Starting /dee2/code/volunteer_pipeline.sh SRR5579228 current disk space = 1522974511104 free memory = 1601494868 SRR5579228 SRAfilesize 07ef5b961d8b947473c0b3684ae3b1cc SRR5579228.sra SRR5579228.sra file validated SRR5579228 is paired end SRR5579228 is conventional basespace SRR5579228 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579228_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4845 34.0 33.0 34.0 32.0 34.0 2 33.31175 34.0 33.0 34.0 33.0 34.0 3 33.37375 34.0 34.0 34.0 33.0 34.0 4 33.4725 34.0 34.0 34.0 33.0 34.0 5 33.45875 34.0 34.0 34.0 33.0 34.0 6 37.3245 38.0 38.0 38.0 36.0 38.0 7 37.51025 38.0 38.0 38.0 37.0 38.0 8 37.58125 38.0 38.0 38.0 38.0 38.0 9 37.5505 38.0 38.0 38.0 38.0 38.0 10-14 37.57305 38.0 38.0 38.0 38.0 38.0 15-19 37.57485 38.0 38.0 38.0 38.0 38.0 20-24 37.55695000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.394349999999996 38.0 38.0 38.0 37.2 38.0 30-34 37.3648 38.0 38.0 38.0 37.8 38.0 35-39 37.172900000000006 38.0 38.0 38.0 37.0 38.0 40-44 37.04285 38.0 38.0 38.0 36.4 38.0 45-49 37.05145 38.0 38.0 38.0 36.6 38.0 50-54 37.178700000000006 38.0 38.0 38.0 36.8 38.0 55-59 37.00405 38.0 38.0 38.0 36.2 38.0 60-64 37.063900000000004 38.0 38.0 38.0 36.2 38.0 65-69 36.8378 38.0 38.0 38.0 35.6 38.0 70-74 36.8683 38.0 38.0 38.0 35.8 38.0 75-79 36.74395 38.0 38.0 38.0 35.4 38.0 80-84 36.56155 38.0 38.0 38.0 34.4 38.0 85-89 36.5643 38.0 38.0 38.0 34.6 38.0 90-94 36.4028 38.0 38.0 38.0 34.2 38.0 95-99 36.226299999999995 38.0 38.0 38.0 33.8 38.0 100-104 35.735049999999994 38.0 37.0 38.0 31.8 38.0 105-109 35.8786 38.0 37.0 38.0 32.6 38.0 110-114 35.13165 38.0 35.8 38.0 28.6 38.0 115-119 34.9366 38.0 35.2 38.0 28.0 38.0 120-124 34.87555 38.0 35.0 38.0 28.0 38.0 125-129 34.231899999999996 38.0 33.8 38.0 24.6 38.0 130-134 33.80535 38.0 33.2 38.0 23.2 38.0 135-139 32.777550000000005 38.0 32.2 38.0 18.0 38.0 140-144 31.71255 37.0 30.4 38.0 13.2 38.0 145-149 30.014 36.0 28.6 38.0 6.0 38.0 150-151 23.126625 29.0 11.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 8.0 9 3.0 10 3.0 11 0.0 12 1.0 13 1.0 14 1.0 15 1.0 16 2.0 17 6.0 18 4.0 19 7.0 20 3.0 21 8.0 22 12.0 23 8.0 24 12.0 25 14.0 26 21.0 27 27.0 28 37.0 29 48.0 30 57.0 31 75.0 32 94.0 33 122.0 34 216.0 35 433.0 36 959.0 37 1816.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.46460746460747 13.153153153153152 8.468468468468467 30.913770913770914 2 22.575 18.775 35.199999999999996 23.45 3 21.475 24.6 24.675 29.25 4 28.4 30.575000000000003 18.875 22.15 5 25.224999999999998 33.45 21.5 19.825 6 20.775 33.025 23.599999999999998 22.6 7 18.075 18.875 40.725 22.325 8 20.5 19.85 29.275000000000002 30.375000000000004 9 22.125 18.9 29.45 29.525000000000002 10-14 24.345 24.795 24.610000000000003 26.25 15-19 23.724999999999998 23.91 26.314999999999998 26.05 20-24 23.36018411967779 24.681042677740532 25.73672887376795 26.222044328813727 25-29 23.995 24.73 24.89 26.384999999999998 30-34 23.96516342159267 24.851093648330746 24.926172481105162 26.257570448971418 35-39 24.167083541770886 24.39719859929965 25.47273636818409 25.962981490745374 40-44 23.920232488225274 25.278083976350334 25.43341016133881 25.368273374085582 45-49 24.22693329323911 24.88347616899714 