Starting /dee2/code/volunteer_pipeline.sh SRR5579230 current disk space = 1523078717440 free memory = 1601590920 SRR5579230 SRAfilesize 8f6da057ae6a6f5280bdd93a931f4402 SRR5579230.sra SRR5579230.sra file validated SRR5579230 is paired end SRR5579230 is conventional basespace SRR5579230 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579230_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.289 34.0 33.0 34.0 2.0 34.0 2 32.5745 34.0 33.0 34.0 28.0 34.0 3 32.773 34.0 33.0 34.0 28.0 34.0 4 33.153 34.0 33.0 34.0 32.0 34.0 5 33.1695 34.0 33.0 34.0 32.0 34.0 6 36.94725 38.0 37.0 38.0 36.0 38.0 7 37.29325 38.0 38.0 38.0 36.0 38.0 8 37.38275 38.0 38.0 38.0 37.0 38.0 9 37.47875 38.0 38.0 38.0 37.0 38.0 10-14 37.446600000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.4176 38.0 38.0 38.0 37.0 38.0 20-24 37.404500000000006 38.0 38.0 38.0 37.0 38.0 25-29 37.38945 38.0 38.0 38.0 37.0 38.0 30-34 37.33635 38.0 38.0 38.0 37.0 38.0 35-39 37.3171 38.0 38.0 38.0 37.0 38.0 40-44 37.1457 38.0 38.0 38.0 36.0 38.0 45-49 37.08125 38.0 38.0 38.0 36.0 38.0 50-54 37.0719 38.0 38.0 38.0 36.0 38.0 55-59 37.038 38.0 38.0 38.0 36.0 38.0 60-64 36.995799999999996 38.0 38.0 38.0 35.8 38.0 65-69 36.9533 38.0 38.0 38.0 35.4 38.0 70-74 36.910700000000006 38.0 38.0 38.0 35.0 38.0 75-79 36.89325 38.0 38.0 38.0 35.0 38.0 80-84 36.721799999999995 38.0 38.0 38.0 34.6 38.0 85-89 36.64165 38.0 38.0 38.0 34.2 38.0 90-94 36.53415 38.0 38.0 38.0 34.0 38.0 95-99 36.513999999999996 38.0 38.0 38.0 34.0 38.0 100-104 36.2672 38.0 37.6 38.0 33.6 38.0 105-109 36.28445 38.0 38.0 38.0 33.8 38.0 110-114 36.063900000000004 38.0 37.4 38.0 32.8 38.0 115-119 35.9894 38.0 37.0 38.0 32.8 38.0 120-124 35.73754999999999 38.0 36.4 38.0 31.8 38.0 125-129 35.5835 38.0 36.0 38.0 31.0 38.0 130-134 35.502050000000004 38.0 36.0 38.0 31.0 38.0 135-139 35.13585 38.0 35.2 38.0 29.2 38.0 140-144 34.8874 38.0 35.0 38.0 28.0 38.0 145-149 34.3418 38.0 35.0 38.0 26.8 38.0 150-151 30.8925 36.5 31.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 1.0 15 0.0 16 2.0 17 2.0 18 1.0 19 3.0 20 5.0 21 5.0 22 6.0 23 6.0 24 4.0 25 14.0 26 15.0 27 26.0 28 34.0 29 29.0 30 45.0 31 64.0 32 85.0 33 106.0 34 171.0 35 242.0 36 601.0 37 2532.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.96567505720824 12.72883295194508 8.581235697940503 33.724256292906176 2 23.35 19.025 36.225 21.4 3 22.375 24.425 23.65 29.549999999999997 4 27.775 32.0 19.225 21.0 5 25.05 33.925 21.975 19.05 6 20.150000000000002 34.55 23.1 22.2 7 17.275 18.95 42.25 21.525 8 20.525 20.549999999999997 27.975 30.95 9 21.55 19.875 29.349999999999998 29.225 10-14 23.494999999999997 26.05 24.815 25.64 15-19 22.994999999999997 25.41 25.495 26.1 20-24 23.215 25.264999999999997 25.245 26.275 25-29 23.375 25.685000000000002 24.925 26.015 30-34 23.400000000000002 25.36 25.124999999999996 26.115 35-39 23.665 25.44 25.605 25.290000000000003 40-44 23.71 25.91 25.215 25.165 45-49 23.7 24.39 25.765 26.145000000000003 50-54 23.669999999999998 25.105 24.965 26.26 55-59 23.56 25.569999999999997 25.080000000000002 25.790000000000003 60-64 24.26 25.095 24.135 