Starting /dee2/code/volunteer_pipeline.sh SRR5579224 current disk space = 1522940325888 free memory = 1564337256 SRR5579224 SRAfilesize 08d8b5a952be35305895535882855ba8 SRR5579224.sra SRR5579224.sra file validated SRR5579224 is paired end SRR5579224 is conventional basespace SRR5579224 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579224_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.1925 34.0 32.0 34.0 2.0 34.0 2 32.259 34.0 32.0 34.0 28.0 34.0 3 32.53475 34.0 32.0 34.0 28.0 34.0 4 32.98025 34.0 33.0 34.0 32.0 34.0 5 33.061 34.0 33.0 34.0 32.0 34.0 6 36.8535 38.0 37.0 38.0 35.0 38.0 7 37.2325 38.0 38.0 38.0 36.0 38.0 8 37.38625 38.0 38.0 38.0 37.0 38.0 9 37.398 38.0 38.0 38.0 37.0 38.0 10-14 37.35475 38.0 38.0 38.0 37.0 38.0 15-19 37.322849999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.3134 38.0 38.0 38.0 37.0 38.0 25-29 37.26335 38.0 38.0 38.0 37.0 38.0 30-34 37.042899999999996 38.0 38.0 38.0 36.2 38.0 35-39 37.13015 38.0 38.0 38.0 36.0 38.0 40-44 36.97095 38.0 38.0 38.0 35.6 38.0 45-49 36.8721 38.0 38.0 38.0 35.0 38.0 50-54 36.81805000000001 38.0 38.0 38.0 35.0 38.0 55-59 36.81564999999999 38.0 38.0 38.0 35.0 38.0 60-64 36.763799999999996 38.0 38.0 38.0 34.6 38.0 65-69 36.60325 38.0 38.0 38.0 34.2 38.0 70-74 36.5606 38.0 38.0 38.0 34.0 38.0 75-79 36.47675 38.0 38.0 38.0 33.8 38.0 80-84 36.421949999999995 38.0 38.0 38.0 34.0 38.0 85-89 36.378949999999996 38.0 38.0 38.0 34.0 38.0 90-94 36.226299999999995 38.0 37.4 38.0 33.4 38.0 95-99 36.0227 38.0 37.2 38.0 32.8 38.0 100-104 35.87355 38.0 37.0 38.0 32.0 38.0 105-109 35.748400000000004 38.0 36.4 38.0 31.2 38.0 110-114 35.66995 38.0 36.4 38.0 31.0 38.0 115-119 35.379149999999996 38.0 36.0 38.0 30.0 38.0 120-124 35.184 38.0 36.0 38.0 29.0 38.0 125-129 35.08965 38.0 35.6 38.0 28.6 38.0 130-134 34.69325 38.0 35.0 38.0 26.8 38.0 135-139 34.3812 38.0 34.8 38.0 25.2 38.0 140-144 33.94655 38.0 35.0 38.0 23.0 38.0 145-149 33.467850000000006 38.0 34.6 38.0 18.8 38.0 150-151 29.839750000000002 36.5 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 2.0 16 5.0 17 6.0 18 2.0 19 6.0 20 4.0 21 10.0 22 12.0 23 10.0 24 12.0 25 15.0 26 21.0 27 31.0 28 38.0 29 51.0 30 57.0 31 73.0 32 99.0 33 115.0 34 184.0 35 295.0 36 738.0 37 2211.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.40694568121104 13.000890471950132 9.943603443158207 35.64856040368062 2 23.325000000000003 19.05 35.475 22.15 3 22.85 24.425 24.15 28.575 4 27.150000000000002 31.225 19.925 21.7 5 26.0 32.25 21.7 20.05 6 21.099999999999998 34.1 22.1 22.7 7 16.775000000000002 19.15 41.475 22.6 8 20.65 19.575 28.275 31.5 9 21.675 18.775 30.55 28.999999999999996 10-14 23.175 26.534999999999997 24.48 25.81 15-19 23.97 24.325 25.485000000000003 26.22 20-24 23.175 25.115 25.895000000000003 25.814999999999998 25-29 23.555 25.180000000000003 25.445 25.82 30-34 24.07 25.385 25.264999999999997 25.28 35-39 23.47 25.305 24.84 26.384999999999998 40-44 24.355 25.509999999999998 24.605 25.53 45-49 23.974999999999998 25.39 24.815 25.82 50-54 23.77 25.095 24.834999999999997 