24.80829950383401 26.08129103392973 50-54 23.868250864791698 25.497568556675187 24.87090790595077 25.763272672582342 55-59 24.43497870207968 24.62540716612378 24.59533951390629 26.34427461789025 60-64 24.482430197002355 24.17163767607399 24.80826106571758 26.537671061206076 65-69 24.587615943845577 24.733015793431935 24.848332915517673 25.83103534720481 70-74 23.91718468016844 24.40344896731502 25.401042711048728 26.278323641467814 75-79 24.446891580738814 24.536990689758735 25.317849634598055 25.698268094904396 80-84 24.368149742255145 24.793553876182372 25.003753565887592 25.834542815674894 85-89 24.908663230068566 24.88363945748461 24.573344677443572 25.634352635003253 90-94 24.6707066659989 24.69073972053889 24.620624029648923 26.01792958381329 95-99 24.218710810132933 24.30900426385754 24.971156257837972 26.50112866817156 100-104 24.81715258992085 24.752028854824164 24.301172227231742 26.12964632802324 105-109 24.93623405851463 23.72093023255814 25.32133033258315 26.021505376344084 110-114 25.320271288620948 24.27530771163024 24.77769404672193 25.62672695302688 115-119 25.24762381190595 23.08654327163582 25.312656328164078 26.353176588294147 120-124 24.825 24.22 24.495 26.46 125-129 24.375 24.75 24.169999999999998 26.705000000000002 130-134 25.014999999999997 25.119999999999997 23.9 25.965 135-139 24.915000000000003 24.59 23.880000000000003 26.615 140-144 24.665 24.88 24.455 26.0 145-149 24.565 24.85 23.825 26.76 150-151 24.1125 26.400000000000002 23.225 26.2625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 1.5 23 1.0 24 1.5 25 2.0 26 1.0 27 0.5 28 2.0 29 5.0 30 6.5 31 9.5 32 16.0 33 23.0 34 28.0 35 40.5 36 48.5 37 58.5 38 82.0 39 88.5 40 104.5 41 137.0 42 162.0 43 183.0 44 193.5 45 188.0 46 184.5 47 183.5 48 171.5 49 154.0 50 132.5 51 133.5 52 135.0 53 122.5 54 115.0 55 110.5 56 103.5 57 91.0 58 83.5 59 79.5 60 81.5 61 83.0 62 78.0 63 67.5 64 57.5 65 55.0 66 51.5 67 45.5 68 40.5 69 40.5 70 45.5 71 38.5 72 31.0 73 28.0 74 21.0 75 14.5 76 10.0 77 8.5 78 6.0 79 3.5 80 1.5 81 1.5 82 1.0 83 0.5 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.065 25-29 0.0 30-34 0.105 35-39 0.05 40-44 0.21 45-49 0.23500000000000001 50-54 0.265 55-59 0.22499999999999998 60-64 0.255 65-69 0.27499999999999997 70-74 0.26 75-79 0.11 80-84 0.095 85-89 0.095 90-94 0.165 95-99 0.325 100-104 0.19 105-109 0.025 110-114 0.475 115-119 0.05 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19293820933164 98.32499999999999 2 0.7313997477931904 1.4500000000000002 3 0.07566204287515763 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.07500000000000001 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.38749999999999996 0.0 0.0 0.0 0.0 84-85 0.6499999999999999 0.0 0.0 0.0 0.0 86-87 0.8500000000000001 0.0 0.0 0.0 0.0 88-89 1.0375 0.0 0.0 0.0 0.0 90-91 1.15 0.0 0.0 0.0 0.0 92-93 1.3625 0.0 0.0 0.0 0.0 94-95 1.6625 0.0 0.0 0.0 0.0 96-97 1.925 0.0 0.0 0.0 0.0 98-99 2.2 0.0 0.0 0.0 0.0 100-101 2.5875000000000004 0.0 0.0 0.0 0.0 102-103 3.0625 0.0 0.0 0.0 0.0 104-105 3.4875 0.0 0.0 0.0 0.0 106-107 3.7875 0.0 0.0 0.0 0.0 108-109 4.15 0.0 0.0 0.0 0.0 110-111 4.5 0.0 0.0 0.0 0.0 112-113 5.025 0.0 0.0 0.0 0.0 114-115 5.6 0.0 0.0 0.0 0.0 116-117 6.125 0.0 0.0 0.0 0.0 118-119 6.825 0.0 0.0 0.0 0.0 120-121 7.550000000000001 0.0 0.0 0.0 0.0 122-123 8.274999999999999 0.0 0.0 0.0 0.0 124-125 9.0375 0.0 0.0 0.0 0.0 126-127 9.8125 0.0 0.0 0.0 0.0 128-129 10.575 0.0 0.0 0.0 0.0 130-131 11.325 0.0 0.0 0.0 0.0 132-133 12.1375 0.0 0.0 0.0 0.0 134-135 12.9375 0.0 0.0 0.0 0.0 136-137 13.6375 0.0 0.0 0.0 0.0 138-139 14.