Starting /dee2/code/volunteer_pipeline.sh SRR5579229 current disk space = 1523062087680 free memory = 1565631500 SRR5579229 SRAfilesize 35e71253fc5e6612e24dfa269760e0cd SRR5579229.sra SRR5579229.sra file validated SRR5579229 is paired end SRR5579229 is conventional basespace SRR5579229 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579229_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.604 34.0 33.0 34.0 2.0 34.0 2 32.3555 34.0 33.0 34.0 28.0 34.0 3 32.6485 34.0 33.0 34.0 28.0 34.0 4 33.04 34.0 33.0 34.0 32.0 34.0 5 33.15425 34.0 33.0 34.0 32.0 34.0 6 36.90975 38.0 37.0 38.0 35.0 38.0 7 37.226 38.0 38.0 38.0 36.0 38.0 8 37.3965 38.0 38.0 38.0 37.0 38.0 9 37.434 38.0 38.0 38.0 37.0 38.0 10-14 37.398900000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.37519999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.3823 38.0 38.0 38.0 37.0 38.0 25-29 37.348200000000006 38.0 38.0 38.0 37.0 38.0 30-34 37.102 38.0 38.0 38.0 36.2 38.0 35-39 37.23479999999999 38.0 38.0 38.0 36.8 38.0 40-44 37.0923 38.0 38.0 38.0 36.0 38.0 45-49 37.07305 38.0 38.0 38.0 36.0 38.0 50-54 37.01865 38.0 38.0 38.0 35.6 38.0 55-59 36.9497 38.0 38.0 38.0 35.2 38.0 60-64 36.8972 38.0 38.0 38.0 35.0 38.0 65-69 36.78744999999999 38.0 38.0 38.0 34.6 38.0 70-74 36.75095 38.0 38.0 38.0 34.6 38.0 75-79 36.72234999999999 38.0 38.0 38.0 35.0 38.0 80-84 36.67345 38.0 38.0 38.0 34.4 38.0 85-89 36.58755 38.0 38.0 38.0 34.0 38.0 90-94 36.457950000000004 38.0 38.0 38.0 34.0 38.0 95-99 36.31455 38.0 37.6 38.0 33.8 38.0 100-104 36.228449999999995 38.0 37.4 38.0 33.4 38.0 105-109 36.11835 38.0 37.0 38.0 33.0 38.0 110-114 35.98795 38.0 37.0 38.0 32.6 38.0 115-119 35.711400000000005 38.0 36.4 38.0 31.4 38.0 120-124 35.5581 38.0 36.0 38.0 31.0 38.0 125-129 35.43755 38.0 36.0 38.0 31.0 38.0 130-134 35.19375 38.0 35.8 38.0 29.8 38.0 135-139 34.8211 38.0 35.0 38.0 28.0 38.0 140-144 34.49515 38.0 35.0 38.0 26.6 38.0 145-149 33.9127 38.0 35.0 38.0 23.8 38.0 150-151 30.509124999999997 36.5 29.0 38.0 8.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 2.0 14 1.0 15 2.0 16 1.0 17 1.0 18 1.0 19 1.0 20 5.0 21 4.0 22 7.0 23 15.0 24 14.0 25 17.0 26 22.0 27 24.0 28 32.0 29 32.0 30 55.0 31 54.0 32 84.0 33 98.0 34 184.0 35 276.0 36 678.0 37 2389.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.323409223584356 12.551079976649154 10.099241097489783 35.02626970227671 2 23.875 18.35 35.199999999999996 22.575 3 23.0 23.275000000000002 22.45 31.275 4 28.125 31.324999999999996 18.375 22.175 5 26.8 34.725 20.775 17.7 6 21.45 34.725 22.325 21.5 7 16.85 20.549999999999997 41.175 21.425 8 21.05 21.425 26.0 31.525 9 22.125 19.575 29.299999999999997 28.999999999999996 10-14 23.355 26.674999999999997 24.465 25.505 15-19 23.485 25.355 25.31 25.85 20-24 23.48 25.45 25.355 25.715 25-29 24.465 25.39 24.945 25.2 30-34 23.91 25.979999999999997 24.66 25.45 35-39 24.015 25.480000000000004 24.815 25.69 40-44 24.0 25.555 25.555 24.89 45-49 24.310000000000002 25.330000000000002 25.145 25.215 50-54 23.76 25.7 24.645 25.895000000000003 55-59 23.9 25.674999999999997 24.825 25.6 60-64 24.555 25.505 24.595 25.345000000000002 65-69 24.11 25.005 25.019999999999996 