Starting /dee2/code/volunteer_pipeline.sh SRR5579232 current disk space = 1523121451008 free memory = 1392116680 SRR5579232 SRAfilesize 8cfac2002fdc37d7368e12f932702bf0 SRR5579232.sra SRR5579232.sra file validated SRR5579232 is paired end SRR5579232 is conventional basespace SRR5579232 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579232_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.662 34.0 33.0 34.0 32.0 34.0 2 33.15875 34.0 33.0 34.0 32.0 34.0 3 33.277 34.0 33.0 34.0 32.0 34.0 4 33.4765 34.0 33.0 34.0 33.0 34.0 5 33.46725 34.0 33.0 34.0 33.0 34.0 6 37.34325 38.0 38.0 38.0 36.0 38.0 7 37.51975 38.0 38.0 38.0 37.0 38.0 8 37.52375 38.0 38.0 38.0 38.0 38.0 9 37.55675 38.0 38.0 38.0 38.0 38.0 10-14 37.6089 38.0 38.0 38.0 38.0 38.0 15-19 37.53005 38.0 38.0 38.0 38.0 38.0 20-24 37.543150000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.384150000000005 38.0 38.0 38.0 37.6 38.0 30-34 37.372699999999995 38.0 38.0 38.0 37.6 38.0 35-39 37.131150000000005 38.0 38.0 38.0 36.6 38.0 40-44 37.049549999999996 38.0 38.0 38.0 36.6 38.0 45-49 37.101800000000004 38.0 38.0 38.0 36.6 38.0 50-54 37.3091 38.0 38.0 38.0 37.0 38.0 55-59 37.1382 38.0 38.0 38.0 36.8 38.0 60-64 37.248400000000004 38.0 38.0 38.0 37.0 38.0 65-69 36.92325 38.0 38.0 38.0 36.0 38.0 70-74 37.00325 38.0 38.0 38.0 36.0 38.0 75-79 36.83945 38.0 38.0 38.0 35.6 38.0 80-84 36.6998 38.0 38.0 38.0 34.8 38.0 85-89 36.754000000000005 38.0 38.0 38.0 35.2 38.0 90-94 36.57190000000001 38.0 38.0 38.0 34.4 38.0 95-99 36.455349999999996 38.0 38.0 38.0 34.0 38.0 100-104 36.028150000000004 38.0 37.8 38.0 33.0 38.0 105-109 36.2383 38.0 38.0 38.0 33.8 38.0 110-114 35.653499999999994 38.0 36.6 38.0 31.0 38.0 115-119 35.49640000000001 38.0 36.4 38.0 30.4 38.0 120-124 35.57430000000001 38.0 36.4 38.0 31.0 38.0 125-129 35.2908 38.0 36.2 38.0 30.6 38.0 130-134 34.87075 38.0 35.0 38.0 28.4 38.0 135-139 34.43455 38.0 34.4 38.0 26.4 38.0 140-144 33.893299999999996 38.0 33.0 38.0 23.6 38.0 145-149 32.738099999999996 38.0 33.0 38.0 15.6 38.0 150-151 27.162625 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 3.0 9 1.0 10 1.0 11 1.0 12 1.0 13 1.0 14 1.0 15 3.0 16 2.0 17 1.0 18 8.0 19 6.0 20 4.0 21 7.0 22 7.0 23 7.0 24 11.0 25 15.0 26 23.0 27 15.0 28 43.0 29 31.0 30 45.0 31 54.0 32 77.0 33 99.0 34 167.0 35 264.0 36 693.0 37 2409.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.608465608465615 13.65079365079365 8.253968253968253 27.486772486772487 2 24.3 19.575 32.775 23.35 3 21.95 26.974999999999998 24.625 26.450000000000003 4 26.650000000000002 31.65 19.2 22.5 5 24.975 35.25 22.275 17.5 6 21.0 34.949999999999996 22.5 21.55 7 17.724999999999998 21.425 40.150000000000006 20.7 8 19.1 20.875 28.625 31.4 9 21.6 19.975 29.425 28.999999999999996 10-14 22.865 26.605 24.765 25.765 15-19 23.35 25.355 25.715 25.580000000000002 20-24 22.96574143535884 25.41635408852213 25.771442860715176 25.846461615403847 25-29 23.78 25.835 25.290000000000003 25.095 30-34 23.55824538588506 26.049117191016858 25.518931626069126 24.87370579702896 35-39 23.927392739273927 25.762576257625764 25.357535753575355 24.952495249524954 40-44 23.571785892946473 25.892946473236616 25.05752876438219 25.477738869434717 45-49 23.80071031964384 