Starting /dee2/code/volunteer_pipeline.sh SRR5579225 current disk space = 1522955198464 free memory = 1426218880 SRR5579225 SRAfilesize 668c3783035a3741fa6f9714b53a2250 SRR5579225.sra SRR5579225.sra file validated SRR5579225 is paired end SRR5579225 is conventional basespace SRR5579225 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579225_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.50075 34.0 33.0 34.0 18.0 34.0 2 32.87725 34.0 33.0 34.0 28.0 34.0 3 33.04575 34.0 33.0 34.0 32.0 34.0 4 33.31575 34.0 33.0 34.0 32.0 34.0 5 33.36775 34.0 33.0 34.0 33.0 34.0 6 37.1665 38.0 38.0 38.0 36.0 38.0 7 37.452 38.0 38.0 38.0 37.0 38.0 8 37.52025 38.0 38.0 38.0 38.0 38.0 9 37.4295 38.0 38.0 38.0 38.0 38.0 10-14 37.532650000000004 38.0 38.0 38.0 37.8 38.0 15-19 37.477199999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.305499999999995 38.0 38.0 38.0 37.0 38.0 25-29 37.28150000000001 38.0 38.0 38.0 37.0 38.0 30-34 37.2094 38.0 38.0 38.0 37.0 38.0 35-39 37.07815 38.0 38.0 38.0 36.4 38.0 40-44 36.8968 38.0 38.0 38.0 35.6 38.0 45-49 37.0475 38.0 38.0 38.0 36.0 38.0 50-54 37.273599999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.2152 38.0 38.0 38.0 36.6 38.0 60-64 37.21525 38.0 38.0 38.0 36.6 38.0 65-69 36.8721 38.0 38.0 38.0 35.4 38.0 70-74 36.968399999999995 38.0 38.0 38.0 35.8 38.0 75-79 36.83645 38.0 38.0 38.0 35.4 38.0 80-84 36.70085 38.0 38.0 38.0 34.8 38.0 85-89 36.795049999999996 38.0 38.0 38.0 34.8 38.0 90-94 36.55945 38.0 38.0 38.0 34.2 38.0 95-99 36.610049999999994 38.0 38.0 38.0 34.6 38.0 100-104 36.0127 38.0 37.4 38.0 32.8 38.0 105-109 36.0003 38.0 37.6 38.0 33.2 38.0 110-114 35.7774 38.0 37.0 38.0 31.8 38.0 115-119 35.5619 38.0 36.6 38.0 30.4 38.0 120-124 35.5426 38.0 36.2 38.0 31.0 38.0 125-129 35.43920000000001 38.0 36.0 38.0 30.2 38.0 130-134 35.2247 38.0 35.8 38.0 29.6 38.0 135-139 35.1377 38.0 35.8 38.0 29.2 38.0 140-144 34.876799999999996 38.0 35.4 38.0 28.0 38.0 145-149 34.105599999999995 38.0 33.6 38.0 25.6 38.0 150-151 29.58925 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 2.0 11 0.0 12 0.0 13 1.0 14 1.0 15 1.0 16 4.0 17 1.0 18 2.0 19 5.0 20 6.0 21 9.0 22 5.0 23 8.0 24 9.0 25 9.0 26 20.0 27 25.0 28 36.0 29 37.0 30 43.0 31 68.0 32 73.0 33 92.0 34 150.0 35 253.0 36 603.0 37 2536.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.128480838158254 13.675213675213676 8.271298593879239 35.925006892748826 2 24.05 18.175 35.425000000000004 22.35 3 20.625 24.725 24.4 30.25 4 28.175 31.874999999999996 18.7 21.25 5 25.275 32.550000000000004 22.025 20.150000000000002 6 19.400000000000002 33.900000000000006 24.425 22.275 7 17.150000000000002 19.3 41.05 22.5 8 20.05 20.775 27.450000000000003 31.724999999999998 9 21.775 19.3 31.525 27.400000000000002 10-14 23.075000000000003 26.22 24.834999999999997 25.869999999999997 15-19 23.415 24.69 25.14 26.755000000000003 20-24 23.460865216304075 25.701425356339087 25.166291572893222 25.67141785446362 25-29 23.387338733873385 25.38253825382538 25.71257125712571 25.517551755175518 30-34 23.575 24.965 25.580000000000002 25.88 35-39 23.775 24.585 25.525 26.115 40-44 23.9 25.145 25.19 25.765 45-49 24.147414741474147 24.332433243324335 24.962496249624962 26.55765576557656 50-54 24.355 24.8 24.75 26.095000000000002 