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5579228 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579228_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.587 33.0 33.0 34.0 32.0 34.0 2 32.694 34.0 33.0 34.0 32.0 34.0 3 32.66425 34.0 33.0 34.0 32.0 34.0 4 32.6665 34.0 33.0 34.0 32.0 34.0 5 32.6225 34.0 33.0 34.0 32.0 34.0 6 36.66 38.0 38.0 38.0 36.0 38.0 7 36.939 38.0 38.0 38.0 37.0 38.0 8 36.76825 38.0 38.0 38.0 37.0 38.0 9 36.6945 38.0 38.0 38.0 36.0 38.0 10-14 36.7519 38.0 38.0 38.0 36.2 38.0 15-19 36.82195 38.0 38.0 38.0 36.8 38.0 20-24 36.79705 38.0 38.0 38.0 36.8 38.0 25-29 36.7332 38.0 38.0 38.0 36.2 38.0 30-34 36.755649999999996 38.0 38.0 38.0 36.6 38.0 35-39 36.79275 38.0 38.0 38.0 37.0 38.0 40-44 36.76625 38.0 38.0 38.0 37.0 38.0 45-49 36.67935000000001 38.0 38.0 38.0 36.0 38.0 50-54 36.631299999999996 38.0 38.0 38.0 36.0 38.0 55-59 36.48575 38.0 38.0 38.0 35.6 38.0 60-64 36.524 38.0 38.0 38.0 35.8 38.0 65-69 36.3548 38.0 38.0 38.0 35.4 38.0 70-74 36.086600000000004 38.0 38.0 38.0 34.0 38.0 75-79 36.018499999999996 38.0 38.0 38.0 34.0 38.0 80-84 35.95015 38.0 38.0 38.0 33.8 38.0 85-89 35.9328 38.0 38.0 38.0 33.8 38.0 90-94 35.95915 38.0 38.0 38.0 33.8 38.0 95-99 35.86225 38.0 38.0 38.0 33.4 38.0 100-104 35.591750000000005 38.0 37.8 38.0 32.0 38.0 105-109 35.34525000000001 38.0 37.4 38.0 30.6 38.0 110-114 34.994699999999995 38.0 36.6 38.0 29.0 38.0 115-119 34.72425 38.0 36.0 38.0 27.2 38.0 120-124 34.1272 38.0 35.2 38.0 22.8 38.0 125-129 33.78869999999999 38.0 34.0 38.0 22.2 38.0 130-134 33.2201 38.0 33.0 38.0 17.6 38.0 135-139 32.6028 38.0 33.0 38.0 13.0 38.0 140-144 32.08165 38.0 33.0 38.0 12.0 38.0 145-149 30.637350000000005 38.0 30.4 38.0 2.0 38.0 150-151 24.560499999999998 32.0 15.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 30.0 3 7.0 4 5.0 5 4.0 6 6.0 7 4.0 8 3.0 9 4.0 10 1.0 11 2.0 12 2.0 13 5.0 14 2.0 15 10.0 16 8.0 17 8.0 18 11.0 19 11.0 20 12.0 21 6.0 22 11.0 23 15.0 24 11.0 25 19.0 26 25.0 27 24.0 28 32.0 29 56.0 30 56.0 31 64.0 32 95.0 33 106.0 34 180.0 35 269.0 36 709.0 37 2187.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.84592145015105 15.508559919436053 10.850956696878148 27.794561933534744 2 25.182573659027952 22.76504658776127 30.54646184840091 21.50591790480987 3 24.148372445117335 24.75397426192279 26.24274539490285 24.85490789805703 4 28.481490808360615 33.36691009821204 16.242760010073027 21.90883908335432 5 26.869806094182824 34.55049106018635 17.401158398388315 21.17854444724251 6 21.83791971724312 33.021964150467056 20.903812168644283 24.236303963645543 7 20.834380497612464 15.95878361397336 36.81829605428499 26.388539834129176 8 22.33107259482542 21.225822657623713 24.014066817382567 32.4290379301683 9 23.840725806451612 21.875 24.445564516129032 29.838709677419356 10-14 25.36060712670252 25.425943609589385 22.87782077700156 