26.51 65-69 23.28 24.69 25.465 26.565 70-74 24.295 24.46 24.735 26.51 75-79 24.015 25.064999999999998 25.145 25.775 80-84 24.38 25.455 24.44 25.724999999999998 85-89 24.560000000000002 25.119999999999997 24.205 26.115 90-94 24.044999999999998 25.405 24.52 26.029999999999998 95-99 24.88 24.215 24.695 26.21 100-104 24.535 24.88 24.84 25.745 105-109 24.175 24.94 25.05 25.835 110-114 24.975 25.275 24.175 25.575 115-119 25.0 25.25 24.035 25.715 120-124 24.495 25.22 24.605 25.679999999999996 125-129 24.044999999999998 25.085 24.615000000000002 26.255 130-134 24.325 25.555 24.37 25.75 135-139 24.315 25.395 24.0 26.290000000000003 140-144 24.404999999999998 24.895 24.635 26.064999999999998 145-149 24.404999999999998 25.174999999999997 24.72 25.7 150-151 23.9875 25.5125 23.8875 26.6125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.0 27 1.0 28 2.5 29 6.5 30 10.5 31 7.5 32 9.5 33 16.0 34 28.0 35 41.0 36 44.5 37 60.0 38 88.0 39 110.5 40 125.5 41 145.0 42 159.5 43 175.5 44 191.5 45 190.5 46 192.0 47 184.0 48 178.0 49 179.0 50 164.0 51 142.0 52 124.5 53 118.5 54 113.5 55 99.5 56 87.5 57 83.0 58 83.5 59 80.5 60 77.5 61 83.0 62 76.5 63 66.0 64 64.5 65 67.5 66 60.5 67 47.0 68 44.5 69 40.0 70 26.5 71 19.0 72 20.5 73 18.5 74 15.0 75 10.5 76 4.5 77 3.0 78 2.0 79 3.0 80 3.5 81 0.5 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 12.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54773869346734 99.05000000000001 2 0.4020100502512563 0.8 3 0.05025125628140704 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.825 0.0 0.0 0.0 0.0 94-95 1.0875 0.0 0.0 0.0 0.0 96-97 1.375 0.0 0.0 0.0 0.0 98-99 1.675 0.0 0.0 0.0 0.0 100-101 1.9125 0.0 0.0 0.0 0.0 102-103 2.1125 0.0 0.0 0.0 0.0 104-105 2.5125 0.0 0.0 0.0 0.0 106-107 3.0375 0.0 0.0 0.0 0.0 108-109 3.3 0.0 0.0 0.0 0.0 110-111 3.95 0.0 0.0 0.0 0.0 112-113 4.425 0.0 0.0 0.0 0.0 114-115 4.85 0.0 0.0 0.0 0.0 116-117 5.2125 0.0 0.0 0.0 0.0 118-119 5.75 0.0 0.0 0.0 0.0 120-121 6.1625 0.0 0.0 0.0 0.0 122-123 6.775 0.0 0.0 0.0 0.0 124-125 7.4125 0.0 0.0 0.0 0.0 126-127 8.037500000000001 0.0 0.0 0.0 0.0 128-129 8.649999999999999 0.0 0.0 0.0 0.0 130-131 9.3 0.0 0.0 0.0 0.0 132-133 10.0625 0.0 0.0 0.0 0.0 134-135 10.6625 0.0 0.0 0.0 0.0 136-137 11.575 0.0 0.0 0.0 0.0 138-139 12.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACACCTT 10 0.006846698 144.88751 3 TACAAGG 10 0.006846698 144.88751 6 >>END_MODULE SRR5579230 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579230_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.64975 33.0 33.0 34.0 32.0 34.0 2 32.7425 33.0 33.0 34.0 32.0 34.0 3 32.81825 33.0 33.0 34.0 32.0 34.0 4 32.693 34.0 33.0 34.0 32.0 34.0 5 32.75775 34.0 33.0 34.0 32.0 34.0 6 36.7795 38.0 38.0 38.0 35.0 38.0 7 36.826 38.0 38.0 38.0 35.0 38.0 8 36.788 38.0 38.0 38.0 35.0 38.0 9 36.82425 38.0 38.0 38.0 36.0 38.0 10-14 36.84695000000001 38.0 38.0 38.0 36.0 38.0 15-19 36.808350000000004 38.0 38.0 38.0 35.8 38.0 20-24 36.706100000000006 38.0 38.0 38.0 35.4 38.0 25-29 36.673249999999996 38.0 38.0 38.0 35.0 38.0 30-34 36.734 38.0 38.0 38.0 35.8 38.0 35-39 36.662400000000005 38.0 