Starting /dee2/code/volunteer_pipeline.sh SRR5579227
    current disk space = 1522992222208
    free memory = 1471731140 
SRR5579227 SRAfilesize
179634f2ce4a79d80337b9427a5721f7  SRR5579227.sra
SRR5579227.sra file validated
SRR5579227 is paired end
SRR5579227 is conventional basespace
SRR5579227 read1 length is 151 nt
##FastQC	0.11.5
>>Basic Statistics	pass
#Measure	Value
Filename	SRR5579227_1.fastq
File type	Conventional base calls
Encoding	Sanger / Illumina 1.9
Total Sequences	4000
Sequences flagged as poor quality	0
Sequence length	151
%GC	49
>>END_MODULE
>>Per base sequence quality	pass
#Base	Mean	Median	Lower Quartile	Upper Quartile	10th Percentile	90th Percentile
1	32.86825	34.0	34.0	34.0	33.0	34.0
2	33.54075	34.0	34.0	34.0	33.0	34.0
3	33.6375	34.0	34.0	34.0	33.0	34.0
4	33.73325	34.0	34.0	34.0	33.0	34.0
5	33.7275	34.0	34.0	34.0	33.0	34.0
6	37.6595	38.0	38.0	38.0	37.0	38.0
7	37.73225	38.0	38.0	38.0	38.0	38.0
8	37.73175	38.0	38.0	38.0	38.0	38.0
9	37.75225	38.0	38.0	38.0	38.0	38.0
10-14	37.7564	38.0	38.0	38.0	38.0	38.0
15-19	37.7653	38.0	38.0	38.0	38.0	38.0
20-24	37.766999999999996	38.0	38.0	38.0	38.0	38.0
25-29	37.71295	38.0	38.0	38.0	38.0	38.0
30-34	37.7321	38.0	38.0	38.0	38.0	38.0
35-39	37.64185	38.0	38.0	38.0	38.0	38.0
40-44	37.5787	38.0	38.0	38.0	38.0	38.0
45-49	37.5736	38.0	38.0	38.0	38.0	38.0
50-54	37.63205000000001	38.0	38.0	38.0	38.0	38.0
55-59	37.6161	38.0	38.0	38.0	38.0	38.0
60-64	37.6165	38.0	38.0	38.0	38.0	38.0
65-69	37.53789999999999	38.0	38.0	38.0	38.0	38.0
70-74	37.5287	38.0	38.0	38.0	38.0	38.0
75-79	37.42545	38.0	38.0	38.0	38.0	38.0
80-84	37.3741	38.0	38.0	38.0	38.0	38.0
85-89	37.39615	38.0	38.0	38.0	38.0	38.0
90-94	37.364599999999996	38.0	38.0	38.0	37.6	38.0
95-99	37.277	38.0	38.0	38.0	37.4	38.0
100-104	37.123400000000004	38.0	38.0	38.0	36.6	38.0
105-109	37.032599999999995	38.0	38.0	38.0	36.0	38.0
110-114	36.966150000000006	38.0	38.0	38.0	36.0	38.0
115-119	36.93724999999999	38.0	38.0	38.0	35.6	38.0
120-124	36.876	38.0	38.0	38.0	35.0	38.0
125-129	36.7735	38.0	38.0	38.0	35.0	38.0
130-134	36.64309999999999	38.0	38.0	38.0	35.0	38.0
135-139	36.485749999999996	38.0	38.0	38.0	34.6	38.0
140-144	36.2568	38.0	38.0	38.0	33.8	38.0
145-149	35.88375	38.0	38.0	38.0	32.8	38.0
150-151	32.263125	35.5	33.0	38.0	17.5	38.0
>>END_MODULE
>>Per sequence quality scores	pass
#Quality	Count
8	1.0
9	0.0
10	0.0
11	0.0
12	0.0
13	1.0
14	0.0
15	0.0
16	0.0
17	2.0
18	5.0
19	5.0
20	1.0
21	1.0
22	4.0
23	5.0
24	3.0
25	3.0
26	10.0
27	7.0
28	13.0
29	13.0
30	18.0
31	17.0
32	27.0
33	50.0
34	52.0
35	124.0
36	303.0
37	3335.0
>>END_MODULE
>>Per base sequence content	fail
#Base	G	A	T	C
1	48.76859928168291	13.724987172909184	8.902001026167266	28.604412519240636
2	22.825	18.275	34.125	24.775
3	22.975	25.05	24.775	27.200000000000003
4	26.325	29.849999999999998	21.099999999999998	22.725
5	24.349999999999998	33.75	21.075	20.825
6	20.375	32.925	22.3	24.4
7	16.85	20.1	42.525	20.525
8	19.975	22.2	26.150000000000002	31.674999999999997
9	21.275	20.75	30.7	27.275
10-14	23.205000000000002	26.484999999999996	25.080000000000002	25.230000000000004
15-19	23.169999999999998	25.5	25.869999999999997	25.46
20-24	23.186159307965397	25.786289314465723	25.806290314515728	25.221261063053152
25-29	23.425	25.295	25.629999999999995	25.650000000000002
30-34	23.005	25.515	25.505	25.974999999999998
35-39	23.474999999999998	25.124999999999996	25.61	25.790000000000003
40-44	23.18	25.53	25.8	25.490000000000002
45-49	23.89	25.069999999999997	25.445	25.595000000000002
50-54	23.75	25.580000000000002	24.795	25.874999999999996
55-59	23.51	25.03	25.635	25.825
60-64	23.45	25.259999999999998	25.290000000000003	26.0
65-69	23.035	25.580000000000002	25.330000000000002	26.055
70-74	24.654999999999998	24.72	24.654999999999998	25.97
