Starting /dee2/code/volunteer_pipeline.sh SRR5579226 current disk space = 1522969370624 free memory = 1567479616 SRR5579226 SRAfilesize de8eb096c6d1e846b018e62f4143e815 SRR5579226.sra SRR5579226.sra file validated SRR5579226 is paired end SRR5579226 is conventional basespace SRR5579226 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579226_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.13175 34.0 33.0 34.0 30.0 34.0 2 32.999 34.0 33.0 34.0 30.0 34.0 3 33.12 34.0 33.0 34.0 32.0 34.0 4 33.332 34.0 33.0 34.0 33.0 34.0 5 33.3785 34.0 33.0 34.0 33.0 34.0 6 37.15725 38.0 38.0 38.0 36.0 38.0 7 37.46175 38.0 38.0 38.0 37.0 38.0 8 37.5035 38.0 38.0 38.0 38.0 38.0 9 37.471 38.0 38.0 38.0 38.0 38.0 10-14 37.51935 38.0 38.0 38.0 38.0 38.0 15-19 37.4668 38.0 38.0 38.0 38.0 38.0 20-24 37.3145 38.0 38.0 38.0 37.0 38.0 25-29 37.266999999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.198249999999994 38.0 38.0 38.0 37.0 38.0 35-39 37.08845 38.0 38.0 38.0 36.4 38.0 40-44 36.960800000000006 38.0 38.0 38.0 36.0 38.0 45-49 37.046949999999995 38.0 38.0 38.0 36.2 38.0 50-54 37.2691 38.0 38.0 38.0 37.0 38.0 55-59 37.123 38.0 38.0 38.0 36.4 38.0 60-64 37.1755 38.0 38.0 38.0 36.8 38.0 65-69 36.9145 38.0 38.0 38.0 35.4 38.0 70-74 37.008750000000006 38.0 38.0 38.0 36.0 38.0 75-79 36.873200000000004 38.0 38.0 38.0 35.6 38.0 80-84 36.682849999999995 38.0 38.0 38.0 34.4 38.0 85-89 36.8121 38.0 38.0 38.0 35.0 38.0 90-94 36.553 38.0 38.0 38.0 34.4 38.0 95-99 36.669000000000004 38.0 38.0 38.0 34.8 38.0 100-104 36.0108 38.0 37.6 38.0 32.6 38.0 105-109 36.031699999999994 38.0 37.6 38.0 32.8 38.0 110-114 35.86275 38.0 37.0 38.0 32.4 38.0 115-119 35.71145 38.0 36.6 38.0 31.0 38.0 120-124 35.65555 38.0 36.2 38.0 31.4 38.0 125-129 35.60665 38.0 36.0 38.0 30.8 38.0 130-134 35.3957 38.0 36.0 38.0 30.6 38.0 135-139 35.21725 38.0 36.0 38.0 29.6 38.0 140-144 35.064949999999996 38.0 35.8 38.0 30.2 38.0 145-149 34.43240000000001 38.0 35.0 38.0 28.0 38.0 150-151 29.86025 35.5 27.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 3.0 15 1.0 16 0.0 17 1.0 18 4.0 19 1.0 20 5.0 21 3.0 22 4.0 23 11.0 24 15.0 25 22.0 26 19.0 27 30.0 28 28.0 29 47.0 30 45.0 31 47.0 32 70.0 33 79.0 34 133.0 35 245.0 36 596.0 37 2588.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.73755047106326 13.970390309555855 10.847913862718709 30.444145356662176 2 24.375 18.4 34.075 23.150000000000002 3 21.7 26.25 24.925 27.125 4 26.650000000000002 31.45 20.349999999999998 21.55 5 24.325 32.9 22.325 20.45 6 21.2 32.074999999999996 23.400000000000002 23.325000000000003 7 16.725 19.625 42.725 20.925 8 20.1 19.375 27.675 32.85 9 21.75 18.7 30.25 29.299999999999997 10-14 22.625 26.135 24.89 26.35 15-19 23.89 25.61 24.985 25.515 20-24 23.158105336867905 25.30885810033512 25.734006902415846 25.799029660381134 25-29 22.980341153519085 24.99624831174028 25.811615226852087 26.21179530788855 30-34 23.875 25.345000000000002 24.79 25.990000000000002 35-39 23.630000000000003 24.935 25.474999999999998 25.96 40-44 23.385 24.745 25.995 25.874999999999996 45-49 23.51705511653496 24.57737321196359 