38.0 38.0 35.4 38.0 40-44 36.670849999999994 38.0 38.0 38.0 35.6 38.0 45-49 36.6115 38.0 38.0 38.0 35.4 38.0 50-54 36.51989999999999 38.0 38.0 38.0 34.8 38.0 55-59 36.56455 38.0 38.0 38.0 35.0 38.0 60-64 36.54945 38.0 38.0 38.0 34.8 38.0 65-69 36.4328 38.0 38.0 38.0 34.2 38.0 70-74 36.350699999999996 38.0 38.0 38.0 34.0 38.0 75-79 36.379949999999994 38.0 38.0 38.0 34.2 38.0 80-84 36.3087 38.0 38.0 38.0 34.0 38.0 85-89 36.10755 38.0 38.0 38.0 33.4 38.0 90-94 35.643100000000004 38.0 37.4 38.0 30.8 38.0 95-99 35.8134 38.0 38.0 38.0 32.2 38.0 100-104 35.66455 38.0 37.6 38.0 31.4 38.0 105-109 35.6438 38.0 37.6 38.0 31.4 38.0 110-114 35.540000000000006 38.0 37.0 38.0 31.4 38.0 115-119 35.40215 38.0 37.0 38.0 30.6 38.0 120-124 35.08145 38.0 36.2 38.0 28.8 38.0 125-129 34.876850000000005 38.0 36.0 38.0 28.0 38.0 130-134 34.4963 38.0 35.6 38.0 24.6 38.0 135-139 34.1036 38.0 35.0 38.0 23.2 38.0 140-144 33.673649999999995 38.0 35.0 38.0 21.4 38.0 145-149 32.7872 38.0 33.6 38.0 11.0 38.0 150-151 28.400750000000002 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 9.0 4 5.0 5 1.0 6 2.0 7 4.0 8 1.0 9 2.0 10 3.0 11 2.0 12 5.0 13 2.0 14 4.0 15 3.0 16 4.0 17 6.0 18 6.0 19 7.0 20 9.0 21 6.0 22 10.0 23 23.0 24 18.0 25 30.0 26 27.0 27 39.0 28 46.0 29 37.0 30 48.0 31 69.0 32 84.0 33 95.0 34 153.0 35 230.0 36 575.0 37 2430.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.224999999999994 15.049999999999999 9.125 31.6 2 25.7 21.45 31.474999999999998 21.375 3 24.575 23.724999999999998 26.025 25.674999999999997 4 28.95 31.424999999999997 16.55 23.075000000000003 5 27.800000000000004 33.525 18.125 20.549999999999997 6 21.825 33.725 20.674999999999997 23.775 7 20.225 15.65 38.025 26.1 8 21.775 20.325 23.95 33.95 9 24.275 20.7 25.324999999999996 29.7 10-14 25.96 25.540000000000003 22.445 26.055 15-19 25.515 24.715 24.11 25.66 20-24 26.224999999999998 24.855 23.505000000000003 25.415 25-29 25.395 24.52 24.279999999999998 25.805 30-34 26.13 24.44 24.23 25.2 35-39 25.900000000000002 25.215 23.29 25.595000000000002 40-44 26.71 24.610000000000003 23.84 24.84 45-49 26.22 24.495 23.715 25.569999999999997 50-54 26.445 24.395 23.825 25.335 55-59 26.565 24.615000000000002 23.26 25.56 60-64 25.629999999999995 24.685000000000002 24.205 25.480000000000004 65-69 25.564999999999998 25.34 24.215 24.88 70-74 25.740000000000002 24.375 24.395 25.490000000000002 75-79 26.19 24.26 24.22 25.330000000000002 80-84 25.965 25.069999999999997 23.865 25.1 85-89 26.724999999999998 24.044999999999998 24.21 25.019999999999996 90-94 26.11 25.264999999999997 23.74 24.884999999999998 95-99 26.395000000000003 24.985 23.974999999999998 24.645 100-104 26.435 24.58 24.025 24.959999999999997 105-109 27.11 24.625 24.235 24.03 110-114 27.0 25.019999999999996 24.145 23.835 115-119 27.060000000000002 25.435000000000002 23.66 23.845 120-124 27.224999999999998 25.130000000000003 23.47 24.175 125-129 27.41 25.09 24.055 23.445 130-134 27.975 25.174999999999997 23.87 22.98 135-139 28.16 25.585 23.53 22.725 140-144 27.915 24.8 23.745 23.54 145-149 28.235 25.7 23.865 22.2 150-151 27.800000000000004 