75-79	24.355	25.15	24.755	25.740000000000002
80-84	24.04	25.009999999999998	25.155	25.795
85-89	24.404999999999998	25.224999999999998	25.169999999999998	25.2
90-94	24.32	24.905	24.93	25.845000000000002
95-99	24.474999999999998	25.005	25.0	25.52
100-104	24.934960976585952	25.445267160296176	24.70982589553732	24.909945967580548
105-109	25.187744067287476	25.102633423450488	24.2865725443076	25.42304996495444
110-114	24.489693816289773	25.08505103061837	24.899939963978387	25.525315189113467
115-119	24.245	25.145	24.84	25.77
120-124	24.92	24.505	24.795	25.779999999999998
125-129	24.335	25.135	24.09	26.44
130-134	24.995	25.074999999999996	24.075	25.855
135-139	24.385	25.935000000000002	24.145	25.535000000000004
140-144	24.575	25.03	24.29	26.105
145-149	24.62	25.490000000000002	24.205	25.685000000000002
150-151	24.425	25.4375	23.8125	26.325
>>END_MODULE
>>Per sequence GC content	warn
#GC Content	Count
0	0.0
1	0.0
2	0.0
3	0.0
4	0.0
5	0.0
6	0.0
7	0.0
8	0.0
9	0.0
10	0.0
11	0.5
12	0.5
13	0.0
14	0.0
15	0.0
16	0.0
17	0.0
18	0.0
19	0.0
20	0.0
21	0.0
22	0.0
23	0.0
24	1.0
25	1.0
26	0.5
27	2.0
28	3.5
29	6.0
30	8.0
31	15.0
32	20.5
33	26.0
34	30.0
35	38.5
36	51.5
37	71.5
38	97.0
39	117.5
40	136.0
41	148.0
42	163.0
43	189.5
44	185.0
45	164.5
46	180.0
47	190.5
48	170.0
49	159.0
50	151.5
51	135.0
52	127.5
53	114.5
54	101.0
55	101.5
56	103.5
57	97.0
58	88.5
59	86.5
60	81.0
61	72.0
62	68.0
63	64.5
64	65.5
65	62.0
66	50.0
67	45.5
68	46.5
69	35.5
70	26.5
71	22.0
72	18.0
73	17.0
74	14.0
75	11.0
76	8.5
77	5.0
78	2.5
79	0.5
80	1.0
81	1.0
82	0.0
83	0.0
84	0.0
85	0.0
86	0.0
87	0.0
88	0.0
89	0.0
90	0.0
91	0.0
92	0.0
93	0.0
94	0.0
95	0.0
96	0.0
97	0.0
98	0.0
99	0.0
100	0.0
>>END_MODULE
>>Per base N content	pass
#Base	N-Count
1	2.55
2	0.0
3	0.0
4	0.0
5	0.0
6	0.0
7	0.0
8	0.0
9	0.0
10-14	0.0
15-19	0.0
20-24	0.005
25-29	0.0
30-34	0.0
35-39	0.0
40-44	0.0
45-49	0.0
50-54	0.0
55-59	0.0
60-64	0.0
65-69	0.0
70-74	0.0
75-79	0.0
80-84	0.0
85-89	0.0
90-94	0.0
95-99	0.0
100-104	0.06
105-109	0.13
110-114	0.06
115-119	0.0
120-124	0.0
125-129	0.0
130-134	0.0
135-139	0.0
140-144	0.0
145-149	0.0
150-151	0.0
>>END_MODULE
>>Sequence Length Distribution	pass
#Length	Count
151	4000.0
>>END_MODULE
>>Sequence Duplication Levels	pass
#Total Deduplicated Percentage	98.225
#Duplication Level	Percentage of deduplicated	Percentage of total
1	98.4728938661237	96.72500000000001
2	1.3998472893866123	2.75
3	0.07635530669381523	0.22499999999999998
4	0.025451768897938407	0.1
5	0.0	0.0
6	0.0	0.0
7	0.0	0.0
8	0.025451768897938407	0.2
9	0.0	0.0
>10	0.0	0.0
>50	0.0	0.0
>100	0.0	0.0
>500	0.0	0.0
>1k	0.0	0.0
>5k	0.0	0.0
>10k+	0.0	0.0
>>END_MODULE
>>Overrepresented sequences	warn
#Sequence	Count	Percentage	Possible Source
GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCGAAGATCTCGTATGC	8	0.2	TruSeq Adapter, Index 10 (97% over 36bp)
>>END_MODULE
>>Adapter Content	fail
#Position	Illumina Universal Adapter	Illumina Small RNA 3' Adapter	Illumina Small RNA 5' Adapter	Nextera Transposase Sequence	SOLID Small RNA Adapter
1	0.0	0.0	0.0	0.0	0.0
2	0.0	0.0	0.0	0.0	0.0
3	0.0	0.0	0.0	0.0	0.0
4	0.0	0.0	0.0	0.0	0.0
5	0.0	0.0	0.0	0.0	0.0
6	0.0	0.0	0.0	0.0	0.0
7	0.0	0.0	0.0	0.0	0.0
8	0.0	0.0	0.0	0.0	0.0
9	0.0	0.0	0.0	0.0	0.0
10-11	0.0	0.0	0.0	0.0	0.0
12-13	0.0	0.0	0.0	0.0	0.0
14-15	0.0	0.0	0.0	0.0	0.0
16-17	0.0	0.0	0.0	0.0	0.0
18-19	0.0	0.0	0.0	0.0	0.0
20-21	0.0	0.0	0.0	0.0	0.0
22-23	0.0125	0.0	0.0	0.0	0.0
24-25	0.025	0.0	0.0	0.0	0.0
26-27	0.025	0.0	0.0	0.0	0.0
28-29	0.025	0.0	0.0	0.0	0.0
30-31	0.025	0.0	0.0	0.0	0.0
32-33	0.025	0.0	0.0	0.0	0.0
34-35	0.025	0.0	0.0	0.0	0.0
36-37	0.025	0.0	0.0	0.0	0.0
38-39	0.025	0.0	0.0	0.0	0.0
40-41	0.025	0.0	0.0	0.0	0.0
42-43	0.025	0.0	0.0	0.0	0.0
44-45	0.025	0.0	0.0	0.0	0.0