25.71771531459438 26.187856356907073 50-54 23.735 25.05 25.124999999999996 26.090000000000003 55-59 23.872161648494547 24.83745123537061 24.7074122236671 26.582974892467742 60-64 23.575609024060828 25.301385623530585 24.811165024260916 26.311840328147667 65-69 23.164632926585316 25.38507701540308 24.83996799359872 26.610322064412884 70-74 23.729745949189837 24.689937987597517 25.375075015003002 26.205241048209643 75-79 24.365000000000002 25.22 24.73 25.685000000000002 80-84 23.355 24.615000000000002 25.535000000000004 26.495 85-89 23.91 24.65 25.324999999999996 26.115 90-94 23.895 24.72 25.480000000000004 25.905 95-99 23.84 24.345 25.374999999999996 26.44 100-104 24.164331465172136 24.224379503602883 25.335268214571656 26.276020816653322 105-109 24.685857321652065 24.921151439299123 24.745932415519402 25.647058823529413 110-114 24.14794054351634 25.12386767429058 24.42320204193984 26.304989740253244 115-119 23.787136140842254 24.34230269080724 25.01750525157547 26.85305591677503 120-124 24.62 24.295 25.05 26.035000000000004 125-129 24.38 25.03 24.65 25.94 130-134 24.095 24.955 24.575 26.375 135-139 24.37 24.915000000000003 24.01 26.705000000000002 140-144 23.875 24.81 24.775 26.540000000000003 145-149 24.099999999999998 24.75 24.665 26.484999999999996 150-151 23.7875 25.5 24.675 26.0375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 1.0 26 1.0 27 2.5 28 6.0 29 6.0 30 6.0 31 10.5 32 15.0 33 17.0 34 27.5 35 36.0 36 40.5 37 62.0 38 94.5 39 99.5 40 109.0 41 137.0 42 158.0 43 173.0 44 178.0 45 177.5 46 178.0 47 187.0 48 185.5 49 167.5 50 168.0 51 164.0 52 138.5 53 125.5 54 115.5 55 116.0 56 107.5 57 104.5 58 108.0 59 95.5 60 83.0 61 71.5 62 65.5 63 60.0 64 63.5 65 60.0 66 45.0 67 36.0 68 38.5 69 40.0 70 31.5 71 25.5 72 16.5 73 10.5 74 10.5 75 8.5 76 3.5 77 1.5 78 1.0 79 0.5 80 2.5 81 2.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.124999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.034999999999999996 25-29 0.045 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.03 50-54 0.0 55-59 0.03 60-64 0.045 65-69 0.02 70-74 0.02 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.08 105-109 0.125 110-114 0.095 115-119 0.03 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09159727479182 98.175 2 0.8831693161746152 1.7500000000000002 3 0.025233409033560434 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.11249999999999999 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.32499999999999996 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.5375000000000001 0.0 0.0 0.0 0.0 100-101 0.5875 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.275 0.0 0.0 0.0 0.0 108-109 1.4874999999999998 0.0 0.0 0.0 0.0 110-111 1.85 0.0 0.0 0.0 0.0 112-113 2.3499999999999996 0.0 0.0 0.0 0.0 114-115 2.6375 0.0 0.0 0.0 0.0 116-117 3.0 0.0 0.0 0.0 0.0 118-119 3.2125000000000004 0.0 0.0 0.0 0.0 120-121 3.5875 0.0 0.0 0.0 0.0 122-123 4.074999999999999 0.0 0.0 0.0 0.0 124-125 4.6 0.0 0.0 0.0 0.0 126-127 5.1875 0.0 0.0 0.0 0.0 128-129 5.6875 0.0 0.0 0.0 0.0 130-131 6.15 0.0 0.0 0.0 0.0 132-133 6.475 0.0 0.0 0.0 0.0 134-135 6.9625 0.0 