26.26181781801811 24.971237056675506 24.96623480566255 50-54 23.0076542098154 25.6691180149082 25.37395567562159 25.949272099654806 55-59 23.69921953171903 25.285171102661597 25.485291174704823 25.530318190914546 60-64 23.901950975487743 25.767883941970986 25.307653826913455 25.022511255627816 65-69 23.730424776104467 25.476559763846502 25.221393906038927 25.571621554010104 70-74 23.898143979188553 25.4990244634549 25.27890339686828 25.32392816048827 75-79 23.84738473847385 25.837583758375835 24.917491749174918 25.397539753975394 80-84 24.097409740974097 25.412541254125415 24.922492249224923 25.567556755675568 85-89 23.832383238323832 25.34253425342534 24.992499249924993 25.83258325832583 90-94 24.26985397079416 25.275055011002202 25.365073014602917 25.090018003600722 95-99 24.030231743330496 25.441713799489463 25.10636167976375 25.42169277741629 100-104 23.6168084042021 24.907453726863434 25.477738869434717 25.99799899949975 105-109 24.273641046156925 25.483822573386007 24.978746812021804 25.263789568435264 110-114 24.009020295665245 24.91606113755951 25.53745928338762 25.53745928338762 115-119 24.24621231061553 25.781289064453222 24.491224561228062 25.481274063703186 120-124 24.72 25.2 24.72 25.36 125-129 24.215 25.145 24.63 26.009999999999998 130-134 25.069999999999997 24.990000000000002 24.8 25.14 135-139 23.96 25.66 24.67 25.71 140-144 24.27 25.545 24.355 25.83 145-149 24.275 25.755 24.68 25.290000000000003 150-151 25.0 24.837500000000002 25.137500000000003 25.025 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 1.0 25 1.5 26 1.5 27 2.5 28 3.5 29 6.0 30 6.0 31 12.0 32 16.5 33 26.5 34 36.5 35 35.5 36 48.5 37 65.5 38 86.5 39 109.5 40 113.5 41 135.0 42 156.0 43 161.0 44 178.5 45 205.5 46 209.5 47 187.5 48 169.5 49 169.0 50 170.5 51 155.5 52 145.0 53 137.0 54 132.5 55 124.5 56 113.0 57 99.5 58 89.5 59 82.0 60 75.5 61 79.0 62 72.0 63 59.0 64 58.5 65 48.5 66 35.5 67 34.5 68 30.5 69 28.0 70 25.0 71 16.5 72 11.0 73 8.5 74 7.0 75 4.5 76 2.5 77 2.0 78 2.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.025 25-29 0.0 30-34 0.034999999999999996 35-39 0.01 40-44 0.05 45-49 0.045 50-54 0.055 55-59 0.06 60-64 0.05 65-69 0.065 70-74 0.055 75-79 0.01 80-84 0.01 85-89 0.01 90-94 0.02 95-99 0.105 100-104 0.05 105-109 0.015 110-114 0.22499999999999998 115-119 0.005 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77420973406925 99.425 2 0.15052684395383845 0.3 3 0.050175614651279475 0.15 4 0.0 0.0 5 0.025087807325639738 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGTTTCGATCTCGTATGC 5 0.125 TruSeq Adapter, Index 21 (98% over 50bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.6125 0.0 0.0 0.0 0.0 90-91 0.75 0.0 0.0 0.0 0.0 92-93 0.825 0.0 0.0 0.0 0.0 94-95 0.9375 0.0 0.0 0.0 0.0 96-97 1.15 0.0 0.0 0.0 0.0 98-99 1.35 0.0 0.0 0.0 0.0 100-101 1.6 0.0 0.0 0.0 0.0 102-103 1.9874999999999998 0.0 0.0 0.0 0.0 104-105 2.2375 0.0 0.0 0.0 0.0 106-107 2.5 0.0 0.0 0.0 0.0 108-109 2.8625 0.0 0.0 0.0 0.0 110-111 3.275 0.0 0.0 0.0 0.0 112-113 3.75 0.0 0.0 0.0 0.0 114-115 4.275 0.0 0.0 0.0 0.0 116-117 4.6625 0.0 0.0 0.0 0.0 118-119 5.175 0.0 0.0 0.0 0.0 120-121 5.6375 0.0 0.0 0.0 0.0 122-123 6.2125 0.0 0.0 0.0 0.0 124-125 6.8 0.0 0.0 0.0 0.0 126-127 7.3875 0.0 0.0 0.0 0.0 128-129 8.025 0.0 0.0 0.0 0.0 130-131 8.5125 0.0 0.0 0.0 0.0 132-133 9.05 0.0 0.0 0.0 0.0 134-135 9.6875 0.0 0.0 0.0 0.0 136-137 10.1875 0.0 0.0 0.0 0.0 138-139 10.