46-47	0.025	0.0	0.0	0.0	0.0
48-49	0.025	0.0	0.0	0.0	0.0
50-51	0.037500000000000006	0.0	0.0	0.0	0.0
52-53	0.05	0.0	0.0	0.0	0.0
54-55	0.05	0.0	0.0	0.0	0.0
56-57	0.05	0.0	0.0	0.0	0.0
58-59	0.05	0.0	0.0	0.0	0.0
60-61	0.05	0.0	0.0	0.0	0.0
62-63	0.05	0.0	0.0	0.0	0.0
64-65	0.05	0.0	0.0	0.0	0.0
66-67	0.0625	0.0	0.0	0.0	0.0
68-69	0.125	0.0	0.0	0.0	0.0
70-71	0.125	0.0	0.0	0.0	0.0
72-73	0.125	0.0	0.0	0.0	0.0
74-75	0.15	0.0	0.0	0.0	0.0
76-77	0.1875	0.0	0.0	0.0	0.0
78-79	0.21250000000000002	0.0	0.0	0.0	0.0
80-81	0.25	0.0	0.0	0.0	0.0
82-83	0.275	0.0	0.0	0.0	0.0
84-85	0.35	0.0	0.0	0.0	0.0
86-87	0.44999999999999996	0.0	0.0	0.0	0.0
88-89	0.5375	0.0	0.0	0.0	0.0
90-91	0.6375	0.0	0.0	0.0	0.0
92-93	0.7625	0.0	0.0	0.0	0.0
94-95	1.0	0.0	0.0	0.0	0.0
96-97	1.3375	0.0	0.0	0.0	0.0
98-99	1.7375	0.0	0.0	0.0	0.0
100-101	2.0999999999999996	0.0	0.0	0.0	0.0
102-103	2.3125	0.0	0.0	0.0	0.0
104-105	2.6375	0.0	0.0	0.0	0.0
106-107	3.0	0.0	0.0	0.0	0.0
108-109	3.2375	0.0	0.0	0.0	0.0
110-111	3.5625	0.0	0.0	0.0	0.0
112-113	4.0	0.0	0.0	0.0	0.0
114-115	4.4625	0.0	0.0	0.0	0.0
116-117	5.0	0.0	0.0	0.0	0.0
118-119	5.525	0.0	0.0	0.0	0.0
120-121	6.074999999999999	0.0	0.0	0.0	0.0
122-123	6.625	0.0	0.0	0.0	0.0
124-125	7.1125	0.0	0.0	0.0	0.0
126-127	7.775	0.0	0.0	0.0	0.0
128-129	8.4	0.0	0.0	0.0	0.0
130-131	9.075	0.0	0.0	0.0	0.0
132-133	9.7875	0.0	0.0	0.0	0.0
134-135	10.5	0.0	0.0	0.0	0.0
136-137	11.425	0.0	0.0	0.0	0.0
138-139	12.275	0.0	0.0	0.0	0.0
>>END_MODULE
>>Kmer Content	warn
#Sequence	Count	PValue	Obs/Exp Max	Max Obs/Exp Position
CGTCCAT	10	0.0068484643	144.875	5
>>END_MODULE
SRR5579227 read2 length is 151 nt
##FastQC	0.11.5
>>Basic Statistics	pass
#Measure	Value
Filename	SRR5579227_2.fastq
File type	Conventional base calls
Encoding	Sanger / Illumina 1.9
Total Sequences	4000
Sequences flagged as poor quality	0
Sequence length	151
%GC	50
>>END_MODULE
>>Per base sequence quality	pass
#Base	Mean	Median	Lower Quartile	Upper Quartile	10th Percentile	90th Percentile
1	33.188	34.0	33.0	34.0	33.0	34.0
2	33.26075	34.0	33.0	34.0	33.0	34.0
3	33.30925	34.0	33.0	34.0	33.0	34.0
4	33.22925	34.0	33.0	34.0	33.0	34.0
5	33.207	34.0	33.0	34.0	33.0	34.0
6	37.3935	38.0	38.0	38.0	38.0	38.0
7	37.4395	38.0	38.0	38.0	38.0	38.0
8	37.439	38.0	38.0	38.0	38.0	38.0
9	37.3965	38.0	38.0	38.0	38.0	38.0
10-14	37.381550000000004	38.0	38.0	38.0	38.0	38.0
15-19	37.43245	38.0	38.0	38.0	38.0	38.0
20-24	37.3977	38.0	38.0	38.0	38.0	38.0
25-29	37.35845	38.0	38.0	38.0	38.0	38.0
30-34	37.3879	38.0	38.0	38.0	38.0	38.0
35-39	37.38865	38.0	38.0	38.0	38.0	38.0
40-44	37.348349999999996	38.0	38.0	38.0	38.0	38.0
45-49	37.3844	38.0	38.0	38.0	38.0	38.0
50-54	37.3707	38.0	38.0	38.0	38.0	38.0
55-59	37.35045	38.0	38.0	38.0	38.0	38.0
60-64	37.339600000000004	38.0	38.0	38.0	38.0	38.0
65-69	37.27285	38.0	38.0	38.0	38.0	38.0
70-74	37.14525	38.0	38.0	38.0	38.0	38.0
75-79	37.134699999999995	38.0	38.0	38.0	38.0	38.0
80-84	37.112849999999995	38.0	38.0	38.0	38.0	38.0
85-89	37.13934999999999	38.0	38.0	38.0	38.0	38.0
90-94	37.0733	38.0	38.0	38.0	37.4	38.0
95-99	37.03255	38.0	38.0	38.0	37.4	38.0
100-104	36.90305000000001	38.0	38.0	38.0	36.8	38.0
105-109	36.7712	38.0	38.0	38.0	36.0	38.0
110-114	36.784949999999995	38.0	38.0	38.0	35.8	38.0
115-119	36.59475	38.0	38.0	38.0	35.4	38.0
120-124	36.37495	38.0	38.0	38.0	34.8	38.0
125-129	36.2887	38.0	38.0	38.0	34.4	38.0
130-134	36.18724999999999	38.0	38.0	38.0	34.0	38.0
135-139	35.79015	38.0	38.0	38.0	33.2	38.0
140-144	35.506	38.0	38.0	38.0	31.4	38.0
145-149	34.959250000000004	38.0	36.4	38.0	30.4	38.0
150-151	30.941125	35.5	29.5	38.0	16.5	38.0
>>END_MODULE
>>Per sequence quality scores	pass
#Quality	Count
2	16.0
3	3.0
4	2.0
5	1.0
6	1.0
7	1.0
8	1.0
9	1.0
10	1.0
11	0.0
12	0.0
13	0.0
14	1.0
15	3.0
16	4.0
17	10.0
18	1.0
19	6.0
20	2.0