0.0 0.0 0.0 136-137 7.449999999999999 0.0 0.0 0.0 0.0 138-139 7.949999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5579226 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579226_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.46525 33.0 33.0 34.0 32.0 34.0 2 32.6375 34.0 33.0 34.0 32.0 34.0 3 32.63625 34.0 33.0 34.0 32.0 34.0 4 32.5655 34.0 33.0 34.0 32.0 34.0 5 32.4975 34.0 33.0 34.0 32.0 34.0 6 36.652 38.0 38.0 38.0 36.0 38.0 7 36.81775 38.0 38.0 38.0 36.0 38.0 8 36.62575 38.0 38.0 38.0 36.0 38.0 9 36.70025 38.0 38.0 38.0 36.0 38.0 10-14 36.56505 38.0 38.0 38.0 35.2 38.0 15-19 36.6358 38.0 38.0 38.0 35.8 38.0 20-24 36.623599999999996 38.0 38.0 38.0 35.8 38.0 25-29 36.602450000000005 38.0 38.0 38.0 35.8 38.0 30-34 36.56915 38.0 38.0 38.0 35.6 38.0 35-39 36.784200000000006 38.0 38.0 38.0 36.8 38.0 40-44 36.778299999999994 38.0 38.0 38.0 36.8 38.0 45-49 36.637800000000006 38.0 38.0 38.0 36.0 38.0 50-54 36.59615 38.0 38.0 38.0 36.0 38.0 55-59 36.538050000000005 38.0 38.0 38.0 35.6 38.0 60-64 36.57915 38.0 38.0 38.0 36.0 38.0 65-69 36.376850000000005 38.0 38.0 38.0 35.2 38.0 70-74 36.115300000000005 38.0 38.0 38.0 33.6 38.0 75-79 35.7706 38.0 38.0 38.0 32.2 38.0 80-84 35.863350000000004 38.0 38.0 38.0 32.8 38.0 85-89 35.994800000000005 38.0 38.0 38.0 33.6 38.0 90-94 36.106 38.0 38.0 38.0 34.0 38.0 95-99 36.0577 38.0 38.0 38.0 34.0 38.0 100-104 35.89555 38.0 38.0 38.0 33.8 38.0 105-109 35.610899999999994 38.0 37.8 38.0 32.6 38.0 110-114 35.465199999999996 38.0 38.0 38.0 32.0 38.0 115-119 35.131099999999996 38.0 37.0 38.0 29.6 38.0 120-124 34.5997 38.0 36.0 38.0 25.0 38.0 125-129 34.320499999999996 38.0 35.0 38.0 23.4 38.0 130-134 34.40735000000001 38.0 35.2 38.0 24.4 38.0 135-139 34.105900000000005 38.0 34.8 38.0 24.2 38.0 140-144 33.66995 38.0 33.2 38.0 23.0 38.0 145-149 32.699650000000005 38.0 33.0 38.0 10.6 38.0 150-151 28.217125 35.0 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 30.0 3 8.0 4 6.0 5 4.0 6 4.0 7 2.0 8 1.0 9 3.0 10 6.0 11 4.0 12 1.0 13 2.0 14 6.0 15 5.0 16 7.0 17 3.0 18 9.0 19 8.0 20 6.0 21 10.0 22 8.0 23 11.0 24 17.0 25 22.0 26 21.0 27 30.0 28 29.0 29 41.0 30 33.0 31 54.0 32 88.0 33 96.0 34 122.0 35 216.0 36 572.0 37 2515.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.0729009552539 13.423831070889895 12.518853695324283 28.98441427853193 2 30.158331239004777 20.206081930133198 27.19276200050264 22.44282483035939 3 24.974849094567407 23.767605633802816 27.565392354124747 23.69215291750503 4 27.263581488933603 32.3440643863179 17.857142857142858 22.535211267605636 5 27.19276200050264 32.84744910781603 17.718019602915305 22.241769288766022 6 23.256397390868038 33.09081786251882 18.615153035624687 25.03763171098846 7 20.999748806832454 15.347902537050992 38.25671941723185 25.395629238884705 8 22.95905551369003 20.09545340366742 23.662396382818386 33.28309469982417 9 24.002008536279188 20.56239015817223 25.910118001506405 29.525483304042176 10-14 25.27235302977057 25.27235302977057 23.43491139113409 26.020382549324765 15-19 26.86072772898369 24.77289836888331 23.558343789209534 