25.865 70-74 24.435000000000002 24.735 25.395 25.435000000000002 75-79 24.05 25.05 25.31 25.590000000000003 80-84 24.04 25.019999999999996 25.19 25.75 85-89 24.01 25.415 24.58 25.995 90-94 24.275 25.009999999999998 24.84 25.874999999999996 95-99 24.9 25.16 24.72 25.22 100-104 24.86 25.415 24.565 25.16 105-109 24.465 24.66 25.230000000000004 25.645 110-114 24.98 25.380000000000003 24.55 25.09 115-119 24.195 25.495 24.815 25.495 120-124 25.06 25.005 24.64 25.295 125-129 24.965 25.19 23.990000000000002 25.855 130-134 25.130000000000003 25.545 23.669999999999998 25.655 135-139 24.865000000000002 25.319999999999997 23.990000000000002 25.825 140-144 24.77 25.385 24.44 25.405 145-149 25.119999999999997 25.005 23.91 25.965 150-151 24.5375 26.0125 23.9375 25.5125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.0 27 0.5 28 3.0 29 6.5 30 9.0 31 13.0 32 16.5 33 21.0 34 28.5 35 36.0 36 52.5 37 66.0 38 73.0 39 93.0 40 117.5 41 130.0 42 144.0 43 164.5 44 181.0 45 182.5 46 179.0 47 178.0 48 183.0 49 175.5 50 175.0 51 178.0 52 163.0 53 149.0 54 141.0 55 124.0 56 105.5 57 98.0 58 84.5 59 74.0 60 73.0 61 63.5 62 55.0 63 71.5 64 70.5 65 54.0 66 46.5 67 38.5 68 33.5 69 36.0 70 30.0 71 22.0 72 18.5 73 12.5 74 9.5 75 9.0 76 6.5 77 2.5 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 14.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8246492985972 99.625 2 0.15030060120240482 0.3 3 0.0250501002004008 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.5875 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.9125000000000001 0.0 0.0 0.0 0.0 98-99 1.1 0.0 0.0 0.0 0.0 100-101 1.35 0.0 0.0 0.0 0.0 102-103 1.7125 0.0 0.0 0.0 0.0 104-105 2.1125 0.0 0.0 0.0 0.0 106-107 2.375 0.0 0.0 0.0 0.0 108-109 2.7 0.0 0.0 0.0 0.0 110-111 3.025 0.0 0.0 0.0 0.0 112-113 3.3375 0.0 0.0 0.0 0.0 114-115 3.6 0.0 0.0 0.0 0.0 116-117 4.075 0.0 0.0 0.0 0.0 118-119 4.5 0.0 0.0 0.0 0.0 120-121 4.9 0.0 0.0 0.0 0.0 122-123 5.512499999999999 0.0 0.0 0.0 0.0 124-125 5.987500000000001 0.0 0.0 0.0 0.0 126-127 6.4125 0.0 0.0 0.0 0.0 128-129 7.050000000000001 0.0 0.0 0.0 0.0 130-131 7.5875 0.0 0.0 0.0 0.0 132-133 8.1375 0.0 0.0 0.0 0.0 134-135 8.775 0.0 0.0 0.0 0.0 136-137 9.575 0.0 0.0 0.0 0.0 138-139 10.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5579229 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579229_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.46925 33.0 33.0 34.0 32.0 34.0 2 32.7115 33.0 33.0 34.0 32.0 34.0 3 32.736 33.0 33.0 34.0 32.0 34.0 4 32.6475 33.0 33.0 34.0 32.0 34.0 5 32.73375 34.0 33.0 34.0 32.0 34.0 6 36.79575 38.0 38.0 38.0 36.0 38.0 7 36.7895 38.0 38.0 38.0 36.0 38.0 8 36.79975 38.0 38.0 38.0 35.0 38.0 9 36.754 38.0 38.0 38.0 36.0 38.0 10-14 36.72410000000001 38.0 38.0 38.0 35.4 38.0 15-19 36.70345 38.0 38.0 38.0 35.0 38.0 20-24 36.7379 38.0 38.0 38.0 35.4 38.0 25-29 36.7659 38.0 38.0 38.0 36.0 38.0 30-34 36.65345 38.0 38.0 38.0 35.2 38.0 35-39 36.61745 38.0 38.0 38.0 35.0 38.0 40-44 36.634249999999994 38.0 38.0 38.0 35.4 38.0 45-49 36.61024999999999 38.0 38.0 38.0 35.0 38.0 50-54 36.56795 38.0 38.0 38.0 34.8 38.0 55-59 36.6093 38.0 38.0 38.0 35.0 38.0 60-64 36.4927 38.0 38.0 38.0 34.4 