21	4.0
22	7.0
23	6.0
24	4.0
25	8.0
26	10.0
27	9.0
28	9.0
29	14.0
30	12.0
31	24.0
32	31.0
33	63.0
34	56.0
35	126.0
36	356.0
37	3207.0
>>END_MODULE
>>Per base sequence content	fail
#Base	G	A	T	C
1	47.76606425702811	17.093373493975903	10.090361445783133	25.050200803212853
2	27.405174579251444	21.225822657623713	29.264004019090677	22.104998744034162
3	23.832245102963334	23.95781014565545	27.348066298342545	24.861878453038674
4	27.781964330570208	32.554634513941224	17.759356945491085	21.90404420999749
5	28.0251572327044	33.886792452830186	17.61006289308176	20.47798742138365
6	22.567703109327983	33.70110330992979	20.58676028084253	23.1444332998997
7	20.95883534136546	17.143574297188753	36.77208835341366	25.12550200803213
8	22.827724761426417	20.994475138121548	22.903063787041688	33.274736313410344
9	24.404314020566844	20.792575871582645	25.13167795334838	29.67143215450213
10-14	26.115544847663504	25.73909551774331	22.74255885157858	25.402800783014605
15-19	26.01825842696629	25.080256821829856	23.786115569823433	25.115369181380416
20-24	25.99799398194584	25.536609829488466	23.876629889669008	24.58876629889669
25-29	25.956763805988864	24.552339870592366	24.02568089481868	25.46521542860009
30-34	25.82781456953642	25.185631145896046	23.961468994581576	25.025085289985956
35-39	25.31728116378229	24.78053674441936	24.70529219964886	25.19688989214949
40-44	26.529178583973106	24.68764112599729	24.065432284610367	24.71774800541924
45-49	25.93558743854721	24.846995083776463	24.229958864252033	24.9874586134243
50-54	25.651061267499625	25.048923679060664	23.754327863916906	25.545687189522802
55-59	26.342197691921726	24.731560461615654	23.96387355745108	24.96236828901154
60-64	26.05227512165755	25.344905433201227	24.16093914613957	24.441880299001657
65-69	25.568210325623404	25.19191209673373	24.113190507250014	25.126687070392855
70-74	25.823127885966674	24.989961855049188	24.427825737803655	24.759084521180487
75-79	25.499347586068456	25.318679112717053	24.164408310749774	25.01756499046472
80-84	25.507129945772245	24.974894557139987	24.598312914239806	24.919662582847963
85-89	25.776350775096574	25.0990819244469	24.522149199819395	24.602418100637134
90-94	25.650930617568857	24.883359253499222	24.89840967240255	24.567300456529374
95-99	26.083249749247745	25.426278836509532	24.30792377131394	24.182547642928785
100-104	26.00300902708124	25.616850551654963	23.831494483450353	24.54864593781344
105-109	26.031586863875656	25.595387315116568	24.061168212584608	24.311857608423164
110-114	26.450383593240733	25.387353958782533	24.239081381938522	23.92318106603821
115-119	26.57072657072657	25.989068846211705	23.76773805345234	23.672466529609387
120-124	26.67034510433387	25.67215088282504	23.921548956661315	23.735955056179776
125-129	27.32972213862975	25.574280268833384	23.788745109840505	23.30725248269636
130-134	27.198835984145305	25.593296874216044	24.1282424364056	23.079624705233055
135-139	27.496236828901154	25.64475664826894	24.174611138986453	22.68439538384345
140-144	27.648358268902502	25.75057736720554	23.83773471232051	22.763329651571443
145-149	28.044187798142104	26.06577956314336	23.53000251067035	22.360030128044187
150-151	27.516947024855636	26.901832789354756	22.960080341451167	22.62113984433844
>>END_MODULE
>>Per sequence GC content	fail
#GC Content	Count
0	9.0
1	5.5
2	1.5
3	0.5
4	0.0
5	0.5
6	0.5
7	0.0
8	0.0
9	0.0
10	0.0
11	0.0
12	0.0
13	0.0
14	0.0
15	0.0
16	0.0
17	1.0
18	1.0
19	0.0
20	0.0
21	1.0
22	2.5
23	1.5
24	0.0
25	0.0
26	1.0
27	1.0
28	1.5
29	3.0
30	4.0
31	8.5
32	12.0
33	17.5
34	20.5
35	29.0
36	45.0
37	54.5
38	62.0
39	84.0
40	111.0
41	128.0
42	153.0
43	167.5
44	165.0
45	169.0
46	175.5
47	168.5
48	160.0
49	158.0
50	145.5
51	137.0
52	134.0
53	129.5
54	134.0