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5579232 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579232_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.75725 33.0 33.0 34.0 32.0 34.0 2 32.8315 34.0 33.0 34.0 32.0 34.0 3 32.8845 34.0 33.0 34.0 32.0 34.0 4 32.89075 34.0 33.0 34.0 32.0 34.0 5 32.92875 34.0 33.0 34.0 32.0 34.0 6 37.04375 38.0 38.0 38.0 37.0 38.0 7 37.08 38.0 38.0 38.0 37.0 38.0 8 37.04 38.0 38.0 38.0 37.0 38.0 9 36.818 38.0 38.0 38.0 36.0 38.0 10-14 36.97365 38.0 38.0 38.0 37.0 38.0 15-19 36.94675 38.0 38.0 38.0 36.8 38.0 20-24 36.988800000000005 38.0 38.0 38.0 37.0 38.0 25-29 36.93079999999999 38.0 38.0 38.0 37.0 38.0 30-34 36.98115 38.0 38.0 38.0 37.0 38.0 35-39 37.030449999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.06635 38.0 38.0 38.0 37.0 38.0 45-49 36.955499999999994 38.0 38.0 38.0 37.0 38.0 50-54 36.936350000000004 38.0 38.0 38.0 37.0 38.0 55-59 36.841100000000004 38.0 38.0 38.0 36.4 38.0 60-64 36.7725 38.0 38.0 38.0 36.2 38.0 65-69 36.632600000000004 38.0 38.0 38.0 35.6 38.0 70-74 36.3056 38.0 38.0 38.0 34.4 38.0 75-79 36.291 38.0 38.0 38.0 34.2 38.0 80-84 36.3215 38.0 38.0 38.0 34.2 38.0 85-89 36.30415000000001 38.0 38.0 38.0 34.4 38.0 90-94 36.344500000000004 38.0 38.0 38.0 34.6 38.0 95-99 36.2977 38.0 38.0 38.0 34.0 38.0 100-104 36.067 38.0 38.0 38.0 33.8 38.0 105-109 35.9125 38.0 38.0 38.0 33.2 38.0 110-114 35.56875 38.0 38.0 38.0 31.8 38.0 115-119 35.38005 38.0 37.4 38.0 30.8 38.0 120-124 34.6657 38.0 36.0 38.0 25.8 38.0 125-129 34.42100000000001 38.0 36.0 38.0 24.6 38.0 130-134 34.148250000000004 38.0 35.2 38.0 24.4 38.0 135-139 33.844 38.0 34.6 38.0 22.2 38.0 140-144 33.337399999999995 38.0 34.0 38.0 17.6 38.0 145-149 32.09125 38.0 33.0 38.0 8.2 38.0 150-151 25.970375 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 4.0 4 0.0 5 1.0 6 1.0 7 1.0 8 2.0 9 4.0 10 3.0 11 7.0 12 3.0 13 1.0 14 6.0 15 3.0 16 7.0 17 6.0 18 7.0 19 7.0 20 8.0 21 5.0 22 17.0 23 11.0 24 20.0 25 27.0 26 22.0 27 28.0 28 27.0 29 38.0 30 51.0 31 58.0 32 67.0 33 90.0 34 140.0 35 248.0 36 601.0 37 2463.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.11490215755143 16.758655293527347 10.160561966884094 25.965880582037133 2 28.14851981936779 21.575514300050173 27.29553437029604 22.980431510286 3 24.974899598393574 23.519076305220885 27.158634538152608 24.347389558232933 4 26.99448068238836 31.911690918213747 18.28901154039137 22.80481685900652 5 26.61816357250376 34.26994480682388 18.138484696437533 20.973406924234823 6 22.389558232931726 35.567269076305216 19.67871485943775 22.364457831325304 7 20.526315789473685 16.56641604010025 38.27067669172932 24.636591478696744 8 21.57354046604861 20.972187421698823 23.277374091706342 34.17689802054623 9 24.310085298544905 22.00200702458605 25.539387857501257 28.14851981936779 10-14 25.305795067174653 26.223180268698616 23.24543813916182 25.22558652496491 15-19 25.176470588235293 24.770963704630788 24.380475594493117 25.6720901126408 20-24 25.42457792695757 25.339411853113567 24.25730173838986 24.978708481538998 