26.335628486706536 15-19 26.353011987761448 24.41691327682199 23.258263530119876 25.971811205296685 20-24 26.305220883534137 25.09036144578313 23.56425702811245 25.04016064257028 25-29 26.081941728097892 25.856276014242013 23.10315430520034 24.958627952459757 30-34 26.663655525444142 24.771655123958645 23.095453176753992 25.469236173843218 35-39 25.998594941790447 24.939783219590524 23.33902047370534 25.72260136491369 40-44 26.41272709023387 24.3701696276222 23.632440028103986 25.584663254039945 45-49 26.23041382081157 24.527922860586582 23.9302932904781 25.311370028123743 50-54 25.743121108656357 24.929704759991967 24.10624623418357 25.220927897168107 55-59 26.549249836921067 25.239600582066334 23.61884690651814 24.592302674494455 60-64 25.898774854388428 25.27113878288813 23.579031934123318 25.251054428600124 65-69 26.066850967579796 24.51872329731088 23.89545111837145 25.51897461673787 70-74 26.34538152610442 25.281124497991968 23.393574297188753 24.97991967871486 75-79 26.454043194374687 25.118031140130586 23.405323957810147 25.022601707684583 80-84 26.11314693037498 24.541940665629237 24.20059233974198 25.1443200642538 85-89 26.640208982216418 24.409725710840952 23.636089621219732 25.3139756857229 90-94 26.35118181361971 24.38901992271792 24.16821398103076 25.091584282631608 95-99 26.304424245467782 24.79284889268317 24.190227489579673 24.712499372269374 100-104 27.061183550651958 25.035105315947842 23.771313941825476 24.132397191574725 105-109 27.097227097227094 24.92102492102492 23.742666599809457 24.239081381938522 110-114 26.78750753163286 25.733078931512352 23.7547700341434 23.724643502711388 115-119 27.907676869041648 24.726542900150527 23.823381836427497 23.54239839438033 120-124 27.859149277688605 25.245786516853936 23.023675762439808 23.871388443017658 125-129 28.038181361466968 25.450891735744786 23.556895252449134 22.95403165033911 130-134 28.34262188080534 25.315057488577597 22.980368529396998 23.361952101220062 135-139 28.974732506153618 25.950670618375444 23.152659868388003 21.92193700708294 140-144 28.625282734355366 25.549132947976876 23.24704699673285 22.578537320934906 145-149 28.667570689568578 26.196574757671637 22.796444176585805 22.339410376173973 150-151 28.75972884760231 26.198845091639466 23.186040672859654 21.85538538789857 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 1.5 2 5.0 3 3.5 4 1.0 5 1.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.5 15 1.0 16 0.5 17 0.0 18 1.0 19 1.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 1.5 26 1.5 27 2.0 28 2.0 29 3.0 30 6.0 31 7.0 32 10.0 33 14.5 34 19.5 35 24.0 36 31.5 37 53.5 38 71.5 39 80.0 40 94.0 41 110.5 42 136.0 43 161.0 44 166.0 45 169.0 46 170.0 47 177.0 48 174.5 49 154.0 50 149.5 51 138.5 52 116.0 53 116.0 54 121.0 55 113.5 56 101.5 57 99.0 58 110.5 59 107.5 60 91.0 61 84.0 62 83.0 63 77.0 64 77.0 65 78.5 66 73.5 67 73.0 68 63.0 69 47.0 70 44.0 71 46.0 72 39.0 73 31.5 74 23.0 75 11.5 76 7.5 77 5.5 78 3.5 79 1.0 80 1.0 81 1.5 82 1.0 83 1.0 84 0.5 85 0.0 86 0.5 87 0.5 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7000000000000001 2 0.7250000000000001 3 0.9249999999999999 4 0.7250000000000001 5 0.7250000000000001 6 0.975 7 0.525 8 0.475 