55	114.5
56	93.5
57	104.5
58	105.5
59	96.5
60	94.5
61	88.0
62	87.0
63	84.0
64	69.5
65	64.0
66	61.0
67	58.5
68	63.5
69	53.5
70	36.0
71	27.5
72	27.0
73	25.5
74	16.5
75	9.5
76	8.0
77	7.5
78	3.0
79	1.0
80	0.5
81	0.0
82	0.0
83	0.0
84	0.0
85	0.0
86	0.0
87	0.0
88	0.0
89	0.5
90	0.5
91	0.0
92	0.0
93	0.0
94	0.0
95	0.0
96	0.0
97	0.0
98	0.0
99	0.0
100	0.0
>>END_MODULE
>>Per base N content	pass
#Base	N-Count
1	0.4
2	0.475
3	0.44999999999999996
4	0.475
5	0.625
6	0.3
7	0.4
8	0.44999999999999996
9	0.325
10-14	0.385
15-19	0.32
20-24	0.3
25-29	0.315
30-34	0.33999999999999997
35-39	0.325
40-44	0.35500000000000004
45-49	0.33
50-54	0.35500000000000004
55-59	0.35000000000000003
60-64	0.335
65-69	0.345
70-74	0.38
75-79	0.37
80-84	0.42
85-89	0.335
90-94	0.335
95-99	0.3
100-104	0.3
105-109	0.27499999999999997
110-114	0.28500000000000003
115-119	0.28500000000000003
120-124	0.32
125-129	0.31
130-134	0.345
135-139	0.35000000000000003
140-144	0.41000000000000003
145-149	0.42500000000000004
150-151	0.42500000000000004
>>END_MODULE
>>Sequence Length Distribution	pass
#Length	Count
151	4000.0
>>END_MODULE
>>Sequence Duplication Levels	pass
#Total Deduplicated Percentage	97.875
#Duplication Level	Percentage of deduplicated	Percentage of total
1	98.41634738186463	96.325
2	1.277139208173691	2.5
3	0.22988505747126436	0.675
4	0.02554278416347382	0.1
5	0.0	0.0
6	0.0	0.0
7	0.0	0.0
8	0.05108556832694764	0.4
9	0.0	0.0
>10	0.0	0.0
>50	0.0	0.0
>100	0.0	0.0
>500	0.0	0.0
>1k	0.0	0.0
>5k	0.0	0.0
>10k+	0.0	0.0
>>END_MODULE
>>Overrepresented sequences	warn
#Sequence	Count	Percentage	Possible Source
GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG	8	0.2	Illumina Single End PCR Primer 1 (100% over 50bp)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN	8	0.2	No Hit
>>END_MODULE
>>Adapter Content	fail
#Position	Illumina Universal Adapter	Illumina Small RNA 3' Adapter	Illumina Small RNA 5' Adapter	Nextera Transposase Sequence	SOLID Small RNA Adapter
1	0.0	0.0	0.0	0.0	0.0
2	0.0	0.0	0.0	0.0	0.0
3	0.0	0.0	0.0	0.0	0.0
4	0.0	0.0	0.0	0.0	0.0
5	0.0	0.0	0.0	0.0	0.0
6	0.0	0.0	0.0	0.0	0.0
7	0.0	0.0	0.0	0.0	0.0
8	0.0	0.0	0.0	0.0	0.0
9	0.0	0.0	0.0	0.0	0.0
10-11	0.0	0.0	0.0	0.0	0.0
12-13	0.0	0.0	0.0	0.0	0.0
14-15	0.0	0.0	0.0	0.0	0.0
16-17	0.0	0.0	0.0	0.0	0.0
18-19	0.0	0.0	0.0	0.0	0.0
20-21	0.0	0.0	0.0	0.0	0.0
22-23	0.0125	0.0	0.0	0.0	0.0
24-25	0.025	0.0	0.0	0.0	0.0
26-27	0.025	0.0	0.0	0.0	0.0
28-29	0.025	0.0	0.0	0.0	0.0
30-31	0.025	0.0	0.0	0.0	0.0
32-33	0.025	0.0	0.0	0.0	0.0
34-35	0.025	0.0	0.0	0.0	0.0
36-37	0.025	0.0	0.0	0.0	0.0
38-39	0.025	0.0	0.0	0.0	0.0
40-41	0.025	0.0	0.0	0.0	0.0
42-43	0.025	0.0	0.0	0.0	0.0
44-45	0.025	0.0	0.0	0.0	0.0
46-47	0.025	0.0	0.0	0.0	0.0
48-49	0.025	0.0	0.0	0.0	0.0
50-51	0.037500000000000006	0.0	0.0	0.0	0.0
52-53	0.05	0.0	0.0	0.0	0.0
54-55	0.05	0.0	0.0	0.0	0.0
56-57	0.05	0.0	0.0	0.0	0.0
58-59	0.05	0.0	0.0	0.0	0.0
60-61	0.05	0.0	0.0	0.0	0.0
62-63	0.05	0.0	0.0	0.0	0.0
64-65	0.05	0.0	0.0	0.0	0.0
66-67	0.0625	0.0	0.0	0.0	0.0
68-69	0.125	0.0	0.0	0.0	0.0
70-71	0.125	0.0	0.0	0.0	0.0
72-73	0.125	0.0	0.0	0.0	0.0
74-75	0.175	0.0	0.0	0.0	0.0
76-77	0.21250000000000002	0.0	0.0	0.0	0.0
78-79	0.2375	0.0	0.0	0.0	0.0
80-81	0.275	0.0	0.0	0.0	0.0
82-83	0.3	0.0	0.0	0.0	0.0
84-85	0.375	0.0	0.0	0.0	0.0
86-87	0.475	0.0	0.0	0.0	0.0
88-89	0.5625	0.0	0.0	0.0	0.0
90-91	0.6625000000000001	0.0	0.0	0.0	0.0
92-93	0.8	0.0	0.0	0.0	0.0
94-95	1.05	0.0	0.0	0.0	0.0
96-97	1.3875	0.0	0.0	0.0	0.0
98-99	1.7625	0.0	0.0	0.0	0.0
100-101	2.125	0.0	0.0	0.0	0.0
102-103	2.3375	0.0	0.0	0.0	0.0
104-105	2.6875	0.0	0.0	0.0	0.0
106-107	3.0875	0.0	0.0	0.0	0.0
108-109	3.3375	0.0	0.0	0.0	0.0
110-111	3.6375	0.0	0.0	0.0	0.0
112-113	4.0375	0.0	0.0	0.0	0.0
114-115	4.5	0.0	0.0	0.0	0.0
116-117	5.074999999999999	0.0	0.0	0.0	0.0