38.0 65-69 36.4625 38.0 38.0 38.0 34.6 38.0 70-74 36.3881 38.0 38.0 38.0 34.2 38.0 75-79 36.2732 38.0 38.0 38.0 34.0 38.0 80-84 36.31215000000001 38.0 38.0 38.0 34.0 38.0 85-89 36.222699999999996 38.0 38.0 38.0 33.8 38.0 90-94 36.0647 38.0 38.0 38.0 33.6 38.0 95-99 35.96155 38.0 38.0 38.0 33.0 38.0 100-104 35.80135 38.0 38.0 38.0 32.4 38.0 105-109 35.6102 38.0 37.8 38.0 31.2 38.0 110-114 35.55285 38.0 37.2 38.0 31.6 38.0 115-119 35.354150000000004 38.0 36.8 38.0 30.6 38.0 120-124 35.11 38.0 36.0 38.0 28.8 38.0 125-129 34.959199999999996 38.0 36.0 38.0 28.2 38.0 130-134 34.67935 38.0 35.6 38.0 27.2 38.0 135-139 34.255399999999995 38.0 35.0 38.0 23.2 38.0 140-144 33.7188 38.0 35.0 38.0 21.4 38.0 145-149 32.99355 38.0 34.0 38.0 13.6 38.0 150-151 28.99675 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 3.0 4 2.0 5 1.0 6 2.0 7 0.0 8 0.0 9 2.0 10 4.0 11 2.0 12 4.0 13 3.0 14 3.0 15 5.0 16 5.0 17 9.0 18 8.0 19 5.0 20 8.0 21 9.0 22 12.0 23 15.0 24 25.0 25 23.0 26 25.0 27 27.0 28 38.0 29 45.0 30 58.0 31 62.0 32 84.0 33 105.0 34 162.0 35 224.0 36 498.0 37 2507.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.875 15.15 12.174999999999999 31.8 2 28.050000000000004 22.725 28.825 20.4 3 23.974999999999998 25.1 24.625 26.3 4 25.75 32.074999999999996 18.95 23.225 5 27.55 33.1 18.175 21.175 6 21.8 34.1 20.075000000000003 24.025 7 18.6 16.175 39.425 25.8 8 21.75 20.200000000000003 23.799999999999997 34.25 9 24.2 21.275 25.674999999999997 28.849999999999998 10-14 25.419999999999998 25.5 23.415 25.665 15-19 25.255 24.605 24.044999999999998 26.095000000000002 20-24 24.815 24.85 24.735 25.6 25-29 25.46 25.105 24.055 25.380000000000003 30-34 25.105 24.834999999999997 24.36 25.7 35-39 25.369999999999997 25.46 23.810000000000002 25.36 40-44 25.71 24.7 24.005000000000003 25.585 45-49 25.86 24.675 24.27 25.195 50-54 25.785000000000004 24.565 24.325 25.324999999999996 55-59 26.105 24.38 24.42 25.095 60-64 25.055 24.83 24.65 25.465 65-69 25.790000000000003 25.0 24.205 25.005 70-74 25.874999999999996 24.87 24.315 24.94 75-79 26.229999999999997 25.25 24.195 24.325 80-84 26.0 24.695 24.240000000000002 25.064999999999998 85-89 25.795 25.035 24.805 24.365000000000002 90-94 25.900000000000002 24.845 24.779999999999998 24.474999999999998 95-99 25.71 25.145 24.23 24.915000000000003 100-104 25.635 25.540000000000003 24.04 24.785 105-109 25.924999999999997 24.97 24.57 24.535 110-114 25.679999999999996 25.21 24.315 24.795 115-119 26.31 24.9 24.445 24.345 120-124 25.990000000000002 25.245 24.26 24.505 125-129 26.815 25.119999999999997 24.66 23.405 130-134 27.169999999999998 24.93 23.95 23.95 135-139 26.715 25.47 24.95 22.865 140-144 27.439999999999998 25.395 23.885 23.28 145-149 27.224999999999998 25.259999999999998 24.075 23.44 150-151 27.6125 25.662499999999998 23.525 23.200000000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.0 26 1.0 27 3.5 28 3.0 29 2.5 30 6.5 31 8.5 32 11.0 33 13.5 34 23.0 35 33.5 36 41.0 37 49.5 38 58.5 39 75.5 40 91.5 41 122.0 42 140.0 43 149.0 44 157.0 45 167.0 46 171.5 47 167.5 48 171.5 49 158.5 50 156.5 51 164.0 52 158.0 53 157.5 54 140.5 55 131.5 56 130.0 57 104.0 58 102.5 59 108.5 60 98.5 61 83.5 62 76.5 63 71.5 64 70.5 65 68.0 66 58.0 67 52.5 68 47.0 69 40.5 70 39.0 71 35.0 72 23.0 73 17.5 74 14.0 75 9.5 76 6.0 77 2.0 78 2.0 79 1.