26.325 23.0125 22.8625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 2.0 27 2.5 28 3.0 29 3.5 30 3.5 31 4.5 32 6.5 33 8.5 34 10.0 35 20.5 36 31.0 37 47.5 38 67.5 39 85.5 40 101.5 41 128.5 42 153.0 43 159.0 44 183.0 45 182.0 46 180.0 47 178.5 48 159.5 49 164.5 50 153.5 51 129.5 52 112.0 53 102.0 54 104.0 55 101.5 56 92.5 57 89.0 58 96.5 59 108.5 60 107.0 61 97.0 62 103.0 63 99.0 64 89.5 65 85.0 66 70.5 67 64.0 68 62.0 69 57.5 70 47.0 71 38.5 72 32.0 73 21.0 74 14.5 75 12.5 76 9.0 77 5.0 78 3.0 79 1.5 80 2.0 81 2.0 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21756688541142 98.275 2 0.6562342251388188 1.3 3 0.10095911155981827 0.3 4 0.0 0.0 5 0.025239777889954566 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.825 0.0 0.0 0.0 0.0 94-95 1.1 0.0 0.0 0.0 0.0 96-97 1.4 0.0 0.0 0.0 0.0 98-99 1.675 0.0 0.0 0.0 0.0 100-101 1.9125 0.0 0.0 0.0 0.0 102-103 2.1125 0.0 0.0 0.0 0.0 104-105 2.5125 0.0 0.0 0.0 0.0 106-107 3.0375 0.0 0.0 0.0 0.0 108-109 3.3 0.0 0.0 0.0 0.0 110-111 3.95 0.0 0.0 0.0 0.0 112-113 4.45 0.0 0.0 0.0 0.0 114-115 4.8625 0.0 0.0 0.0 0.0 116-117 5.225 0.0 0.0 0.0 0.0 118-119 5.7625 0.0 0.0 0.0 0.0 120-121 6.175000000000001 0.0 0.0 0.0 0.0 122-123 6.775 0.0 0.0 0.0 0.0 124-125 7.425000000000001 0.0 0.0 0.0 0.0 126-127 8.05 0.0 0.0 0.0 0.0 128-129 8.649999999999999 0.0 0.0 0.0 0.0 130-131 9.274999999999999 0.0 0.0 0.0 0.0 132-133 10.037500000000001 0.0 0.0 0.0 0.0 134-135 10.6375 0.0 0.0 0.0 0.0 136-137 11.575 0.0 0.0 0.0 0.0 138-139 12.524999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACTGGT 10 0.006830828 145.0 9 AAAAAAA 30 0.0014437955 24.166668 140-144 >>END_MODULE Read 1356822 spots for SRR5579230.sra Written 1356822 spots for SRR5579230.sra Read 1356822 spots for SRR5579230.sra Written 1356822 spots for SRR5579230.sra Read 1356822 spots for SRR5579230.sra Written 1356822 spots for SRR5579230.sra Read 1356822 spots for SRR5579230.sra Written 1356822 spots for SRR5579230.sra Read 1356822 spots for SRR5579230.sra Written 1356822 spots for SRR5579230.sra Read 1356822 spots for SRR5579230.sra Written 1356822 spots for SRR5579230.sra Read 1356822 spots for SRR5579230.sra Written 1356822 spots for SRR5579230.sra Read 1356822 spots for SRR5579230.sra Written 1356822 spots for SRR5579230.sra Read 1356822 spots for SRR5579230.sra Written 1356822 spots for SRR5579230.sra Read 1356822 spots for SRR5579230.sra Written 1356822 spots for SRR5579230.sra Read 1356834 spots for SRR5579230.sra Written 1356834 spots for SRR5579230.sra Read 1356822 spots for SRR5579230.sra Written 1356822 spots for SRR5579230.sra Read 1356822 spots for SRR5579230.sra Written 1356822 spots for SRR5579230.sra Read 1356822 spots for SRR5579230.sra Written 1356822 spots for SRR5579230.sra Read 1356822 spots for SRR5579230.sra Written 1356822 spots for SRR5579230.sra Read 1356822 spots for SRR5579230.sra Written 1356822 spots for SRR5579230.sra Read 1356822 spots for SRR5579230.sra Written 1356822 spots for SRR5579230.sra Read 1356822 spots for SRR5579230.sra Written 1356822 spots for SRR5579230.sra Read 1356822 spots for SRR5579230.sra Written 1356822 spots for SRR5579230.sra Read 1356822 spots for SRR5579230.sra Written 1356822 spots for SRR5579230.sra SRR ids: ['SRR5579230.