55-59 24.10120506025301 25.04625231261563 24.72623631181559 26.126306315315766 60-64 23.938590788618292 24.8887333099965 24.813722058308745 26.35895384307646 65-69 24.007400740074008 24.282428242824285 25.277527752775274 26.432643264326433 70-74 24.131206560328017 24.526226311315565 25.11125556277814 26.23131156557828 75-79 24.185000000000002 24.42 25.255 26.14 80-84 24.45 24.625 24.92 26.005 85-89 24.745 24.685000000000002 24.92 25.650000000000002 90-94 24.42 24.474999999999998 24.709999999999997 26.395000000000003 95-99 25.03 24.345 25.019999999999996 25.605 100-104 24.622386716014805 25.122536761028307 24.617385215564667 25.637691307392217 105-109 24.719775820656526 24.764811849479585 24.1693354683747 26.34607686148919 110-114 24.456114028507127 25.061265316329084 24.846211552888224 25.63640910227557 115-119 25.257525752575255 25.302530253025303 23.907390739073907 25.532553255325535 120-124 24.29 25.240000000000002 24.295 26.174999999999997 125-129 24.825 25.095 23.745 26.334999999999997 130-134 24.77 25.585 23.94 25.705 135-139 24.349999999999998 25.525 23.724999999999998 26.400000000000002 140-144 24.474999999999998 25.22 23.47 26.834999999999997 145-149 24.185000000000002 25.77 23.21 26.834999999999997 150-151 23.8375 26.35 23.2625 26.55 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 1.5 25 1.0 26 1.5 27 3.0 28 3.0 29 3.5 30 6.0 31 8.0 32 9.0 33 13.5 34 23.5 35 33.0 36 53.0 37 73.0 38 85.5 39 100.0 40 115.0 41 135.0 42 152.5 43 166.5 44 181.5 45 188.5 46 199.0 47 199.5 48 187.5 49 168.5 50 151.5 51 147.5 52 134.0 53 118.0 54 108.5 55 103.5 56 101.5 57 98.5 58 86.5 59 83.5 60 81.0 61 70.0 62 64.0 63 59.5 64 60.0 65 59.5 66 47.5 67 46.0 68 47.0 69 38.5 70 38.5 71 35.0 72 27.5 73 22.5 74 19.0 75 15.0 76 8.5 77 6.5 78 4.5 79 2.0 80 1.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 9.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.025 25-29 0.01 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.01 50-54 0.0 55-59 0.005 60-64 0.015 65-69 0.01 70-74 0.005 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.03 105-109 0.08 110-114 0.025 115-119 0.01 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34492315444696 98.575 2 0.5542957923910304 1.0999999999999999 3 0.07558578987150416 0.22499999999999998 4 0.02519526329050139 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.21250000000000002 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.325 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.4875 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.6875 0.0 0.0 0.0 0.0 88-89 0.8875 0.0 0.0 0.0 0.0 90-91 1.1 0.0 0.0 0.0 0.0 92-93 1.25 0.0 0.0 0.0 0.0 94-95 1.5750000000000002 0.0 0.0 0.0 0.0 96-97 1.925 0.0 0.0 0.0 0.0 98-99 2.0875 0.0 0.0 0.0 0.0 100-101 2.3875 0.0 0.0 0.0 0.0 102-103 2.7875 0.0 0.0 0.0 0.0 104-105 3.3 0.0 0.0 0.0 0.0 106-107 3.8125 0.0 0.0 0.0 0.0 108-109 4.4375 0.0 0.0 0.0 0.0 110-111 5.025 0.0 0.0 0.0 0.0 112-113 5.5375 0.0 0.0 0.0 0.0 114-115 6.1625 0.0 0.0 0.0 0.0 116-117 6.7375 0.0 0.0 0.0 0.0 118-119 7.3 0.0 0.0 0.0 0.0 120-121 7.8125 0.0 0.0 0.0 0.0 122-123 8.6875 0.0 0.0 0.0 0.0 124-125 9.399999999999999 0.0 0.0 0.0 0.0 126-127 10.0 0.0 0.0 0.0 0.0 128-129 10.6 0.0 0.0 0.0 0.0 130-131 11.3375 0.0 0.0 0.0 0.0 132-133 12.0375 0.0 0.0 0.0 0.0 134-135 12.7 0.0 0.0 0.0 0.0 136-137 13.6875 0.0 0.0 0.0 0.0 138-139 14.