118-119	5.575	0.0	0.0	0.0	0.0
120-121	6.1	0.0	0.0	0.0	0.0
122-123	6.65	0.0	0.0	0.0	0.0
124-125	7.15	0.0	0.0	0.0	0.0
126-127	7.8125	0.0	0.0	0.0	0.0
128-129	8.45	0.0	0.0	0.0	0.0
130-131	9.1375	0.0	0.0	0.0	0.0
132-133	9.8625	0.0	0.0	0.0	0.0
134-135	10.575	0.0	0.0	0.0	0.0
136-137	11.475000000000001	0.0	0.0	0.0	0.0
138-139	12.325	0.0	0.0	0.0	0.0
>>END_MODULE
>>Kmer Content	warn
#Sequence	Count	PValue	Obs/Exp Max	Max Obs/Exp Position
TGATCCA	10	0.0065840036	146.77216	4
>>END_MODULE
Read 395835 spots for SRR5579227.sra
Written 395835 spots for SRR5579227.sra
Read 395835 spots for SRR5579227.sra
Written 395835 spots for SRR5579227.sra
Read 395835 spots for SRR5579227.sra
Written 395835 spots for SRR5579227.sra
Read 395835 spots for SRR5579227.sra
Written 395835 spots for SRR5579227.sra
Read 395835 spots for SRR5579227.sra
Written 395835 spots for SRR5579227.sra
Read 395835 spots for SRR5579227.sra
Written 395835 spots for SRR5579227.sra
Read 395835 spots for SRR5579227.sra
Written 395835 spots for SRR5579227.sra
Read 395835 spots for SRR5579227.sra
Written 395835 spots for SRR5579227.sra
Read 395835 spots for SRR5579227.sra
Written 395835 spots for SRR5579227.sra
Read 395835 spots for SRR5579227.sra
Written 395835 spots for SRR5579227.sra
Read 395835 spots for SRR5579227.sra
Written 395835 spots for SRR5579227.sra
Read 395835 spots for SRR5579227.sra
Written 395835 spots for SRR5579227.sra
Read 395835 spots for SRR5579227.sra
Written 395835 spots for SRR5579227.sra
Read 395835 spots for SRR5579227.sra
Written 395835 spots for SRR5579227.sra
Read 395835 spots for SRR5579227.sra
Written 395835 spots for SRR5579227.sra
Read 395835 spots for SRR5579227.sra
Written 395835 spots for SRR5579227.sra
Read 395835 spots for SRR5579227.sra
Written 395835 spots for SRR5579227.sra
Read 395835 spots for SRR5579227.sra
Written 395835 spots for SRR5579227.sra
Read 395847 spots for SRR5579227.sra
Written 395847 spots for SRR5579227.sra
Read 395835 spots for SRR5579227.sra
Written 395835 spots for SRR5579227.sra
SRR ids: ['SRR5579227.sra']
extra args: ['--split-files', '--defline-qual', '+']
tempdir: /tmp/pfd_wm8xmj73
SRR5579227.sra spots: 7916712
blocks: [[1, 395835], [395836, 791670], [791671, 1187505], [1187506, 1583340], [1583341, 1979175], [1979176, 2375010], [2375011, 2770845], [2770846, 3166680], [3166681, 3562515], [3562516, 3958350], [3958351, 4354185], [4354186, 4750020], [4750021, 5145855], [5145856, 5541690], [5541691, 5937525], [5937526, 6333360], [6333361, 6729195], [6729196, 7125030], [7125031, 7520865], [7520866, 7916712]]
SRR5579227 file size 2665082
SRR5579227 completed basic pipeline successfully
skewer v0.2.2 [April 4, 2016]
COMMAND LINE:	skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579227 SRR5579227_1.fastq SRR5579227_2.fastq
Input file:	SRR5579227_1.fastq
Paired file:	SRR5579227_2.fastq
trimmed:	SRR5579227-trimmed-pair1.fastq, SRR5579227-trimmed-pair2.fastq

Parameters used:
-- 3' end adapter sequence (-x):	AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
-- paired 3' end adapter sequence (-y):	AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA
-- maximum error ratio allowed (-r):	0.100
-- maximum indel error ratio allowed (-d):	0.030
-- end quality threshold (-q):		10
-- minimum read length allowed after trimming (-l):	18
-- file format (-f):		Sanger/Illumina 1.8+ FASTQ 
-- number of concurrent threads (-t):	20
Mon Dec  9 22:46:11 2024 >> started

Mon Dec  9 22:46:21 2024 >> done (10.320s)
7916712 read pairs processed; of these:
   6427 ( 0.08%) short read pairs filtered out after trimming by size control
  42876 ( 0.54%) empty read pairs filtered out after trimming by size control
7867409 (99.38%) read pairs available; of these:
3964875 (50.40%) trimmed read pairs available after processing
3902534 (49.60%) untrimmed read pairs available after processing

Length distribution of reads after trimming:
length	count	percentage
 18	      8	  0.00%
 19	     16	  0.00%
 20	     14	  0.00%
 21	     14	  0.00%
 22	     29	  0.00%
 23	     14	  0.00%
 24	     16	  0.00%
 25	     12	  0.00%
 26	     18	  0.00%
 27	     15	  0.00%
 28	     21	  0.00%
 29	     18	  0.00%
 30	     17	  0.00%
 31	     12	  0.00%
 32	     15	  0.00%
 33	     29	  0.00%
 34	     30	  0.00%
 35	     16	  0.00%
 36	     25	  0.00%
 37	     17	  0.00%
 38	     23	  0.00%
 39	     31	  0.00%
 40	     45	  0.00%
 41	     36	  0.00%
 42	     43	  0.00%
 43	     39	  0.00%
 44	     34	  0.00%
 45	     63	  0.00%
 46	     58	  0.00%
 47	     66	  0.00%
 48	     75	  0.00%
 49	     76	  0.00%
 50	     88	  0.00%
 51	     92	  0.00%
 52	    116	  0.00%
 53	    117	  0.00%
 54	    138	  0.00%
 55	    141	  0.00%
 56	    149	  0.00%
 57	    170	  0.00%
 58	    205	  0.00%
 59	    245	  0.00%
 60	    296	  0.00%
 61	    311	  0.00%
 62	    403	  0.01%
 63	    384	  0.00%
 64	    437	  0.01%
 65	    480	  0.01%
 66	    586	  0.01%
 67	    629	  0.01%
 68	    762	  0.01%
 69	   1008	  0.01%
 70	   1263	  0.02%
 71	   1248	  0.02%
 72	   1343	  0.02%
 73	   1444	  0.02%
 74	   1554	  0.02%
 75	   1739	  0.02%
 76	   2012	  0.03%
 77	   2142	  0.03%
 78	   2392	  0.03%
 79	   2758	  0.04%
 80	   3064	  0.04%
 81	   3550	  0.05%
 82	   4005	  0.05%
 83	   4378	  0.06%
 84	   4804	  0.06%
 85	   5169	  0.07%
 86	   5667	  0.07%
 87	   6249	  0.08%
 88	   6469	  0.08%
 89	   6905	  0.09%
 90	   7496	  0.10%
 91	   8104	  0.10%
 92	   8851	  0.11%
 93	   9684	  0.12%
 94	  10084	  0.13%
 95	  10503	  0.13%
 96	  10821	  0.14%
 97	  11576	  0.15%
 98	  11687	  0.15%
 99	  12627	  0.16%
100	  13042	  0.17%
101	  13721	  0.17%
102	  15205	  0.19%
103	  15858	  0.20%
104	  16127	  0.20%
105	  16829	  0.21%
106	  17234	  0.22%
107	  17503	  0.22%
108	  18104	  0.23%
109	  18222	  0.23%
110	  19001	  0.24%
111	  19909	  0.25%
112	  21078	  0.27%
113	  21893	  0.28%
114	  23056	  0.29%
115	  23670	  0.30%
116	  23856	  0.30%
117	  24266	  0.31%
118	  24002	  0.31%
119	  24286	  0.31%
120	  25174	  0.32%
121	  25745	  0.33%
122	  26766	  0.34%
123	  28352	  0.36%
124	  29702	  0.38%
125	  29946	  0.38%
126	  30922	  0.39%
127	  30740	  0.39%
128	  31082	  0.40%
129	  31650	  0.40%
130	  31357	  0.40%
131	  32347	  0.41%
132	  34185	  0.43%
133	  35782	  0.45%
134	  36826	  0.47%
135	  39119	  0.50%
136	  39417	  0.50%
137	  39940	  0.51%
138	  41313	  0.53%
139	  42826	  0.54%
140	  43447	  0.55%
141	  45349	  0.58%
142	  48480	  0.62%
143	  52016	  0.66%
144	  56882	  0.72%
145	  64599	  0.82%
146	  75037	  0.95%
147	  97105	  1.23%
148	 142847	  1.82%
149	 286125	  3.64%
150	1825645	 23.21%
151	3902534	 49.60%
7867409 reads passed initial QC


criterion=sequence-density
sequence-density=0.98
sequence-density-rank=1
fanout-score=2.89
fanout-score-rank=19
prefix-density=1.04
prefix-fanout=2.7
sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC


criterion=fanout-score
sequence-density=0.01
sequence-density-rank=38
fanout-score=66.03
fanout-score-rank=1
prefix-density=0.25
prefix-fanout=1.5
sequence=TATATATATTACTGTTCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATG


criterion=sequence-density
sequence-density=0.74
sequence-density-rank=1
fanout-score=3.88
fanout-score-rank=18
prefix-density=0.83
prefix-fanout=3.5
sequence=GAGTTCAGCAAGGTCGGCTT


criterion=fanout-score
sequence-density=0.01
sequence-density-rank=40
fanout-score=129.74
fanout-score-rank=1
prefix-density=0.17
prefix-fanout=7.5
sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGC