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qv8rxtif SRR5579230.sra spots: 27136452 blocks: [[1, 1356822], [1356823, 2713644], [2713645, 4070466], [4070467, 5427288], [5427289, 6784110], [6784111, 8140932], [8140933, 9497754], [9497755, 10854576], [10854577, 12211398], [12211399, 13568220], [13568221, 14925042], [14925043, 16281864], [16281865, 17638686], [17638687, 18995508], [18995509, 20352330], [20352331, 21709152], [21709153, 23065974], [23065975, 24422796], [24422797, 25779618], [25779619, 27136452]] SRR5579230 file size 9173952 SRR5579230 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579230 SRR5579230_1.fastq SRR5579230_2.fastq Input file: SRR5579230_1.fastq Paired file: SRR5579230_2.fastq trimmed: SRR5579230-trimmed-pair1.fastq, SRR5579230-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 22:59:19 2024 >> started Mon Dec 9 22:59:52 2024 >> done (32.706s) 27136452 read pairs processed; of these: 37728 ( 0.14%) short read pairs filtered out after trimming by size control 28731 ( 0.11%) empty read pairs filtered out after trimming by size control 27069993 (99.76%) read pairs available; of these: 12195807 (45.05%) trimmed read pairs available after processing 14874186 (54.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 27 0.00% 19 22 0.00% 20 11 0.00% 21 20 0.00% 22 15 0.00% 23 20 0.00% 24 23 0.00% 25 22 0.00% 26 32 0.00% 27 20 0.00% 28 33 0.00% 29 36 0.00% 30 32 0.00% 31 41 0.00% 32 42 0.00% 33 39 0.00% 34 38 0.00% 35 49 0.00% 36 47 0.00% 37 58 0.00% 38 51 0.00% 39 88 0.00% 40 71 0.00% 41 87 0.00% 42 116 0.00% 43 103 0.00% 44 134 0.00% 45 120 0.00% 46 145 0.00% 47 169 0.00% 48 189 0.00% 49 234 0.00% 50 264 0.00% 51 296 0.00% 52 346 0.00% 53 326 0.00% 54 368 0.00% 55 455 0.00% 56 524 0.00% 57 594 0.00% 58 667 0.00% 59 847 0.00% 60 866 0.00% 61 1036 0.00% 62 1150 0.00% 63 1267 0.00% 64 1353 0.00% 65 1600 0.01% 66 1785 0.01% 67 1991 0.01% 68 2282 0.01% 69 2879 0.01% 70 3141 0.01% 71 3534 0.01% 72 3871 0.01% 73 4466 0.02% 74 5023 0.02% 75 5478 0.02% 76 6007 0.02% 77 6766 0.02% 78 7648 0.03% 79 8701 0.03% 80 9893 0.04% 81 11078 0.04% 82 12732 0.05% 83 13877 0.05% 84 16667 0.06% 85 18433 0.07% 86 19349 0.07% 87 21081 0.08% 88 22326 0.08% 89 23860 0.09% 90 26012 0.10% 91 27795 0.10% 92 30152 0.11% 93 32260 0.12% 94 34458 0.13% 95 35416 0.13% 96 37675 0.14% 97 39542 0.15% 98 40962 0.15% 99 43925 0.16% 100 45703 0.17% 101 48702 0.18% 102 51986 0.19% 103 54528 0.20% 104 56630 0.21% 105 58419 0.22% 106 61362 0.23% 107 62031 0.23% 108 64119 0.24% 109 67140 0.25% 110 68873 0.25% 111 71236 0.26% 112 75432 0.28% 113 77043 0.28% 114 80973 0.30% 115 83816 0.31% 116 83682 0.31% 117 86698 0.32% 118 86829 0.32% 119 89406 0.33% 120 92800 0.34% 121 95129 0.35% 122 97556 0.36% 123 101448 0.37% 124 105599 0.39% 125 107366 0.40% 126 109429 0.40% 127 111032 0.41% 128 112673 0.42% 129 114656 0.42% 130 116542 0.43% 131 118165 0.44% 132 124123 0.46% 133 127381 0.47% 134 131202 0.48% 135 136715 