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5579225 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579225_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.581 33.0 33.0 34.0 32.0 34.0 2 32.771 34.0 33.0 34.0 32.0 34.0 3 32.81175 34.0 33.0 34.0 32.0 34.0 4 32.76725 34.0 33.0 34.0 32.0 34.0 5 32.6675 34.0 33.0 34.0 32.0 34.0 6 36.8925 38.0 38.0 38.0 36.0 38.0 7 36.9965 38.0 38.0 38.0 36.0 38.0 8 36.83825 38.0 38.0 38.0 36.0 38.0 9 36.86175 38.0 38.0 38.0 36.0 38.0 10-14 36.755700000000004 38.0 38.0 38.0 35.6 38.0 15-19 36.8984 38.0 38.0 38.0 36.2 38.0 20-24 36.8721 38.0 38.0 38.0 36.4 38.0 25-29 36.85055 38.0 38.0 38.0 36.0 38.0 30-34 36.86435 38.0 38.0 38.0 36.2 38.0 35-39 37.028749999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.0036 38.0 38.0 38.0 37.0 38.0 45-49 36.88135 38.0 38.0 38.0 36.4 38.0 50-54 36.835300000000004 38.0 38.0 38.0 36.0 38.0 55-59 36.8155 38.0 38.0 38.0 35.8 38.0 60-64 36.808049999999994 38.0 38.0 38.0 36.0 38.0 65-69 36.630849999999995 38.0 38.0 38.0 35.2 38.0 70-74 36.3115 38.0 38.0 38.0 34.2 38.0 75-79 35.98895 38.0 38.0 38.0 32.4 38.0 80-84 36.11575 38.0 38.0 38.0 33.2 38.0 85-89 36.249849999999995 38.0 38.0 38.0 34.2 38.0 90-94 36.41949999999999 38.0 38.0 38.0 34.2 38.0 95-99 36.3658 38.0 38.0 38.0 34.4 38.0 100-104 36.1554 38.0 38.0 38.0 34.0 38.0 105-109 35.7341 38.0 37.8 38.0 32.4 38.0 110-114 35.67265 38.0 38.0 38.0 32.2 38.0 115-119 35.233799999999995 38.0 37.0 38.0 29.8 38.0 120-124 34.6617 38.0 35.8 38.0 25.6 38.0 125-129 34.31085 38.0 35.0 38.0 23.2 38.0 130-134 34.29995 38.0 35.0 38.0 23.8 38.0 135-139 33.9079 38.0 33.6 38.0 23.2 38.0 140-144 33.3173 38.0 33.0 38.0 19.8 38.0 145-149 32.172000000000004 38.0 33.0 38.0 10.4 38.0 150-151 27.62925 34.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 6.0 4 0.0 5 2.0 6 3.0 7 1.0 8 4.0 9 2.0 10 2.0 11 5.0 12 2.0 13 3.0 14 4.0 15 6.0 16 5.0 17 5.0 18 7.0 19 9.0 20 3.0 21 8.0 22 10.0 23 7.0 24 14.0 25 24.0 26 29.0 27 28.0 28 31.0 29 48.0 30 55.0 31 71.0 32 79.0 33 126.0 34 157.0 35 242.0 36 560.0 37 2430.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.91767068273092 15.48694779116466 11.370481927710843 31.224899598393574 2 27.325144146402607 22.436700927550763 30.50889947355227 19.72925545249436 3 24.579462716545315 23.34923424554356 25.232237007280943 26.83906603063018 4 27.742907356264123 32.81446146121014 17.524479035902583 21.91815214662315 5 26.59974905897114 33.676286072772896 20.02509410288582 19.69887076537014 6 21.451814768460576 34.11764705882353 20.575719649561954 23.85481852315394 7 21.648709596592333 15.710348283638186 37.38411425707843 25.256827862691054 8 22.475570032573287 20.696567276371837 23.352543222250063 33.47531946880481 9 24.036054081121684 20.981472208312468 24.962443665498245 30.020030045067603 10-14 25.598517479715515 25.558449363918662 23.039166583191424 25.803866573174396 15-19 25.830036556662826 24.45290199809705 23.947118032951074 25.76994341228905 20-24 25.544485054824012 24.668302207980773 23.927301857507636 25.859910879687583 25-29 25.771079511315843 24.8598037252153 23.658121369917883 25.710995393550974 30-34 25.967653096990635 24.365329728105753 