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0125 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.025 0.0 0.0 0.0 0.025 64-65 0.025 0.0 0.0 0.0 0.025 66-67 0.025 0.0 0.0 0.0 0.025 68-69 0.037500000000000006 0.0 0.0 0.0 0.025 70-71 0.05 0.0 0.0 0.0 0.025 72-73 0.0625 0.0 0.0 0.0 0.025 74-75 0.0875 0.0 0.0 0.0 0.025 76-77 0.1 0.0 0.0 0.0 0.025 78-79 0.1125 0.0 0.0 0.0 0.025 80-81 0.15 0.0 0.0 0.0 0.025 82-83 0.2 0.0 0.0 0.0 0.025 84-85 0.2875 0.0 0.0 0.0 0.025 86-87 0.375 0.0 0.0 0.0 0.025 88-89 0.425 0.0 0.0 0.0 0.025 90-91 0.475 0.0 0.0 0.0 0.025 92-93 0.625 0.0 0.0 0.0 0.025 94-95 0.8125 0.0 0.0 0.0 0.025 96-97 0.9875 0.0 0.0 0.0 0.025 98-99 1.1875 0.0 0.0 0.0 0.025 100-101 1.45 0.0 0.0 0.0 0.025 102-103 1.8125 0.0 0.0 0.0 0.025 104-105 2.2125 0.0 0.0 0.0 0.025 106-107 2.4749999999999996 0.0 0.0 0.0 0.025 108-109 2.8 0.0 0.0 0.0 0.025 110-111 3.125 0.0 0.0 0.0 0.025 112-113 3.4375 0.0 0.0 0.0 0.025 114-115 3.7125000000000004 0.0 0.0 0.0 0.025 116-117 4.1875 0.0 0.0 0.0 0.025 118-119 4.625 0.0 0.0 0.0 0.025 120-121 5.0375 0.0 0.0 0.0 0.025 122-123 5.6625 0.0 0.0 0.0 0.025 124-125 6.137499999999999 0.0 0.0 0.0 0.025 126-127 6.550000000000001 0.0 0.0 0.0 0.025 128-129 7.175000000000001 0.0 0.0 0.0 0.025 130-131 7.7125 0.0 0.0 0.0 0.025 132-133 8.2625 0.0 0.0 0.0 0.025 134-135 8.925 0.0 0.0 0.0 0.025 136-137 9.825 0.0 0.0 0.0 0.025 138-139 10.475000000000001 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1473050 spots for SRR5579229.sra Written 1473050 spots for SRR5579229.sra Read 1473050 spots for SRR5579229.sra Written 1473050 spots for SRR5579229.sra Read 1473050 spots for SRR5579229.sra Written 1473050 spots for SRR5579229.sra Read 1473050 spots for SRR5579229.sra Written 1473050 spots for SRR5579229.sra Read 1473050 spots for SRR5579229.sra Written 1473050 spots for SRR5579229.sra Read 1473050 spots for SRR5579229.sra Written 1473050 spots for SRR5579229.sra Read 1473069 spots for SRR5579229.sra Written 1473069 spots for SRR5579229.sra Read 1473050 spots for SRR5579229.sra Written 1473050 spots for SRR5579229.sra Read 1473050 spots for SRR5579229.sra Written 1473050 spots for SRR5579229.sra Read 1473050 spots for SRR5579229.sra Written 1473050 spots for SRR5579229.sra Read 1473050 spots for SRR5579229.sra Written 1473050 spots for SRR5579229.sra Read 1473050 spots for SRR5579229.sra Written 1473050 spots for SRR5579229.sra Read 1473050 spots for SRR5579229.sra Written 1473050 spots for SRR5579229.sra Read 1473050 spots for SRR5579229.sra Written 1473050 spots for SRR5579229.sra Read 1473050 spots for SRR5579229.sra Written 1473050 spots for SRR5579229.sra Read 1473050 spots for SRR5579229.sra Written 1473050 spots for SRR5579229.sra Read 1473050 spots for SRR5579229.sra Written 1473050 spots for SRR5579229.sra Read 1473050 spots for SRR5579229.sra Written 1473050 spots for SRR5579229.sra Read 1473050 spots for SRR5579229.sra Written 1473050 spots for SRR5579229.sra Read 1473050 spots for SRR5579229.sra Written 1473050 spots for SRR5579229.sra SRR ids: ['SRR5579229.