26.3 55-59 24.47 24.83 24.665 26.035000000000004 60-64 24.73 24.795 24.805 25.669999999999998 65-69 24.83 24.595 24.895 25.679999999999996 70-74 23.98 24.81 25.25 25.96 75-79 24.055 24.465 25.0 26.479999999999997 80-84 24.0 25.080000000000002 24.905 26.015 85-89 24.45 23.94 25.445 26.165 90-94 24.695 25.36 24.279999999999998 25.665 95-99 24.490000000000002 24.495 25.119999999999997 25.895000000000003 100-104 25.095 24.52 24.785 25.6 105-109 24.41 25.025 24.25 26.314999999999998 110-114 24.81 25.005 24.224999999999998 25.96 115-119 24.865000000000002 24.625 24.93 25.580000000000002 120-124 24.779999999999998 25.119999999999997 24.075 26.025 125-129 25.185000000000002 24.555 24.25 26.009999999999998 130-134 24.995 25.035 23.7 26.27 135-139 24.4 25.424999999999997 24.08 26.095000000000002 140-144 24.474999999999998 25.295 23.655 26.575 145-149 24.445 25.535000000000004 24.18 25.840000000000003 150-151 24.837500000000002 24.55 24.6125 26.0 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 0.5 27 0.5 28 1.5 29 3.5 30 6.0 31 13.5 32 16.0 33 17.0 34 29.0 35 38.5 36 48.5 37 65.0 38 88.5 39 114.5 40 121.5 41 137.0 42 169.0 43 172.0 44 174.0 45 191.5 46 192.0 47 179.0 48 169.5 49 155.5 50 147.0 51 151.5 52 147.5 53 125.5 54 99.5 55 89.0 56 84.0 57 96.0 58 95.5 59 83.5 60 72.5 61 68.0 62 67.0 63 59.5 64 69.5 65 75.5 66 71.0 67 59.0 68 47.5 69 41.0 70 31.5 71 23.0 72 20.0 73 19.5 74 16.5 75 11.0 76 9.0 77 7.5 78 4.0 79 1.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 15.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.345582683111 98.675 2 0.6292474200855777 1.25 3 0.025169896803423106 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 1.0 0.0 0.0 0.0 0.0 100-101 1.1125 0.0 0.0 0.0 0.0 102-103 1.25 0.0 0.0 0.0 0.0 104-105 1.4625 0.0 0.0 0.0 0.0 106-107 1.6875 0.0 0.0 0.0 0.0 108-109 1.9874999999999998 0.0 0.0 0.0 0.0 110-111 2.2874999999999996 0.0 0.0 0.0 0.0 112-113 2.6625 0.0 0.0 0.0 0.0 114-115 3.0374999999999996 0.0 0.0 0.0 0.0 116-117 3.5 0.0 0.0 0.0 0.0 118-119 3.8375000000000004 0.0 0.0 0.0 0.0 120-121 4.175000000000001 0.0 0.0 0.0 0.0 122-123 4.7 0.0 0.0 0.0 0.0 124-125 5.325 0.0 0.0 0.0 0.0 126-127 5.8625 0.0 0.0 0.0 0.0 128-129 6.4 0.0 0.0 0.0 0.0 130-131 6.975 0.0 0.0 0.0 0.0 132-133 7.7875 0.0 0.0 0.0 0.0 134-135 8.325 0.0 0.0 0.0 0.0 136-137 8.875 0.0 0.0 0.0 0.0 138-139 9.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5579224 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579224_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.33475 33.0 33.0 34.0 31.0 34.0 2 32.595 33.0 33.0 34.0 32.0 34.0 3 32.68225 33.0 33.0 34.0 32.0 34.0 4 32.5095 33.0 33.0 34.0 32.0 34.0 5 32.5375 33.0 33.0 34.0 32.0 34.0 6 36.75575 38.0 38.0 38.0 35.0 38.0 7 36.7855 38.0 38.0 38.0 36.0 38.0 8 36.83125 38.0 38.0 38.0 36.0 38.0 9 36.69725 38.0 38.0 38.0 35.0 38.0 10-14 36.7251 38.0 38.0 38.0 35.4 38.0 15-19 36.6763 38.0 38.0 38.0 35.2 38.0 20-24 36.66154999999999 38.0 38.0 38.0 35.4 38.0 25-29 36.644600000000004 38.0 38.0 38.0 35.4 38.0 30-34 36.554199999999994 