24.044865054328778 25.62215212057483 35-39 25.882529668018627 24.745881528215914 23.47403735416354 25.897551449601924 40-44 26.793851084071907 24.78093235191027 23.403935706774824 25.021280857243 45-49 26.58557340942083 24.277919607548682 23.887470591179856 25.249036391850627 50-54 26.15923885828743 24.516775162744118 23.970956434651978 25.353029544316474 55-59 26.58519483121306 24.20114194130021 24.100971651808074 25.112691575678653 60-64 25.978059409908333 24.795872363873166 24.11461203225968 25.111456193958826 65-69 26.629264138656517 24.314982718028354 24.1196212994039 24.936131843911234 70-74 26.447895791583164 24.248496993987974 24.438877755511022 24.864729458917836 75-79 25.903825903825904 24.870882013739156 23.928195356766786 25.297096725668155 80-84 26.224249411057087 25.10651095183199 23.783269009072228 24.885970628038695 85-89 25.95691382765531 25.36072144288577 23.872745490981963 24.809619238476955 90-94 26.50904172719531 24.229825176576668 24.56544607523919 24.695687020988828 95-99 26.36878224715724 24.680659219556176 24.259880779441968 24.69067775384461 100-104 27.05829326923077 24.524238782051285 23.567708333333336 24.849759615384613 105-109 27.09648331830478 25.05760945797014 24.055705841098085 23.79020138262699 110-114 27.431234029761008 24.25973245152563 23.954105917130118 24.354927601583245 115-119 26.881666583203966 25.539586358856226 23.866993840452704 23.711753217487104 120-124 27.214904592577753 25.68738418390344 23.69409525717434 23.403615966344468 125-129 27.733787711736994 25.659015736193247 23.458955597875114 23.148240954194648 130-134 28.55352846832398 25.696672012830795 23.386126704089815 22.363672814755414 135-139 28.150523625795458 25.514856942426217 23.84626947938067 22.488349952397655 140-144 28.007415201162384 26.328974397514905 23.147452277168195 22.51615812415452 145-149 27.987972939113003 26.359308443998998 23.392633425206714 22.260085191681284 150-151 28.533834586466167 25.902255639097742 23.972431077694235 21.591478696741856 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.0 28 1.5 29 5.0 30 7.0 31 10.0 32 12.0 33 10.0 34 14.0 35 21.5 36 30.5 37 44.5 38 63.0 39 80.0 40 103.0 41 131.0 42 151.5 43 166.5 44 171.0 45 178.0 46 183.0 47 171.5 48 171.0 49 164.5 50 149.0 51 135.5 52 125.0 53 120.5 54 110.5 55 105.0 56 104.0 57 99.0 58 94.0 59 98.5 60 93.0 61 81.5 62 83.0 63 77.0 64 71.0 65 67.5 66 58.0 67 63.5 68 60.0 69 54.5 70 60.0 71 46.5 72 34.0 73 34.5 74 28.5 75 17.0 76 9.5 77 8.0 78 6.5 79 2.0 80 1.0 81 2.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.27499999999999997 3 0.42500000000000004 4 0.42500000000000004 5 0.375 6 0.125 7 0.22499999999999998 8 0.22499999999999998 9 0.15 10-14 0.16999999999999998 15-19 0.155 20-24 0.135 25-29 0.13999999999999999 30-34 0.145 35-39 0.145 40-44 0.145 45-49 0.11499999999999999 50-54 0.15 55-59 0.16999999999999998 60-64 0.185 65-69 0.185 70-74 0.2 75-79 0.28500000000000003 80-84 0.245 85-89 0.2 90-94 0.185 95-99 0.185 100-104 0.16 105-109 0.19 110-114 0.20500000000000002 115-119 0.155 120-124 0.165 125-129 0.22999999999999998 130-134 0.24 135-139 0.215 140-144 0.20500000000000002 145-149 0.22499999999999998 150-151 0.