24.80803011292346 20-24 26.261105255232646 25.272298348642273 23.42518696983386 25.04140942629122 25-29 26.825962552080718 24.627277747101047 23.954620751970282 24.59213894884795 30-34 25.990260555248756 26.055524875746773 23.183894773834027 24.77031979517044 35-39 25.906215483482274 25.16818957726679 23.812631790340397 25.112963148910534 40-44 26.44843859825284 24.761522241188874 23.431067376242595 25.358971784315692 45-49 26.693426994480685 25.449071751128947 23.68289011540391 24.174611138986453 50-54 26.479297365119198 24.888331242158092 23.949811794228356 24.682559598494354 55-59 26.665997087329885 24.355948375433133 24.235424094812434 24.742630442424545 60-64 27.155843503590983 24.07212093817488 24.067098588719805 24.70493696951434 65-69 27.497363266536084 24.021897443624127 24.05203154035458 24.42870774948521 70-74 26.127800663116645 24.01286044408721 25.00251180548578 24.85682708731036 75-79 26.82816505000754 24.667035231441925 23.933256269789418 24.57154344876112 80-84 26.346463022508036 24.55787781350482 23.83942926045016 25.256229903536976 85-89 26.370757180156655 24.467764611367745 24.221731271339628 24.939746937135972 90-94 25.871421396283274 25.16323455549975 24.620793571069814 24.344550477147163 95-99 26.175170751305743 24.799116110887905 24.18642024909602 24.839292888710325 100-104 26.526410925888733 24.83932516569592 23.90038160273147 24.73388230568387 105-109 26.33720054241374 25.03138968409422 23.956606900708152 24.67480287278389 110-114 26.34249259054604 25.463404832470992 23.896116943788616 24.297985633194354 115-119 27.250815967863417 25.086618127039916 23.615365302535775 24.047200602560885 120-124 27.105712277883747 25.52454572834053 23.47655857845598 23.893183415319747 125-129 26.74704848028134 25.234865611655362 24.189902034664655 23.828183873398643 130-134 27.781127524871874 25.30398954878907 23.701135564264895 23.213747362074162 135-139 27.27318396463378 25.540038179443386 24.002813222144077 23.18396463377876 140-144 27.25172050032652 25.518661777264278 23.981514040287337 23.24810368212187 145-149 27.840281265695634 25.695630336514313 23.942742340532398 22.52134605725766 150-151 28.668341708542716 25.778894472361806 22.56281407035176 22.98994974874372 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 6.0 1 3.5 2 1.5 3 2.5 4 2.5 5 1.0 6 0.5 7 1.0 8 0.5 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 1.0 26 2.0 27 2.0 28 2.0 29 3.0 30 4.5 31 8.0 32 9.0 33 13.5 34 22.5 35 30.5 36 40.5 37 50.0 38 62.0 39 69.5 40 80.0 41 113.0 42 134.0 43 149.5 44 161.5 45 164.0 46 167.5 47 168.0 48 162.5 49 157.0 50 154.0 51 142.5 52 134.5 53 134.0 54 129.5 55 120.0 56 109.5 57 109.0 58 111.0 59 107.0 60 108.5 61 102.0 62 99.0 63 92.5 64 74.5 65 70.5 66 72.0 67 69.0 68 62.5 69 55.0 70 44.5 71 33.5 72 23.0 73 13.5 74 9.5 75 7.5 76 5.0 77 2.5 78 4.0 79 2.