38.0 38.0 38.0 35.0 38.0 35-39 36.536150000000006 38.0 38.0 38.0 34.6 38.0 40-44 36.56785 38.0 38.0 38.0 35.0 38.0 45-49 36.57075 38.0 38.0 38.0 35.0 38.0 50-54 36.47615 38.0 38.0 38.0 34.8 38.0 55-59 36.4771 38.0 38.0 38.0 34.6 38.0 60-64 36.41420000000001 38.0 38.0 38.0 34.4 38.0 65-69 36.35275 38.0 38.0 38.0 34.2 38.0 70-74 36.2513 38.0 38.0 38.0 34.0 38.0 75-79 36.2024 38.0 38.0 38.0 34.0 38.0 80-84 36.1718 38.0 38.0 38.0 34.0 38.0 85-89 36.09015 38.0 38.0 38.0 33.4 38.0 90-94 35.9409 38.0 38.0 38.0 33.2 38.0 95-99 35.79165 38.0 38.0 38.0 32.8 38.0 100-104 35.715500000000006 38.0 38.0 38.0 32.4 38.0 105-109 35.554249999999996 38.0 38.0 38.0 31.2 38.0 110-114 35.35504999999999 38.0 37.2 38.0 30.8 38.0 115-119 35.14615 38.0 36.6 38.0 28.6 38.0 120-124 35.0096 38.0 36.0 38.0 28.4 38.0 125-129 34.7118 38.0 36.0 38.0 26.4 38.0 130-134 34.437850000000005 38.0 35.6 38.0 24.4 38.0 135-139 34.126050000000006 38.0 35.0 38.0 23.0 38.0 140-144 33.65 38.0 35.0 38.0 19.0 38.0 145-149 32.75265 38.0 34.0 38.0 11.2 38.0 150-151 28.72475 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 5.0 4 3.0 5 4.0 6 2.0 7 1.0 8 4.0 9 3.0 10 0.0 11 3.0 12 2.0 13 6.0 14 6.0 15 4.0 16 7.0 17 5.0 18 7.0 19 6.0 20 9.0 21 10.0 22 10.0 23 11.0 24 22.0 25 21.0 26 35.0 27 34.0 28 43.0 29 47.0 30 53.0 31 63.0 32 88.0 33 118.0 34 134.0 35 222.0 36 475.0 37 2520.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.225 13.725000000000001 12.45 32.6 2 27.275 21.3 29.325000000000003 22.1 3 23.9 23.549999999999997 25.525 27.025 4 28.449999999999996 30.325000000000003 18.975 22.25 5 28.525 32.425 18.2 20.849999999999998 6 22.425 35.6 18.475 23.5 7 21.224999999999998 14.625 38.550000000000004 25.6 8 22.7 20.275000000000002 24.55 32.475 9 24.625 21.125 25.124999999999996 29.125 10-14 25.319999999999997 24.435000000000002 23.03 27.215 15-19 25.665 24.18 23.955000000000002 26.200000000000003 20-24 25.795 24.495 23.525 26.185000000000002 25-29 25.855 24.959999999999997 23.705000000000002 25.480000000000004 30-34 25.509999999999998 24.7 23.905 25.885 35-39 26.56 24.25 23.35 25.840000000000003 40-44 25.929999999999996 24.67 23.865 25.535000000000004 45-49 26.424999999999997 23.94 23.905 25.729999999999997 50-54 26.555 24.54 24.18 24.725 55-59 26.715 24.075 23.400000000000002 25.81 60-64 26.584999999999997 24.395 23.685000000000002 25.335 65-69 25.8 24.985 24.175 25.040000000000003 70-74 26.185000000000002 24.44 24.32 25.055 75-79 26.31 24.355 24.16 25.174999999999997 80-84 26.58 24.11 23.875 25.435000000000002 85-89 25.945 24.445 24.145 25.465 90-94 26.52 24.365000000000002 24.15 24.965 95-99 26.16 24.16 24.195 25.485000000000003 100-104 26.005 23.810000000000002 24.6 25.585 105-109 26.584999999999997 25.4 23.54 24.474999999999998 110-114 26.52 24.55 24.36 24.57 115-119 26.415 25.1 23.72 24.765 120-124 26.815 25.2 23.43 24.555 125-129 26.884999999999998 25.135 24.035 23.945 130-134 27.955000000000002 25.05 23.5 23.494999999999997 135-139 27.41 25.385 23.31 23.895 140-144 27.445000000000004 25.15 23.865 23.54 