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26804644119132 98.32499999999999 2 0.6057546693589096 1.2 3 0.10095911155981827 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025239777889954566 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.025 0.0 0.0 0.0 0.025 42-43 0.025 0.0 0.0 0.0 0.025 44-45 0.025 0.0 0.0 0.0 0.025 46-47 0.025 0.0 0.0 0.0 0.025 48-49 0.025 0.0 0.0 0.0 0.025 50-51 0.025 0.0 0.0 0.0 0.025 52-53 0.025 0.0 0.0 0.0 0.025 54-55 0.037500000000000006 0.0 0.0 0.0 0.025 56-57 0.05 0.0 0.0 0.0 0.025 58-59 0.0625 0.0 0.0 0.0 0.025 60-61 0.075 0.0 0.0 0.0 0.025 62-63 0.1 0.0 0.0 0.0 0.025 64-65 0.1 0.0 0.0 0.0 0.025 66-67 0.125 0.0 0.0 0.0 0.025 68-69 0.125 0.0 0.0 0.0 0.025 70-71 0.125 0.0 0.0 0.0 0.025 72-73 0.16249999999999998 0.0 0.0 0.0 0.025 74-75 0.21250000000000002 0.0 0.0 0.0 0.025 76-77 0.25 0.0 0.0 0.0 0.025 78-79 0.3125 0.0 0.0 0.0 0.025 80-81 0.3875 0.0 0.0 0.0 0.025 82-83 0.4625 0.0 0.0 0.0 0.025 84-85 0.525 0.0 0.0 0.0 0.025 86-87 0.6625 0.0 0.0 0.0 0.025 88-89 0.8875 0.0 0.0 0.0 0.025 90-91 1.1124999999999998 0.0 0.0 0.0 0.025 92-93 1.2875 0.0 0.0 0.0 0.025 94-95 1.625 0.0 0.0 0.0 0.025 96-97 2.0 0.0 0.0 0.0 0.025 98-99 2.1625 0.0 0.0 0.0 0.025 100-101 2.45 0.0 0.0 0.0 0.025 102-103 2.8375 0.0 0.0 0.0 0.025 104-105 3.35 0.0 0.0 0.0 0.025 106-107 3.8875 0.0 0.0 0.0 0.025 108-109 4.4875 0.0 0.0 0.0 0.025 110-111 5.0625 0.0 0.0 0.0 0.025 112-113 5.5875 0.0 0.0 0.0 0.025 114-115 6.1875 0.0 0.0 0.0 0.025 116-117 6.7375 0.0 0.0 0.0 0.025 118-119 7.3125 0.0 0.0 0.0 0.025 120-121 7.85 0.0 0.0 0.0 0.025 122-123 8.725 0.0 0.0 0.0 0.025 124-125 9.425 0.0 0.0 0.0 0.025 126-127 9.975 0.0 0.0 0.0 0.025 128-129 10.575 0.0 0.0 0.0 0.025 130-131 11.3 0.0 0.0 0.0 0.025 132-133 11.925 0.0 0.0 0.0 0.025 134-135 12.5625 0.0 0.0 0.0 0.025 136-137 13.537500000000001 0.0 0.0 0.0 0.025 138-139 14.4375 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1451571 spots for SRR5579225.sra Written 1451571 spots for SRR5579225.sra Read 1451571 spots for SRR5579225.sra Written 1451571 spots for SRR5579225.sra Read 1451571 spots for SRR5579225.sra Written 1451571 spots for SRR5579225.sra Read 1451571 spots for SRR5579225.sra Written 1451571 spots for SRR5579225.sra Read 1451571 spots for SRR5579225.sra Written 1451571 spots for SRR5579225.sra Read 1451571 spots for SRR5579225.sra Written 1451571 spots for SRR5579225.sra Read 1451571 spots for SRR5579225.sra Written 1451571 spots for SRR5579225.sra Read 1451571 spots for SRR5579225.sra Written 1451571 spots for SRR5579225.sra Read 1451571 spots for SRR5579225.sra Written 1451571 spots for SRR5579225.sra Read 1451571 spots for SRR5579225.sra Written 1451571 spots for SRR5579225.sra Read 1451571 spots for SRR5579225.sra Written 1451571 spots for SRR5579225.sra Read 1451571 spots for SRR5579225.sra Written 1451571 spots for SRR5579225.sra Read 1451571 spots for SRR5579225.sra Written 1451571 spots for SRR5579225.sra Read 1451571 spots for SRR5579225.sra Written 1451571 spots for SRR5579225.sra Read 1451571 spots for SRR5579225.sra Written 1451571 spots for SRR5579225.sra Read 1451571 spots for SRR5579225.sra Written 1451571 spots for SRR5579225.sra Read 1451571 spots for SRR5579225.sra Written 1451571 spots for SRR5579225.sra Read 1451571 spots for SRR5579225.sra Written 1451571 spots for SRR5579225.sra Read 1451586 spots for SRR5579225.sra Written 1451586 spots for SRR5579225.sra Read 1451571 spots for SRR5579225.sra Written 1451571 spots for SRR5579225.sra SRR ids: ['SRR5579225.