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5499999999999999 2 0.525 3 0.6 4 0.6 5 0.525 6 0.35000000000000003 7 0.475 8 0.475 9 0.42500000000000004 10-14 0.40499999999999997 15-19 0.375 20-24 0.385 25-29 0.395 30-34 0.40499999999999997 35-39 0.41000000000000003 40-44 0.41000000000000003 45-49 0.35000000000000003 50-54 0.375 55-59 0.43499999999999994 60-64 0.445 65-69 0.445 70-74 0.47000000000000003 75-79 0.515 80-84 0.48 85-89 0.42 90-94 0.44999999999999996 95-99 0.44 100-104 0.42 105-109 0.445 110-114 0.46499999999999997 115-119 0.42500000000000004 120-124 0.38999999999999996 125-129 0.475 130-134 0.49 135-139 0.47000000000000003 140-144 0.46499999999999997 145-149 0.44999999999999996 150-151 0.5 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.15 #Duplication Level Percentage of deduplicated Percentage of total 1 98.72643912379012 96.89999999999999 2 1.0188487009679064 2.0 3 0.15282730514518594 0.44999999999999996 4 0.025471217524197655 0.1 5 0.0 0.0 6 0.025471217524197655 0.15 7 0.0 0.0 8 0.05094243504839531 0.4 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCAAGG 8 0.2 No Hit GCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAATGGCG 8 0.2 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.5375000000000001 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.8500000000000001 0.0 0.0 0.0 0.0 104-105 1.1125 0.0 0.0 0.0 0.0 106-107 1.325 0.0 0.0 0.0 0.0 108-109 1.5375 0.0 0.0 0.0 0.0 110-111 1.875 0.0 0.0 0.0 0.0 112-113 2.375 0.0 0.0 0.0 0.0 114-115 2.7 0.0 0.0 0.0 0.0 116-117 3.0375 0.0 0.0 0.0 0.0 118-119 3.2625 0.0 0.0 0.0 0.0 120-121 3.6625 0.0 0.0 0.0 0.0 122-123 4.1875 0.0 0.0 0.0 0.025 124-125 4.7375 0.0 0.0 0.0 0.025 126-127 5.324999999999999 0.0 0.0 0.0 0.025 128-129 5.8125 0.0 0.0 0.0 0.025 130-131 6.275 0.0 0.0 0.0 0.025 132-133 6.637499999999999 0.0 0.0 0.0 0.025 134-135 7.125 0.0 0.0 0.0 0.025 136-137 7.6375 0.0 0.0 0.0 0.025 138-139 8.15 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1065819 spots for SRR5579226.sra Written 1065819 spots for SRR5579226.sra Read 1065819 spots for SRR5579226.sra Written 1065819 spots for SRR5579226.sra Read 1065819 spots for SRR5579226.sra Written 1065819 spots for SRR5579226.sra Read 1065819 spots for SRR5579226.sra Written 1065819 spots for SRR5579226.sra Read 1065819 spots for SRR5579226.sra Written 1065819 spots for SRR5579226.sra Read 1065820 spots for SRR5579226.sra Written 1065820 spots for SRR5579226.sra Read 1065819 spots for SRR5579226.sra Written 1065819 spots for SRR5579226.sra Read 1065819 spots for SRR5579226.sra Written 1065819 spots for SRR5579226.sra Read 1065819 spots for SRR5579226.sra Written 1065819 spots for SRR5579226.sra Read 1065819 spots for SRR5579226.sra Written 1065819 spots for SRR5579226.sra Read 1065819 spots for SRR5579226.sra Written 1065819 spots for SRR5579226.sra Read 1065819 spots for SRR5579226.sra Written 1065819 spots for SRR5579226.sra Read 1065819 spots for SRR5579226.sra Written 1065819 spots for SRR5579226.sra Read 1065819 spots for SRR5579226.sra Written 1065819 spots for SRR5579226.sra Read 1065819 spots for SRR5579226.sra Written 1065819 spots for SRR5579226.sra Read 1065819 spots for SRR5579226.sra Written 1065819 spots for SRR5579226.sra Read 1065819 spots for SRR5579226.sra Written 1065819 spots for SRR5579226.sra Read 1065819 spots for SRR5579226.sra Written 1065819 spots for SRR5579226.sra Read 1065819 spots for SRR5579226.sra Written 1065819 spots for SRR5579226.sra Read 1065819 spots for SRR5579226.sra Written 1065819 spots for SRR5579226.sra SRR ids: ['SRR5579226.