.628657164291074 10.152538134533634 28.33208302075519 2 26.638319159579787 21.98599299649825 28.939469734867433 22.436218109054526 3 23.905976494123532 24.431107776944234 25.806451612903224 25.85646411602901 4 28.232058014503625 31.607901975493874 17.05426356589147 23.10577644411103 5 28.83941970985493 31.990995497748877 17.70885442721361 21.46073036518259 6 22.825 32.45 19.85 24.875 7 20.825 15.5 38.425 25.25 8 21.75 20.225 24.3 33.725 9 24.05 20.599999999999998 26.375 28.975 10-14 26.07 24.765 22.85 26.314999999999998 15-19 26.16 23.905 24.14 25.795 20-24 26.35 24.33 23.315 26.005 25-29 26.14 24.3 23.755000000000003 25.805 30-34 26.16630831541577 24.536226811340565 23.42117105855293 25.876293814690737 35-39 25.840000000000003 24.425 23.86 25.874999999999996 40-44 27.13 24.240000000000002 23.674999999999997 24.955 45-49 26.345000000000002 24.385 23.419999999999998 25.85 50-54 26.340000000000003 24.43 23.895 25.335 55-59 26.75 24.945 23.119999999999997 25.185000000000002 60-64 26.055 24.044999999999998 24.34 25.56 65-69 26.196309815490775 24.111205560278016 24.201210060503026 25.49127456372819 70-74 26.32263226322632 24.462446244624463 23.85238523852385 25.36253625362536 75-79 26.35 24.099999999999998 23.655 25.895000000000003 80-84 26.46 24.044999999999998 24.055 25.44 85-89 26.445 24.52 24.005000000000003 25.03 90-94 26.779999999999998 24.685000000000002 23.59 24.945 95-99 26.555 24.955 23.724999999999998 24.765 100-104 26.845000000000002 24.295 24.05 24.81 105-109 27.250000000000004 24.66 24.285 23.805 110-114 26.63 25.465 23.515 24.39 115-119 27.13 24.73 23.805 24.335 120-124 27.79 25.345000000000002 23.21 23.655 125-129 28.07 24.915000000000003 23.87 23.145 130-134 27.971398569928496 25.246262313115658 23.546177308865442 23.236161808090404 135-139 28.174226133920087 24.928739310896635 23.723558533780068 23.17347602140321 140-144 28.194999999999997 25.28 23.974999999999998 22.55 145-149 28.452845284528454 25.492549254925496 23.672367236723673 22.38223822382238 150-151 29.862499999999997 25.4625 22.275 22.400000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 1.0 20 1.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.5 27 1.5 28 2.5 29 2.5 30 3.5 31 6.5 32 11.5 33 15.0 34 16.0 35 18.5 36 28.5 37 45.0 38 64.0 39 73.5 40 96.5 41 129.0 42 141.0 43 152.5 44 156.5 45 163.0 46 186.5 47 175.5 48 154.5 49 155.0 50 136.5 51 122.5 52 128.5 53 117.0 54 106.0 55 111.5 56 102.5 57 98.5 58 98.0 59 94.5 60 105.0 61 111.0 62 109.0 63 94.5 64 78.0 65 77.5 66 68.5 67 66.0 68 65.0 69 56.5 70 52.5 71 42.0 72 38.5 73 32.5 74 24.5 75 19.0 76 16.5 77 12.0 78 3.5 79 3.5 80 3.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.05 3 0.025 4 0.025 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.005 70-74 0.01 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.015 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.8619119878604 97.725 2 1.112797167425392 2.1999999999999997 3 0.025290844714213456 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.42500000000000004 0.0 0.0 0.0 0.0 84-85 0.5874999999999999 0.0 0.0 0.0 0.0 86-87 0.75 0.0 0.0 0.0 0.0 88-89 0.975 0.0 0.0 0.0 0.0 90-91 1.1625 0.0 0.0 0.0 0.0 92-93 1.3250000000000002 0.0 0.0 0.0 0.0 94-95 1.575 0.0 0.0 0.0 0.0 96-97 1.925 0.0 0.0 0.0 0.0 98-99 2.3875 0.0 0.0 0.0 0.0 100-101 2.6125 0.0 0.0 0.0 0.0 102-103 2.9625 0.0 0.0 0.0 0.0 104-105 3.4875 0.0 0.0 0.0 0.0 106-107 3.9 0.0 0.0 0.0 0.0 108-109 4.4375 0.0 0.0 0.0 0.0 110-111 5.125 0.0 0.0 0.0 0.0 112-113 5.7875 0.0 0.0 0.0 0.0 114-115 6.2 0.0 0.0 0.0 0.0 116-117 6.6875 0.0 0.0 0.0 0.0 118-119 7.275 0.0 0.0 0.0 0.0 120-121 7.85 0.0 0.0 0.0 0.0 122-123 8.65 0.0 0.0 0.0 0.0 124-125 9.462499999999999 0.0 0.0 0.0 0.0 126-127 10.2625 0.0 0.0 0.0 0.0 128-129 11.225000000000001 0.0 0.0 0.0 0.0 130-131 12.05 0.0 0.0 0.0 0.0 132-133 12.925 0.0 0.0 0.0 0.0 134-135 13.7375 0.0 0.0 0.0 0.0 136-137 14.5375 0.0 0.0 0.0 0.0 138-139 15.