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_82avik4m SRR5579229.sra spots: 29461019 blocks: [[1, 1473050], [1473051, 2946100], [2946101, 4419150], [4419151, 5892200], [5892201, 7365250], [7365251, 8838300], [8838301, 10311350], [10311351, 11784400], [11784401, 13257450], [13257451, 14730500], [14730501, 16203550], [16203551, 17676600], [17676601, 19149650], [19149651, 20622700], [20622701, 22095750], [22095751, 23568800], [23568801, 25041850], [25041851, 26514900], [26514901, 27987950], [27987951, 29461019]] SRR5579229 file size 9961672 SRR5579229 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579229 SRR5579229_1.fastq SRR5579229_2.fastq Input file: SRR5579229_1.fastq Paired file: SRR5579229_2.fastq trimmed: SRR5579229-trimmed-pair1.fastq, SRR5579229-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 22:57:36 2024 >> started Mon Dec 9 22:58:11 2024 >> done (34.335s) 29461019 read pairs processed; of these: 49382 ( 0.17%) short read pairs filtered out after trimming by size control 47607 ( 0.16%) empty read pairs filtered out after trimming by size control 29364030 (99.67%) read pairs available; of these: 13064502 (44.49%) trimmed read pairs available after processing 16299528 (55.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 10 0.00% 20 13 0.00% 21 9 0.00% 22 13 0.00% 23 12 0.00% 24 20 0.00% 25 19 0.00% 26 27 0.00% 27 25 0.00% 28 25 0.00% 29 20 0.00% 30 27 0.00% 31 31 0.00% 32 25 0.00% 33 29 0.00% 34 33 0.00% 35 34 0.00% 36 43 0.00% 37 46 0.00% 38 56 0.00% 39 50 0.00% 40 52 0.00% 41 72 0.00% 42 80 0.00% 43 88 0.00% 44 97 0.00% 45 84 0.00% 46 155 0.00% 47 161 0.00% 48 150 0.00% 49 195 0.00% 50 210 0.00% 51 261 0.00% 52 294 0.00% 53 312 0.00% 54 328 0.00% 55 386 0.00% 56 454 0.00% 57 495 0.00% 58 566 0.00% 59 658 0.00% 60 771 0.00% 61 809 0.00% 62 980 0.00% 63 1099 0.00% 64 1211 0.00% 65 1364 0.00% 66 1548 0.01% 67 1685 0.01% 68 2038 0.01% 69 2303 0.01% 70 2632 0.01% 71 3117 0.01% 72 3324 0.01% 73 3949 0.01% 74 4200 0.01% 75 4703 0.02% 76 5274 0.02% 77 5926 0.02% 78 6637 0.02% 79 7609 0.03% 80 8553 0.03% 81 9809 0.03% 82 11068 0.04% 83 12153 0.04% 84 15220 0.05% 85 17302 0.06% 86 17986 0.06% 87 19006 0.06% 88 20495 0.07% 89 21568 0.07% 90 23683 0.08% 91 25617 0.09% 92 27245 0.09% 93 29457 0.10% 94 31023 0.11% 95 32877 0.11% 96 34321 0.12% 97 35544 0.12% 98 37156 0.13% 99 39303 0.13% 100 41313 0.14% 101 43821 0.15% 102 46644 0.16% 103 49467 0.17% 104 51108 0.17% 105 53745 0.18% 106 55169 0.19% 107 56314 0.19% 108 58277 0.20% 109 60017 0.20% 110 62050 0.21% 111 65503 0.22% 112 68408 0.23% 113 71087 0.24% 114 74301 0.25% 115 76755 0.26% 116 78299 0.27% 117 79684 0.27% 118 81552 0.28% 119 83799 0.29% 120 86467 0.29% 121 90079 0.31% 122 92440 0.31% 123 96810 0.33% 124 100124 0.34% 125 102337 0.35% 126 105706 0.36% 127 106920 0.36% 128 108398 0.37% 129 111686 0.38% 130 114141 0.39% 131 117571 0.40% 132 122802 0.42% 133 126762 0.43% 134 130737 0.45% 135 136237 0.46% 136 141565 0.48% 137 145396 0.50% 138 151651 0.52% 139 156828 0.53% 140 162451 0.55% 141 171304 0.58% 142 186168 0.63% 143 201536 0.69% 144 224392 0.76% 145 253557 0.86% 