145-149 27.815 25.715 23.62 22.85 150-151 28.1125 25.4375 23.575 22.875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.0 28 2.0 29 3.5 30 4.5 31 7.5 32 12.0 33 15.5 34 23.0 35 34.5 36 40.5 37 56.5 38 74.0 39 80.0 40 99.5 41 126.5 42 134.5 43 148.0 44 168.5 45 163.0 46 158.5 47 157.0 48 154.0 49 152.0 50 145.0 51 133.5 52 117.0 53 110.0 54 117.5 55 114.0 56 91.0 57 86.5 58 83.5 59 85.0 60 107.0 61 110.5 62 102.5 63 100.0 64 89.0 65 73.5 66 66.0 67 68.0 68 77.0 69 72.5 70 55.5 71 48.0 72 40.0 73 29.0 74 20.0 75 14.5 76 12.5 77 7.5 78 3.0 79 1.5 80 1.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0126582278481 97.775 2 0.8101265822784811 1.6 3 0.10126582278481014 0.3 4 0.05063291139240507 0.2 5 0.025316455696202535 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAATGGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 1.0 0.0 0.0 0.0 0.0 100-101 1.1625 0.0 0.0 0.0 0.0 102-103 1.3 0.0 0.0 0.0 0.0 104-105 1.525 0.0 0.0 0.0 0.0 106-107 1.7625 0.0 0.0 0.0 0.0 108-109 2.0625 0.0 0.0 0.0 0.0 110-111 2.3875 0.0 0.0 0.0 0.0 112-113 2.775 0.0 0.0 0.0 0.0 114-115 3.1875 0.0 0.0 0.0 0.0 116-117 3.675 0.0 0.0 0.0 0.0 118-119 4.0375 0.0 0.0 0.0 0.0 120-121 4.362500000000001 0.0 0.0 0.0 0.0 122-123 4.9 0.0 0.0 0.0 0.0 124-125 5.5 0.0 0.0 0.0 0.0 126-127 6.0125 0.0 0.0 0.0 0.0 128-129 6.5875 0.0 0.0 0.0 0.0 130-131 7.175 0.0 0.0 0.0 0.0 132-133 7.975 0.0 0.0 0.0 0.0 134-135 8.475 0.0 0.0 0.0 0.0 136-137 8.9875 0.0 0.0 0.0 0.0 138-139 9.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1628150 spots for SRR5579224.sra Written 1628150 spots for SRR5579224.sra Read 1628150 spots for SRR5579224.sra Written 1628150 spots for SRR5579224.sra Read 1628150 spots for SRR5579224.sra Written 1628150 spots for SRR5579224.sra Read 1628150 spots for SRR5579224.sra Written 1628150 spots for SRR5579224.sra Read 1628159 spots for SRR5579224.sra Written 1628159 spots for SRR5579224.sra Read 1628150 spots for SRR5579224.sra Written 1628150 spots for SRR5579224.sra Read 1628150 spots for SRR5579224.sra Written 1628150 spots for SRR5579224.sra Read 1628150 spots for SRR5579224.sra Written 1628150 spots for SRR5579224.sra Read 1628150 spots for SRR5579224.sra Written 1628150 spots for SRR5579224.sra Read 1628150 spots for SRR5579224.sra Written 1628150 spots for SRR5579224.sra Read 1628150 spots for SRR5579224.sra Written 1628150 spots for SRR5579224.sra Read 1628150 spots for SRR5579224.sra Written 1628150 spots for SRR5579224.sra Read 1628150 spots for SRR5579224.sra Written 1628150 spots for SRR5579224.sra Read 1628150 spots for SRR5579224.sra Written 1628150 spots for SRR5579224.sra Read 1628150 spots for SRR5579224.sra Written 1628150 spots for SRR5579224.sra Read 1628150 spots for SRR5579224.sra Written 1628150 spots for SRR5579224.sra Read 1628150 spots for SRR5579224.sra Written 1628150 spots for SRR5579224.sra Read 1628150 spots for SRR5579224.sra Written 1628150 spots for SRR5579224.sra Read 1628150 spots for SRR5579224.sra Written 1628150 spots for SRR5579224.sra Read 1628150 spots for SRR5579224.sra Written 1628150 spots for SRR5579224.sra SRR ids: ['SRR5579224.