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_75u8vzl4 SRR5579225.sra spots: 29031435 blocks: [[1, 1451571], [1451572, 2903142], [2903143, 4354713], [4354714, 5806284], [5806285, 7257855], [7257856, 8709426], [8709427, 10160997], [10160998, 11612568], [11612569, 13064139], [13064140, 14515710], [14515711, 15967281], [15967282, 17418852], [17418853, 18870423], [18870424, 20321994], [20321995, 21773565], [21773566, 23225136], [23225137, 24676707], [24676708, 26128278], [26128279, 27579849], [27579850, 29031435]] SRR5579225 file size 9816100 SRR5579225 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579225 SRR5579225_1.fastq SRR5579225_2.fastq Input file: SRR5579225_1.fastq Paired file: SRR5579225_2.fastq trimmed: SRR5579225-trimmed-pair1.fastq, SRR5579225-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 22:47:48 2024 >> started Mon Dec 9 22:48:40 2024 >> done (52.058s) 29031435 read pairs processed; of these: 45744 ( 0.16%) short read pairs filtered out after trimming by size control 125179 ( 0.43%) empty read pairs filtered out after trimming by size control 28860512 (99.41%) read pairs available; of these: 16039474 (55.58%) trimmed read pairs available after processing 12821038 (44.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 25 0.00% 19 28 0.00% 20 26 0.00% 21 25 0.00% 22 30 0.00% 23 29 0.00% 24 27 0.00% 25 27 0.00% 26 27 0.00% 27 45 0.00% 28 44 0.00% 29 44 0.00% 30 58 0.00% 31 41 0.00% 32 45 0.00% 33 60 0.00% 34 60 0.00% 35 83 0.00% 36 72 0.00% 37 101 0.00% 38 119 0.00% 39 102 0.00% 40 153 0.00% 41 135 0.00% 42 158 0.00% 43 170 0.00% 44 177 0.00% 45 231 0.00% 46 228 0.00% 47 252 0.00% 48 314 0.00% 49 375 0.00% 50 413 0.00% 51 489 0.00% 52 519 0.00% 53 523 0.00% 54 623 0.00% 55 730 0.00% 56 823 0.00% 57 935 0.00% 58 1099 0.00% 59 1254 0.00% 60 1428 0.00% 61 1635 0.01% 62 1730 0.01% 63 2063 0.01% 64 2258 0.01% 65 2478 0.01% 66 2899 0.01% 67 3209 0.01% 68 3896 0.01% 69 5110 0.02% 70 5527 0.02% 71 5652 0.02% 72 6343 0.02% 73 6903 0.02% 74 7419 0.03% 75 8360 0.03% 76 9304 0.03% 77 10339 0.04% 78 11796 0.04% 79 12895 0.04% 80 14333 0.05% 81 16166 0.06% 82 18413 0.06% 83 20290 0.07% 84 23253 0.08% 85 25583 0.09% 86 27423 0.10% 87 29464 0.10% 88 31558 0.11% 89 34317 0.12% 90 36138 0.13% 91 39494 0.14% 92 42397 0.15% 93 44461 0.15% 94 47066 0.16% 95 49202 0.17% 96 51521 0.18% 97 53816 0.19% 98 55807 0.19% 99 60450 0.21% 100 62580 0.22% 101 67168 0.23% 102 68520 0.24% 103 70869 0.25% 104 73090 0.25% 105 76469 0.26% 106 78436 0.27% 107 79006 0.27% 108 81261 0.28% 109 84537 0.29% 110 86431 0.30% 111 89485 0.31% 112 93542 0.32% 113 95866 0.33% 114 99878 0.35% 115 102739 0.36% 116 103440 0.36% 117 105513 0.37% 118 105399 0.37% 119 107588 0.37% 120 110839 0.38% 121 113552 0.39% 122 116328 0.40% 123 121431 0.42% 124 125069 0.43% 125 127085 0.44% 126 129707 0.45% 127 130883 0.45% 128 132096 0.46% 129 134633 0.47% 130 136372 0.47% 131 140239 0.49% 132 145141 0.50% 133 149945 0.52% 134 154112 0.53% 135 161086 0.56% 136 165226 0.57% 137 169715 0.59% 138 176741 0.61% 139 182000 0.63% 