0.51% 136 139587 0.52% 137 141893 0.52% 138 146834 0.54% 139 151814 0.56% 140 155688 0.58% 141 165015 0.61% 142 174267 0.64% 143 185625 0.69% 144 203851 0.75% 145 228784 0.85% 146 264585 0.98% 147 328986 1.22% 148 452891 1.67% 149 826321 3.05% 150 4858084 17.95% 151 14874186 54.95% 27069993 reads passed initial QC criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=22 prefix-density=0.79 prefix-fanout=2.1 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCC criterion=fanout-score sequence-density=0.20 sequence-density-rank=25 fanout-score=12.73 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=4.2 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=3.65 fanout-score-rank=15 prefix-density=0.77 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=120.46 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=9.1 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR5579230 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 23:00:38 Started mapping on | Dec 09 23:00:38 Finished on | Dec 09 23:02:34 Mapping speed, Million of reads per hour | 840.10 Number of input reads | 27069993 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 26326931 Uniquely mapped reads % | 97.26% Average mapped length | 289.80 Number of splices: Total | 27622627 Number of splices: Annotated (sjdb) | 26085332 Number of splices: GT/AG | 27266667 Number of splices: GC/AG | 322918 Number of splices: AT/AC | 13484 Number of splices: Non-canonical | 19558 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.30 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 261172 % of reads mapped to multiple loci | 0.96% Number of reads mapped to too many loci | 13116 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.47% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 507717 507717 507717 N_multimapping 261172 261172 261172 N_noFeature 829242 25535407 1114967 N_ambiguous 591811 3628 86770 UnstrandedReadsAssigned:24905878 PositiveStrandReadsAssigned:787896 NegativeStrandReadsAssigned:25125194 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR5579230 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579230-trimmed-pair1.fastq SRR5579230-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,069,993 reads, 25,224,111 reads pseudoaligned [quant] estimated average fragment length: 242.777 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,145 rounds 52973 SRR5579230.ke.tsv 35125 SRR5579230.se.tsv 88098 total ==> SRR5579230.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 694.778 0 0 PNS24247 1044 802.223 70.6561 4.96734 PNS24249 1928 1686.22 90.7623 3.03571 PNS24246 1044 802.223 70.6561 4.96734 PNS24248 1044 802.223 70.6561 4.96734 PNS24244 1471 1229.22 107.269 4.9217 PNS24243 293 107.375 1 0.52525 KQK14069 1603 1361.22 7884.36 326.668 KQK14071 474 253.12 236.522 52.7005 ==> SRR5579230.se.tsv <== BRADI_1g14170v3 9010 BRADI_1g53295v3 91 BRADI_1g59795v3 704 BRADI_1g07683v3 0 BRADI_1g00485v3 71 BRADI_1g20270v3 3392 BRADI_1g74790v3 83 BRADI_1g09890v3 2 BRADI_1g77505v3 307 BRADI_1g48960v3 0 SRR5579230 completed mapping pipeline successfully