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qcnryyqa SRR5579224.sra spots: 32563009 blocks: [[1, 1628150], [1628151, 3256300], [3256301, 4884450], [4884451, 6512600], [6512601, 8140750], [8140751, 9768900], [9768901, 11397050], [11397051, 13025200], [13025201, 14653350], [14653351, 16281500], [16281501, 17909650], [17909651, 19537800], [19537801, 21165950], [21165951, 22794100], [22794101, 24422250], [24422251, 26050400], [26050401, 27678550], [27678551, 29306700], [29306701, 30934850], [30934851, 32563009]] SRR5579224 file size 11012834 SRR5579224 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579224 SRR5579224_1.fastq SRR5579224_2.fastq Input file: SRR5579224_1.fastq Paired file: SRR5579224_2.fastq trimmed: SRR5579224-trimmed-pair1.fastq, SRR5579224-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 22:46:58 2024 >> started Mon Dec 9 22:47:36 2024 >> done (38.718s) 32563009 read pairs processed; of these: 65710 ( 0.20%) short read pairs filtered out after trimming by size control 61915 ( 0.19%) empty read pairs filtered out after trimming by size control 32435384 (99.61%) read pairs available; of these: 14637694 (45.13%) trimmed read pairs available after processing 17797690 (54.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 19 0.00% 20 12 0.00% 21 15 0.00% 22 13 0.00% 23 17 0.00% 24 13 0.00% 25 16 0.00% 26 25 0.00% 27 23 0.00% 28 16 0.00% 29 23 0.00% 30 39 0.00% 31 32 0.00% 32 26 0.00% 33 35 0.00% 34 41 0.00% 35 40 0.00% 36 44 0.00% 37 54 0.00% 38 54 0.00% 39 68 0.00% 40 95 0.00% 41 74 0.00% 42 111 0.00% 43 105 0.00% 44 99 0.00% 45 130 0.00% 46 142 0.00% 47 173 0.00% 48 201 0.00% 49 219 0.00% 50 238 0.00% 51 284 0.00% 52 329 0.00% 53 341 0.00% 54 395 0.00% 55 439 0.00% 56 469 0.00% 57 572 0.00% 58 702 0.00% 59 738 0.00% 60 898 0.00% 61 965 0.00% 62 1070 0.00% 63 1201 0.00% 64 1417 0.00% 65 1570 0.00% 66 1703 0.01% 67 1982 0.01% 68 2378 0.01% 69 2834 0.01% 70 3131 0.01% 71 3451 0.01% 72 3921 0.01% 73 4415 0.01% 74 4770 0.01% 75 5421 0.02% 76 6010 0.02% 77 6501 0.02% 78 7360 0.02% 79 8602 0.03% 80 9748 0.03% 81 10847 0.03% 82 12479 0.04% 83 13747 0.04% 84 17388 0.05% 85 20010 0.06% 86 20472 0.06% 87 22022 0.07% 88 23096 0.07% 89 24241 0.07% 90 26218 0.08% 91 28334 0.09% 92 30282 0.09% 93 32531 0.10% 94 34485 0.11% 95 36096 0.11% 96 38245 0.12% 97 40162 0.12% 98 40931 0.13% 99 43743 0.13% 100 45573 0.14% 101 48060 0.15% 102 51700 0.16% 103 54195 0.17% 104 55900 0.17% 105 58462 0.18% 106 60884 0.19% 107 61212 0.19% 108 63993 0.20% 109 66890 0.21% 110 69023 0.21% 111 71320 0.22% 112 75054 0.23% 113 77970 0.24% 114 81170 0.25% 115 84101 0.26% 116 85873 0.26% 117 87455 0.27% 118 89225 0.28% 119 91694 0.28% 120 94398 0.29% 121 97576 0.30% 122 101088 0.31% 123 105057 0.32% 124 109516 0.34% 125 111541 0.34% 126 114633 0.35% 127 115856 0.36% 128 117008 0.36% 129 120690 0.37% 130 123490 0.38% 131 127496 0.39% 132 133610 0.41% 133 138564 0.43% 134 143752 0.44% 135 149453 0.46% 