140 189259 0.66% 141 200917 0.70% 142 217896 0.75% 143 232686 0.81% 144 259374 0.90% 145 298382 1.03% 146 363128 1.26% 147 451562 1.56% 148 661710 2.29% 149 1267358 4.39% 150 6500070 22.52% 151 12821038 44.42% 28860512 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=3.45 fanout-score-rank=10 prefix-density=0.65 prefix-fanout=3.2 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTACGAGAGGGTCTCGAACTTCTTGATGCCCTCGATCGGCCACACCTGCATGCACCTGATCCTTCCACCGTTG criterion=fanout-score sequence-density=0.17 sequence-density-rank=24 fanout-score=6.91 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=1.6 sequence=TTGATGCCCTCAATTGGCCACACCTG criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=3.79 fanout-score-rank=16 prefix-density=0.72 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=129.07 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=8.3 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR5579225 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 22:49:45 Started mapping on | Dec 09 22:49:45 Finished on | Dec 09 22:54:28 Mapping speed, Million of reads per hour | 367.13 Number of input reads | 28860512 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 27161729 Uniquely mapped reads % | 94.11% Average mapped length | 287.52 Number of splices: Total | 29201843 Number of splices: Annotated (sjdb) | 27479902 Number of splices: GT/AG | 28814139 Number of splices: GC/AG | 354835 Number of splices: AT/AC | 14153 Number of splices: Non-canonical | 18716 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.37 Insertion rate per base | 0.00% Insertion average length | 1.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 386861 % of reads mapped to multiple loci | 1.34% Number of reads mapped to too many loci | 46403 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.53% % of reads unmapped: other | 0.85% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1340686 1340686 1340686 N_multimapping 386861 386861 386861 N_noFeature 932750 26329367 1233045 N_ambiguous 634260 4194 102373 UnstrandedReadsAssigned:25594719 PositiveStrandReadsAssigned:828168 NegativeStrandReadsAssigned:25826311 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=144 echo kmer=139 SRR5579225 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579225-trimmed-pair1.fastq SRR5579225-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,860,512 reads, 26,023,448 reads pseudoaligned [quant] estimated average fragment length: 236.898 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,190 rounds 52973 SRR5579225.ke.tsv 35125 SRR5579225.se.tsv 88098 total ==> SRR5579225.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 700.614 0 0 PNS24247 1044 808.102 82.1168 5.46587 PNS24249 1928 1692.1 146.104 4.6444 PNS24246 1044 808.102 82.1168 5.46587 PNS24248 1044 808.102 82.1168 5.46587 PNS24244 1471 1235.1 93.5451 4.07391 PNS24243 293 110.234 1 0.487951 KQK14069 1603 1367.1 11533.5 453.789 KQK14071 474 256.928 224.239 46.9455 ==> SRR5579225.se.tsv <== BRADI_1g14170v3 12822 BRADI_1g53295v3 127 BRADI_1g59795v3 470 BRADI_1g07683v3 0 BRADI_1g00485v3 54 BRADI_1g20270v3 3930 BRADI_1g74790v3 257 BRADI_1g09890v3 6 BRADI_1g77505v3 509 BRADI_1g48960v3 0 SRR5579225 completed mapping pipeline successfully