SRR5579227 testing PE reads STAR mapping to Ensembl genome
                                 Started job on |	Dec 09 22:47:16
                             Started mapping on |	Dec 09 22:47:16
                                    Finished on |	Dec 09 22:49:01
       Mapping speed, Million of reads per hour |	269.74

                          Number of input reads |	7867409
                      Average input read length |	290
                                    UNIQUE READS:
                   Uniquely mapped reads number |	7216760
                        Uniquely mapped reads % |	91.73%
                          Average mapped length |	289.85
                       Number of splices: Total |	7299798
            Number of splices: Annotated (sjdb) |	6897538
                       Number of splices: GT/AG |	7202758
                       Number of splices: GC/AG |	90259
                       Number of splices: AT/AC |	2389
               Number of splices: Non-canonical |	4392
                      Mismatch rate per base, % |	0.12%
                         Deletion rate per base |	0.00%
                        Deletion average length |	1.38
                        Insertion rate per base |	0.00%
                       Insertion average length |	1.14
                             MULTI-MAPPING READS:
        Number of reads mapped to multiple loci |	95138
             % of reads mapped to multiple loci |	1.21%
        Number of reads mapped to too many loci |	11783
             % of reads mapped to too many loci |	0.15%
                                  UNMAPPED READS:
       % of reads unmapped: too many mismatches |	0.00%
                 % of reads unmapped: too short |	6.07%
                     % of reads unmapped: other |	0.84%
                                  CHIMERIC READS:
                       Number of chimeric reads |	0
                            % of chimeric reads |	0.00%
N_unmapped	560907	560907	560907
N_multimapping	95138	95138	95138
N_noFeature	242888	6980240	315187
N_ambiguous	193542	977	29316
UnstrandedReadsAssigned:6780330 PositiveStrandReadsAssigned:235543 NegativeStrandReadsAssigned:6872257
Dataset is classified negative stranded
MeadianReadLen=151 20thPercentileLength=148 echo kmer=143
SRR5579227 Starting Kallisto paired end mapping to ensembl reference transcriptome

[quant] fragment length distribution will be estimated from the data
[index] k-mer length: 31
[index] number of targets: 52,972
[index] number of k-mers: 66,720,672
[index] number of equivalence classes: 111,837
[quant] running in paired-end mode
[quant] will process pair 1: SRR5579227-trimmed-pair1.fastq
                             SRR5579227-trimmed-pair2.fastq
[quant] finding pseudoalignments for the reads ... done
[quant] processed 7,867,409 reads, 6,896,307 reads pseudoaligned
[quant] estimated average fragment length: 238.303
[   em] quantifying the abundances ... done
[   em] the Expectation-Maximization algorithm ran for 1,074 rounds

  52973 SRR5579227.ke.tsv
  35125 SRR5579227.se.tsv
  88098 total
==> SRR5579227.ke.tsv <==
target_id	length	eff_length	est_counts	tpm
PNS24245	936	699.09	0	0
PNS24247	1044	806.697	12.1674	2.98341
PNS24249	1928	1690.7	6.07244	0.710434
PNS24246	1044	806.697	12.1674	2.98341
PNS24248	1044	806.697	12.1674	2.98341
PNS24244	1471	1233.7	49.4254	7.92443
PNS24243	293	107.572	0	0
KQK14069	1603	1365.7	2030.58	294.098
KQK14071	474	253.996	76.0698	59.2397

==> SRR5579227.se.tsv <==
BRADI_1g14170v3	2383
BRADI_1g53295v3	18
BRADI_1g59795v3	353
BRADI_1g07683v3	0
BRADI_1g00485v3	2
BRADI_1g20270v3	44
BRADI_1g74790v3	26
BRADI_1g09890v3	0
BRADI_1g77505v3	138
BRADI_1g48960v3	0
SRR5579227 completed mapping pipeline successfully