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wyhrgo8p SRR5579226.sra spots: 21316381 blocks: [[1, 1065819], [1065820, 2131638], [2131639, 3197457], [3197458, 4263276], [4263277, 5329095], [5329096, 6394914], [6394915, 7460733], [7460734, 8526552], [8526553, 9592371], [9592372, 10658190], [10658191, 11724009], [11724010, 12789828], [12789829, 13855647], [13855648, 14921466], [14921467, 15987285], [15987286, 17053104], [17053105, 18118923], [18118924, 19184742], [19184743, 20250561], [20250562, 21316381]] SRR5579226 file size 7201721 SRR5579226 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579226 SRR5579226_1.fastq SRR5579226_2.fastq Input file: SRR5579226_1.fastq Paired file: SRR5579226_2.fastq trimmed: SRR5579226-trimmed-pair1.fastq, SRR5579226-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 22:47:43 2024 >> started Mon Dec 9 22:48:07 2024 >> done (24.723s) 21316381 read pairs processed; of these: 41807 ( 0.20%) short read pairs filtered out after trimming by size control 91223 ( 0.43%) empty read pairs filtered out after trimming by size control 21183351 (99.38%) read pairs available; of these: 10953358 (51.71%) trimmed read pairs available after processing 10229993 (48.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 16 0.00% 20 19 0.00% 21 23 0.00% 22 16 0.00% 23 11 0.00% 24 21 0.00% 25 22 0.00% 26 24 0.00% 27 35 0.00% 28 20 0.00% 29 31 0.00% 30 34 0.00% 31 27 0.00% 32 30 0.00% 33 42 0.00% 34 35 0.00% 35 21 0.00% 36 41 0.00% 37 43 0.00% 38 49 0.00% 39 45 0.00% 40 48 0.00% 41 40 0.00% 42 64 0.00% 43 71 0.00% 44 82 0.00% 45 91 0.00% 46 98 0.00% 47 112 0.00% 48 116 0.00% 49 130 0.00% 50 149 0.00% 51 194 0.00% 52 205 0.00% 53 208 0.00% 54 205 0.00% 55 225 0.00% 56 281 0.00% 57 309 0.00% 58 340 0.00% 59 427 0.00% 60 476 0.00% 61 521 0.00% 62 555 0.00% 63 705 0.00% 64 668 0.00% 65 866 0.00% 66 928 0.00% 67 1018 0.00% 68 1207 0.01% 69 1698 0.01% 70 1797 0.01% 71 1839 0.01% 72 2015 0.01% 73 2273 0.01% 74 2619 0.01% 75 2834 0.01% 76 3101 0.01% 77 3454 0.02% 78 3875 0.02% 79 4651 0.02% 80 4949 0.02% 81 5667 0.03% 82 6387 0.03% 83 7158 0.03% 84 9323 0.04% 85 10402 0.05% 86 11165 0.05% 87 11928 0.06% 88 12667 0.06% 89 13726 0.06% 90 14112 0.07% 91 15555 0.07% 92 16688 0.08% 93 17429 0.08% 94 18269 0.09% 95 19495 0.09% 96 20322 0.10% 97 21407 0.10% 98 22684 0.11% 99 24647 0.12% 100 25983 0.12% 101 28438 0.13% 102 28170 0.13% 103 29260 0.14% 104 30838 0.15% 105 32398 0.15% 106 33378 0.16% 107 34130 0.16% 108 35949 0.17% 109 36929 0.17% 110 38192 0.18% 111 40489 0.19% 112 43344 0.20% 113 44286 0.21% 114 46744 0.22% 115 48668 0.23% 116 49744 0.23% 117 51088 0.24% 118 52288 0.25% 119 53826 0.25% 120 55934 0.26% 121 57405 0.27% 122 60084 0.28% 123 63679 0.30% 124 66213 0.31% 125 68079 0.32% 126 70525 0.33% 127 71919 0.34% 128 73520 0.35% 129 75821 0.36% 130 77533 0.37% 131 81420 0.38% 132 84826 0.40% 133 89279 