9 0.8 10-14 0.515 15-19 0.315 20-24 0.4 25-29 0.295 30-34 0.37 35-39 0.36 40-44 0.37 45-49 0.44 50-54 0.42 55-59 0.35500000000000004 60-64 0.42 65-69 0.525 70-74 0.4 75-79 0.44999999999999996 80-84 0.395 85-89 0.47000000000000003 90-94 0.365 95-99 0.43499999999999994 100-104 0.3 105-109 0.28500000000000003 110-114 0.42 115-119 0.35000000000000003 120-124 0.32 125-129 0.475 130-134 0.415 135-139 0.46499999999999997 140-144 0.525 145-149 0.445 150-151 0.42500000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19171507956554 98.175 2 0.6567314978529932 1.3 3 0.10103561505430665 0.3 4 0.025258903763576663 0.1 5 0.025258903763576663 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.38749999999999996 0.0 0.0 0.0 0.0 84-85 0.6499999999999999 0.0 0.0 0.0 0.0 86-87 0.8500000000000001 0.0 0.0 0.0 0.0 88-89 1.025 0.0 0.0 0.0 0.0 90-91 1.125 0.0 0.0 0.0 0.0 92-93 1.3375 0.0 0.0 0.0 0.0 94-95 1.6125 0.0 0.0 0.0 0.0 96-97 1.875 0.0 0.0 0.0 0.0 98-99 2.1624999999999996 0.0 0.0 0.0 0.0 100-101 2.5625 0.0 0.0 0.0 0.0 102-103 3.0374999999999996 0.0 0.0 0.0 0.0 104-105 3.475 0.0 0.0 0.0 0.0 106-107 3.7875 0.0 0.0 0.0 0.0 108-109 4.1625 0.0 0.0 0.0 0.0 110-111 4.5125 0.0 0.0 0.0 0.0 112-113 5.0375 0.0 0.0 0.0 0.0 114-115 5.6 0.0 0.0 0.0 0.0 116-117 6.125 0.0 0.0 0.0 0.0 118-119 6.8 0.0 0.0 0.0 0.0 120-121 7.6 0.0 0.0 0.0 0.0 122-123 8.350000000000001 0.0 0.0 0.0 0.0 124-125 9.149999999999999 0.0 0.0 0.0 0.0 126-127 9.8875 0.0 0.0 0.0 0.0 128-129 10.6125 0.0 0.0 0.0 0.0 130-131 11.35 0.0 0.0 0.0 0.0 132-133 12.175 0.0 0.0 0.0 0.0 134-135 12.9375 0.0 0.0 0.0 0.0 136-137 13.6 0.0 0.0 0.0 0.0 138-139 14.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGAGTG 45 0.008975616 48.30833 145 >>END_MODULE Read 848888 spots for SRR5579228.sra Written 848888 spots for SRR5579228.sra Read 848888 spots for SRR5579228.sra Written 848888 spots for SRR5579228.sra Read 848888 spots for SRR5579228.sra Written 848888 spots for SRR5579228.sra Read 848888 spots for SRR5579228.sra Written 848888 spots for SRR5579228.sra Read 848888 spots for SRR5579228.sra Written 848888 spots for SRR5579228.sra Read 848888 spots for SRR5579228.sra Written 848888 spots for SRR5579228.sra Read 848888 spots for SRR5579228.sra Written 848888 spots for SRR5579228.sra Read 848888 spots for SRR5579228.sra Written 848888 spots for SRR5579228.sra Read 848888 spots for SRR5579228.sra Written 848888 spots for SRR5579228.sra Read 848905 spots for SRR5579228.sra Written 848905 spots for SRR5579228.sra Read 848888 spots for SRR5579228.sra Written 848888 spots for SRR5579228.sra Read 848888 spots for SRR5579228.sra Written 848888 spots for SRR5579228.sra Read 848888 spots for SRR5579228.sra Written 848888 spots for SRR5579228.sra Read 848888 spots for SRR5579228.sra Written 848888 spots for SRR5579228.sra Read 848888 spots for SRR5579228.sra Written 848888 spots for SRR5579228.sra Read 848888 spots for SRR5579228.sra Written 848888 spots for SRR5579228.sra Read 848888 spots for SRR5579228.sra Written 848888 spots for SRR5579228.sra Read 848888 spots for SRR5579228.sra Written 848888 spots for SRR5579228.sra Read 848888 spots for SRR5579228.sra Written 848888 spots for SRR5579228.sra Read 848888 spots for SRR5579228.sra Written 848888 spots for SRR5579228.sra SRR ids: ['SRR5579228.