146 300125 1.02% 147 377834 1.29% 148 540473 1.84% 149 991141 3.38% 150 5517316 18.79% 151 16299528 55.51% 29364030 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=3.93 fanout-score-rank=30 prefix-density=0.16 prefix-fanout=3.4 sequence=GTGATGGTCTTGCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=970.42 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=28.6 sequence=CAGCAGCAGTCGGACATGGGTTCACGAAACTAAACGATGAGACGACGAAACGGAGGGCATTGACGCCGGCCGAACGAACTCGGAAGCAGAAGCAGCTTGCATCGATCTGCTTAGTAGTCGGTGGTGGGGAGCTGCTCATGG criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.46 fanout-score-rank=33 prefix-density=0.25 prefix-fanout=2.3 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=724.15 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=21.1 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR5579229 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 22:59:31 Started mapping on | Dec 09 22:59:31 Finished on | Dec 09 23:20:43 Mapping speed, Million of reads per hour | 83.11 Number of input reads | 29364030 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 22694792 Uniquely mapped reads % | 77.29% Average mapped length | 291.31 Number of splices: Total | 23803494 Number of splices: Annotated (sjdb) | 22491721 Number of splices: GT/AG | 23486794 Number of splices: GC/AG | 280416 Number of splices: AT/AC | 17590 Number of splices: Non-canonical | 18694 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.01% Deletion average length | 1.27 Insertion rate per base | 0.00% Insertion average length | 1.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 265584 % of reads mapped to multiple loci | 0.90% Number of reads mapped to too many loci | 13529 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 21.44% % of reads unmapped: other | 0.33% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 6428011 6428011 6428011 N_multimapping 265584 265584 265584 N_noFeature 584279 22065753 803761 N_ambiguous 457218 2886 49041 UnstrandedReadsAssigned:21653295 PositiveStrandReadsAssigned:626153 NegativeStrandReadsAssigned:21841990 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR5579229 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579229-trimmed-pair1.fastq SRR5579229-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,364,030 reads, 22,151,493 reads pseudoaligned [quant] estimated average fragment length: 249.788 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,094 rounds 52973 SRR5579229.ke.tsv 35125 SRR5579229.se.tsv 88098 total ==> SRR5579229.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 687.771 73.8664 6.75744 PNS24247 1044 795.212 57.5758 4.5555 PNS24249 1928 1679.21 137.16 5.13926 PNS24246 1044 795.212 57.5758 4.5555 PNS24248 1044 795.212 57.5758 4.5555 PNS24244 1471 1222.21 230.246 11.8529 PNS24243 293 101.874 0 0 KQK14069 1603 1354.21 6938.1 322.353 KQK14071 474 245.065 43.8456 11.257 ==> SRR5579229.se.tsv <== BRADI_1g14170v3 7150 BRADI_1g53295v3 83 BRADI_1g59795v3 407 BRADI_1g07683v3 0 BRADI_1g00485v3 45 BRADI_1g20270v3 1294 BRADI_1g74790v3 51 BRADI_1g09890v3 1 BRADI_1g77505v3 271 BRADI_1g48960v3 0 SRR5579229 completed mapping pipeline successfully