0.42% 134 93176 0.44% 135 97314 0.46% 136 101564 0.48% 137 105911 0.50% 138 111394 0.53% 139 116046 0.55% 140 123634 0.58% 141 133280 0.63% 142 146268 0.69% 143 160415 0.76% 144 181880 0.86% 145 213719 1.01% 146 264502 1.25% 147 338822 1.60% 148 508259 2.40% 149 993069 4.69% 150 5158636 24.35% 151 10229993 48.29% 21183351 reads passed initial QC criterion=sequence-density sequence-density=0.87 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=14 prefix-density=0.91 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.17 sequence-density-rank=30 fanout-score=12.81 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=4.2 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=3.89 fanout-score-rank=11 prefix-density=0.71 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=100.53 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=8.3 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR5579226 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 22:48:57 Started mapping on | Dec 09 22:48:57 Finished on | Dec 09 22:52:20 Mapping speed, Million of reads per hour | 375.67 Number of input reads | 21183351 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 19320350 Uniquely mapped reads % | 91.21% Average mapped length | 292.12 Number of splices: Total | 20051445 Number of splices: Annotated (sjdb) | 18952670 Number of splices: GT/AG | 19792927 Number of splices: GC/AG | 234427 Number of splices: AT/AC | 9724 Number of splices: Non-canonical | 14367 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 447682 % of reads mapped to multiple loci | 2.11% Number of reads mapped to too many loci | 109258 % of reads mapped to too many loci | 0.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.91% % of reads unmapped: other | 3.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1441635 1441635 1441635 N_multimapping 447682 447682 447682 N_noFeature 846990 18727641 1069594 N_ambiguous 434171 2523 65743 UnstrandedReadsAssigned:18039189 PositiveStrandReadsAssigned:590186 NegativeStrandReadsAssigned:18185013 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR5579226 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579226-trimmed-pair1.fastq SRR5579226-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,183,351 reads, 18,341,258 reads pseudoaligned [quant] estimated average fragment length: 258.801 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52973 SRR5579226.ke.tsv 35125 SRR5579226.se.tsv 88098 total ==> SRR5579226.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 678.992 0 0 PNS24247 1044 786.199 50.4748 4.93095 PNS24249 1928 1670.2 40.1765 1.84753 PNS24246 1044 786.199 50.4748 4.93095 PNS24248 1044 786.199 50.4748 4.93095 PNS24244 1471 1213.2 87.3992 5.53304 PNS24243 293 99.5893 0 0 KQK14069 1603 1345.2 233.9 13.3546 KQK14071 474 240.428 0 0 ==> SRR5579226.se.tsv <== BRADI_1g14170v3 256 BRADI_1g53295v3 109 BRADI_1g59795v3 394 BRADI_1g07683v3 0 BRADI_1g00485v3 39 BRADI_1g20270v3 1866 BRADI_1g74790v3 85 BRADI_1g09890v3 5 BRADI_1g77505v3 253 BRADI_1g48960v3 0 SRR5579226 completed mapping pipeline successfully