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCACCT 10 0.006830828 145.0 1 AAAAAAA 105 0.0011959262 13.809524 145 >>END_MODULE Read 935009 spots for SRR5579223.sra Written 935009 spots for SRR5579223.sra Read 935009 spots for SRR5579223.sra Written 935009 spots for SRR5579223.sra Read 935009 spots for SRR5579223.sra Written 935009 spots for SRR5579223.sra Read 935009 spots for SRR5579223.sra Written 935009 spots for SRR5579223.sra Read 935023 spots for SRR5579223.sra Written 935023 spots for SRR5579223.sra Read 935009 spots for SRR5579223.sra Written 935009 spots for SRR5579223.sra Read 935009 spots for SRR5579223.sra Written 935009 spots for SRR5579223.sra Read 935009 spots for SRR5579223.sra Written 935009 spots for SRR5579223.sra Read 935009 spots for SRR5579223.sra Written 935009 spots for SRR5579223.sra Read 935009 spots for SRR5579223.sra Written 935009 spots for SRR5579223.sra Read 935009 spots for SRR5579223.sra Written 935009 spots for SRR5579223.sra Read 935009 spots for SRR5579223.sra Written 935009 spots for SRR5579223.sra Read 935009 spots for SRR5579223.sra Written 935009 spots for SRR5579223.sra Read 935009 spots for SRR5579223.sra Written 935009 spots for SRR5579223.sra Read 935009 spots for SRR5579223.sra Written 935009 spots for SRR5579223.sra Read 935009 spots for SRR5579223.sra Written 935009 spots for SRR5579223.sra Read 935009 spots for SRR5579223.sra Written 935009 spots for SRR5579223.sra Read 935009 spots for SRR5579223.sra Written 935009 spots for SRR5579223.sra Read 935009 spots for SRR5579223.sra Written 935009 spots for SRR5579223.sra Read 935009 spots for SRR5579223.sra Written 935009 spots for SRR5579223.sra SRR ids: ['SRR5579223.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6kxgbz95 SRR5579223.sra spots: 18700194 blocks: [[1, 935009], [935010, 1870018], [1870019, 2805027], [2805028, 3740036], [3740037, 4675045], [4675046, 5610054], [5610055, 6545063], [6545064, 7480072], [7480073, 8415081], [8415082, 9350090], [9350091, 10285099], [10285100, 11220108], [11220109, 12155117], [12155118, 13090126], [13090127, 14025135], [14025136, 14960144], [14960145, 15895153], [15895154, 16830162], [16830163, 17765171], [17765172, 18700194]] SRR5579223 file size 6315181 SRR5579223 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579223 SRR5579223_1.fastq SRR5579223_2.fastq Input file: SRR5579223_1.fastq Paired file: SRR5579223_2.fastq trimmed: SRR5579223-trimmed-pair1.fastq, SRR5579223-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 22:44:18 2024 >> started Mon Dec 9 22:44:40 2024 >> done (21.893s) 18700194 read pairs processed; of these: 17554 ( 0.09%) short read pairs filtered out after trimming by size control 70157 ( 0.38%) empty read pairs filtered out after trimming by size control 18612483 (99.53%) read pairs available; of these: 10699952 (57.49%) trimmed read pairs available after processing 7912531 (42.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 15 0.00% 20 24 0.00% 21 20 0.00% 22 27 0.00% 23 19 0.00% 24 37 0.00% 25 24 0.00% 26 26 0.00% 27 38 0.00% 28 31 0.00% 29 36 0.00% 30 46 0.00% 31 44 0.00% 32 45 0.00% 33 46 0.00% 34 49 0.00% 35 49 0.00% 36 71 0.00% 37 70 0.00% 38 102 0.00% 39 167 0.00% 40 659 0.00% 41 124 0.00% 42 165 0.00% 43 379 0.00% 44 206 0.00% 45 241 0.00% 46 246 0.00% 47 263 0.00% 48 307 0.00% 49 332 0.00% 50 363 0.00% 51 418 0.00% 52 465 0.00% 53 500 0.00% 54 539 0.00% 55 591 0.00% 56 688 0.00% 57 862 0.00% 58 980 0.01% 59 1116 0.01% 60 1294 0.01% 61 1503 0.01% 62 1632 0.01% 63 1738 0.01% 64 1940 0.01% 65 2163 0.01% 66 2505 0.01% 67 2769 0.01% 68 3220 0.02% 69 3880 0.02% 70 4599 0.02% 71 5102 0.03% 72 5753 0.03% 73 6353 0.03% 74 6754 0.04% 75 7637 0.04% 76 8578 0.05% 77 9194 0.05% 78 10458 0.06% 79 11320 0.06% 80 12474 0.07% 81 14303 0.08% 82 15606 0.08% 83 16579 0.09% 84 19247 0.10% 85 20708 0.11% 86 21608 0.12% 87 23489 0.13% 88 24988 0.13% 89 27170 0.15% 90 28074 0.15% 91 29715 0.16% 92 31512 0.17% 93 33649 0.18% 94 35626 0.19% 95 36981 0.20% 96 38133 0.20% 97 39462 0.21% 98 40726 0.22% 99 42481 0.23% 