136 154835 0.48% 137 159675 0.49% 138 165420 0.51% 139 172969 0.53% 140 180264 0.56% 141 191197 0.59% 142 206764 0.64% 143 224489 0.69% 144 251082 0.77% 145 286444 0.88% 146 339645 1.05% 147 430790 1.33% 148 622482 1.92% 149 1144963 3.53% 150 6222018 19.18% 151 17797690 54.87% 32435384 reads passed initial QC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=16 prefix-density=0.91 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.17 sequence-density-rank=28 fanout-score=12.32 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=4.1 sequence=ACTTGCCGGGGACGAAGTTGGTGGC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=3.88 fanout-score-rank=11 prefix-density=0.70 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=22.28 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=4.9 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR5579224 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 22:48:30 Started mapping on | Dec 09 22:48:30 Finished on | Dec 09 22:52:53 Mapping speed, Million of reads per hour | 443.98 Number of input reads | 32435384 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 30400199 Uniquely mapped reads % | 93.73% Average mapped length | 291.38 Number of splices: Total | 31753156 Number of splices: Annotated (sjdb) | 29955331 Number of splices: GT/AG | 31336626 Number of splices: GC/AG | 380471 Number of splices: AT/AC | 14826 Number of splices: Non-canonical | 21233 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 450905 % of reads mapped to multiple loci | 1.39% Number of reads mapped to too many loci | 81245 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.26% % of reads unmapped: other | 1.37% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1622762 1622762 1622762 N_multimapping 450905 450905 450905 N_noFeature 1115543 29494038 1414247 N_ambiguous 720033 4443 113106 UnstrandedReadsAssigned:28564623 PositiveStrandReadsAssigned:901718 NegativeStrandReadsAssigned:28872846 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR5579224 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579224-trimmed-pair1.fastq SRR5579224-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,435,384 reads, 29,057,465 reads pseudoaligned [quant] estimated average fragment length: 258.052 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,147 rounds 52973 SRR5579224.ke.tsv 35125 SRR5579224.se.tsv 88098 total ==> SRR5579224.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 679.565 0 0 PNS24247 1044 786.948 65.5049 3.99486 PNS24249 1928 1670.95 154.763 4.44506 PNS24246 1044 786.948 65.5049 3.99486 PNS24248 1044 786.948 65.5049 3.99486 PNS24244 1471 1213.95 88.7224 3.50757 PNS24243 293 102.267 0 0 KQK14069 1603 1345.95 5977.97 213.157 KQK14071 474 241.426 158.739 31.5553 ==> SRR5579224.se.tsv <== BRADI_1g14170v3 6803 BRADI_1g53295v3 134 BRADI_1g59795v3 879 BRADI_1g07683v3 0 BRADI_1g00485v3 54 BRADI_1g20270v3 4610 BRADI_1g74790v3 220 BRADI_1g09890v3 4 BRADI_1g77505v3 444 BRADI_1g48960v3 0 SRR5579224 completed mapping pipeline successfully