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c2apix1p SRR5579228.sra spots: 16977777 blocks: [[1, 848888], [848889, 1697776], [1697777, 2546664], [2546665, 3395552], [3395553, 4244440], [4244441, 5093328], [5093329, 5942216], [5942217, 6791104], [6791105, 7639992], [7639993, 8488880], [8488881, 9337768], [9337769, 10186656], [10186657, 11035544], [11035545, 11884432], [11884433, 12733320], [12733321, 13582208], [13582209, 14431096], [14431097, 15279984], [15279985, 16128872], [16128873, 16977777]] SRR5579228 file size 5731511 SRR5579228 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579228 SRR5579228_1.fastq SRR5579228_2.fastq Input file: SRR5579228_1.fastq Paired file: SRR5579228_2.fastq trimmed: SRR5579228-trimmed-pair1.fastq, SRR5579228-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 22:48:06 2024 >> started Mon Dec 9 22:48:26 2024 >> done (19.459s) 16977777 read pairs processed; of these: 22921 ( 0.14%) short read pairs filtered out after trimming by size control 91302 ( 0.54%) empty read pairs filtered out after trimming by size control 16863554 (99.33%) read pairs available; of these: 11284524 (66.92%) trimmed read pairs available after processing 5579030 (33.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 18 0.00% 19 8 0.00% 20 9 0.00% 21 12 0.00% 22 18 0.00% 23 23 0.00% 24 10 0.00% 25 13 0.00% 26 35 0.00% 27 15 0.00% 28 30 0.00% 29 24 0.00% 30 23 0.00% 31 25 0.00% 32 19 0.00% 33 29 0.00% 34 35 0.00% 35 42 0.00% 36 43 0.00% 37 55 0.00% 38 52 0.00% 39 57 0.00% 40 54 0.00% 41 75 0.00% 42 97 0.00% 43 66 0.00% 44 100 0.00% 45 113 0.00% 46 143 0.00% 47 170 0.00% 48 190 0.00% 49 211 0.00% 50 239 0.00% 51 258 0.00% 52 329 0.00% 53 337 0.00% 54 377 0.00% 55 428 0.00% 56 522 0.00% 57 604 0.00% 58 715 0.00% 59 730 0.00% 60 909 0.01% 61 1058 0.01% 62 1130 0.01% 63 1339 0.01% 64 1468 0.01% 65 1595 0.01% 66 1899 0.01% 67 2220 0.01% 68 2592 0.02% 69 3293 0.02% 70 3561 0.02% 71 3716 0.02% 72 4085 0.02% 73 4521 0.03% 74 4975 0.03% 75 5330 0.03% 76 5883 0.03% 77 6444 0.04% 78 7211 0.04% 79 7858 0.05% 80 9069 0.05% 81 10247 0.06% 82 11362 0.07% 83 12503 0.07% 84 14470 0.09% 85 15487 0.09% 86 16494 0.10% 87 17550 0.10% 88 18471 0.11% 89 20068 0.12% 90 21996 0.13% 91 22759 0.13% 92 24495 0.15% 93 26487 0.16% 94 27496 0.16% 95 28399 0.17% 96 29530 0.18% 97 30929 0.18% 98 32080 0.19% 99 33871 0.20% 100 35800 0.21% 101 37277 0.22% 102 39669 0.24% 103 41357 0.25% 104 42900 0.25% 105 44836 0.27% 106 45597 0.27% 107 46213 0.27% 108 47665 0.28% 109 49037 0.29% 110 50559 0.30% 111 53032 0.31% 112 56187 0.33% 113 58351 0.35% 114 60327 0.36% 115 62511 0.37% 116 63305 0.38% 117 63674 0.38% 118 64139 0.38% 119 65697 0.39% 120 68654 0.41% 121 70844 0.42% 122 73052 0.43% 123 77092 0.46% 124 79971 0.47% 125 82334 0.49% 126 84772 0.50% 127 86373 0.51% 128 88030 0.52% 129 91081 0.54% 130 93229 0.55% 131 97079 0.58% 132 102210 0.61% 133 107450 0.64% 134 112894 0.67% 135 120590 0.72% 136 126725 0.75% 137 133806 0.79% 138 139902 0.83% 139 148740 0.88% 140 155638 0.92% 141 169451 1.00% 142 183742 1.09% 143 202352 1.20% 144 228195 1.35% 145 265916 1.58% 146 321400 1.91% 147 423357 2.51% 148 602385 3.57% 149 1082660 6.42% 150 4135264 24.52% 151 5579030 33.08% 16863554 reads passed initial QC criterion=sequence-density sequence-density=0.83 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=11 prefix-density=0.90 prefix-fanout=2.