100 44702 0.24% 101 46934 0.25% 102 49485 0.27% 103 51991 0.28% 104 53733 0.29% 105 54419 0.29% 106 55697 0.30% 107 55772 0.30% 108 57874 0.31% 109 58738 0.32% 110 60142 0.32% 111 62429 0.34% 112 65265 0.35% 113 66481 0.36% 114 69354 0.37% 115 71296 0.38% 116 71507 0.38% 117 72705 0.39% 118 71718 0.39% 119 72232 0.39% 120 75304 0.40% 121 76349 0.41% 122 78511 0.42% 123 81539 0.44% 124 84485 0.45% 125 85646 0.46% 126 86761 0.47% 127 87532 0.47% 128 87119 0.47% 129 88891 0.48% 130 89847 0.48% 131 91503 0.49% 132 95702 0.51% 133 99081 0.53% 134 101396 0.54% 135 105394 0.57% 136 108546 0.58% 137 111665 0.60% 138 115246 0.62% 139 118376 0.64% 140 122755 0.66% 141 129363 0.70% 142 138384 0.74% 143 149570 0.80% 144 165956 0.89% 145 188725 1.01% 146 224254 1.20% 147 286283 1.54% 148 412451 2.22% 149 804821 4.32% 150 4334654 23.29% 151 7912531 42.51% 18612483 reads passed initial QC criterion=sequence-density sequence-density=0.81 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=25 prefix-density=0.83 prefix-fanout=2.1 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCC criterion=fanout-score sequence-density=0.18 sequence-density-rank=28 fanout-score=33.01 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=11.4 sequence=CCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCTTGCCGCCGCTGCAGACGACGGCGAAGTTGGAGCCCCGCCGCGACAGCGACGGCAGGCTCGTCGGCGCCACCAGAGGCGACGTGATCATGGACGCTGCCATCTCGATCTCTCTCTC criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=3.72 fanout-score-rank=8 prefix-density=0.81 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=23.86 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.3 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGG SRR5579223 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 22:45:27 Started mapping on | Dec 09 22:45:27 Finished on | Dec 09 22:47:47 Mapping speed, Million of reads per hour | 478.61 Number of input reads | 18612483 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 17731047 Uniquely mapped reads % | 95.26% Average mapped length | 285.98 Number of splices: Total | 17897085 Number of splices: Annotated (sjdb) | 16961593 Number of splices: GT/AG | 17664082 Number of splices: GC/AG | 210383 Number of splices: AT/AC | 8226 Number of splices: Non-canonical | 14394 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.01% Deletion average length | 1.30 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 169989 % of reads mapped to multiple loci | 0.91% Number of reads mapped to too many loci | 12130 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.39% % of reads unmapped: other | 0.36% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 726980 726980 726980 N_multimapping 169989 169989 169989 N_noFeature 522377 17200616 715925 N_ambiguous 395647 2264 59247 UnstrandedReadsAssigned:16813023 PositiveStrandReadsAssigned:528167 NegativeStrandReadsAssigned:16955875 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=142 echo kmer=137 SRR5579223 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579223-trimmed-pair1.fastq SRR5579223-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,612,483 reads, 17,013,757 reads pseudoaligned [quant] estimated average fragment length: 233.758 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,185 rounds 52973 SRR5579223.ke.tsv 35125 SRR5579223.se.tsv 88098 total ==> SRR5579223.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 703.741 0 0 PNS24247 1044 811.242 42.4246 4.29116 PNS24249 1928 1695.24 101.351 4.90575 PNS24246 1044 811.242 42.4246 4.29116 PNS24248 1044 811.242 42.4246 4.29116 PNS24244 1471 1238.24 44.3749 2.94062 PNS24243 293 113.148 0 0 KQK14069 1603 1370.24 1923.74 115.201 KQK14071 474 259.982 95.0773 30.0083 ==> SRR5579223.se.tsv <== BRADI_1g14170v3 2320 BRADI_1g53295v3 49 BRADI_1g59795v3 541 BRADI_1g07683v3 0 BRADI_1g00485v3 37 BRADI_1g20270v3 2140 BRADI_1g74790v3 67 BRADI_1g09890v3 3 BRADI_1g77505v3 241 BRADI_1g48960v3 0 SRR5579223 completed mapping pipeline successfully