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.31 sequence-density-rank=14 fanout-score=5.92 fanout-score-rank=1 prefix-density=1.01 prefix-fanout=1.8 sequence=TCCAGCTCCTTTAGCACCTGCGTGGCGTCGGTGCACCCGAACATGGG criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=4.52 fanout-score-rank=5 prefix-density=0.90 prefix-fanout=3.5 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=46.50 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=5.3 sequence=CCAGAGCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAATGGCGACCGCCACCATGGCCCTCTCCTCCTCGACCTTCGCCGGGAAGGCGGTGAAGAACCTGCCGGCGCTCGGAGAGGCCCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAA SRR5579228 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 22:49:17 Started mapping on | Dec 09 22:49:17 Finished on | Dec 09 22:52:02 Mapping speed, Million of reads per hour | 367.93 Number of input reads | 16863554 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 15758341 Uniquely mapped reads % | 93.45% Average mapped length | 286.00 Number of splices: Total | 15785121 Number of splices: Annotated (sjdb) | 14866106 Number of splices: GT/AG | 15576588 Number of splices: GC/AG | 189845 Number of splices: AT/AC | 8040 Number of splices: Non-canonical | 10648 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.36 Insertion rate per base | 0.00% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 230820 % of reads mapped to multiple loci | 1.37% Number of reads mapped to too many loci | 33093 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.00% % of reads unmapped: other | 0.99% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 896323 896323 896323 N_multimapping 230820 230820 230820 N_noFeature 566269 15272133 737070 N_ambiguous 371211 2302 56249 UnstrandedReadsAssigned:14820861 PositiveStrandReadsAssigned:483906 NegativeStrandReadsAssigned:14965022 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=139 echo kmer=135 SRR5579228 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579228-trimmed-pair1.fastq SRR5579228-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,863,554 reads, 15,077,142 reads pseudoaligned [quant] estimated average fragment length: 239.354 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52973 SRR5579228.ke.tsv 35125 SRR5579228.se.tsv 88098 total ==> SRR5579228.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 698.274 0 0 PNS24247 1044 805.646 47.7977 5.47474 PNS24249 1928 1689.65 73.6224 4.02082 PNS24246 1044 805.646 47.7977 5.47474 PNS24248 1044 805.646 47.7977 5.47474 PNS24244 1471 1232.65 91.9845 6.88615 PNS24243 293 111.077 0 0 KQK14069 1603 1364.65 1630.89 110.282 KQK14071 474 256.972 36.7108 13.1829 ==> SRR5579228.se.tsv <== BRADI_1g14170v3 1769 BRADI_1g53295v3 99 BRADI_1g59795v3 394 BRADI_1g07683v3 0 BRADI_1g00485v3 24 BRADI_1g20270v3 1889 BRADI_1g74790v3 162 BRADI_1g09890v3 1 BRADI_1g77505v3 270 BRADI_1g48960v3 0 SRR5579228 completed mapping pipeline successfully