25-29 25.05630912458081 26.072375994794534 24.2854997747635 24.58581510586115 30-34 25.036309911353733 25.186557820403664 24.785896729603845 24.991235538638755 35-39 25.436795994993744 25.566958698372964 23.60951188986233 25.386733416770962 40-44 25.12771711910247 25.298006611239103 24.466593208454373 25.107683061204046 45-49 25.40215484840892 24.99123026810323 24.69055374592834 24.91606113755951 50-54 25.453452249724425 25.383304940374785 24.336105822226674 24.827136987674116 55-59 25.25166524765864 25.211599138578656 24.8960785295738 24.64065708418891 60-64 25.66633266533066 25.51102204408818 24.3687374749499 24.45390781563126 65-69 25.803378954228705 24.926054043214517 24.540031082368277 24.730535920188498 70-74 25.6062124248497 25.6563126252505 24.649298597194388 24.08817635270541 75-79 25.933350037584564 24.69556502129792 24.59533951390629 24.775745427211227 80-84 25.66633266533066 25.32064128256513 24.854709418837675 24.158316633266534 85-89 26.014834118472486 25.38839330460058 24.511376165179914 24.085396411747016 90-94 25.927780838383335 25.191566084038662 24.415285220614013 24.46536785696399 95-99 25.702690515556892 25.096447717821533 24.595420612255122 24.60544115436645 100-104 25.563232201862423 25.59327125262842 24.551917492740564 24.2915790527686 105-109 25.688394913387402 25.167718033443474 24.596976068889557 24.546910984279563 110-114 26.50197925539911 25.615072405672194 24.026657313223428 23.856291025705268 115-119 26.27441161742614 25.518277416124185 24.216324486730095 23.990986479719577 120-124 26.283912303533885 25.38792671939133 24.261687856642304 24.066473120432473 125-129 26.954299458809384 25.04008819402686 24.629184205251555 23.376428141912207 130-134 27.145648579588155 25.782854852447517 24.049301067187734 23.022195500776593 135-139 27.31054530874098 25.656575781876505 24.157979149959903 22.874899759422615 140-144 27.620432101859745 25.75066419369392 24.136548197904656 22.49235550654168 145-149 27.236749824666866 25.643723073840295 24.155896202785293 22.963630898707542 150-151 28.175895765472315 26.10874467551992 23.891255324480078 21.824104234527688 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.5 5 0.5 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 1.0 23 1.0 24 1.0 25 1.5 26 1.5 27 2.0 28 2.5 29 3.0 30 4.0 31 7.0 32 10.0 33 15.0 34 26.0 35 31.0 36 33.5 37 45.5 38 63.5 39 79.0 40 104.5 41 138.5 42 147.5 43 147.0 44 159.0 45 172.0 46 184.5 47 197.5 48 190.0 49 176.0 50 168.0 51 157.0 52 152.5 53 148.0 54 133.0 55 115.5 56 115.5 57 115.0 58 108.5 59 96.5 60 87.5 61 83.5 62 70.0 63 67.0 64 67.0 65 62.0 66 53.0 67 47.0 68 43.0 69 40.0 70 32.5 71 20.5 72 22.0 73 17.5 74 8.5 75 6.5 76 3.0 77 1.0 78 1.5 79 1.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.35000000000000003 3 0.4 4 0.35000000000000003 5 0.35000000000000003 6 0.4 7 0.25 8 0.22499999999999998 9 0.35000000000000003 10-14 0.26 15-19 0.125 20-24 0.19499999999999998 25-29 0.105 30-34 0.165 35-39 0.125 40-44 0.16999999999999998 45-49 0.22499999999999998 50-54 0.21 55-59 0.165 60-64 0.2 65-69 0.265 70-74 0.2 75-79 0.22499999999999998 80-84 0.2 85-89 0.22999999999999998 90-94 0.165 95-99 0.20500000000000002 100-104 0.13 105-109 0.13 110-114 0.215 115-119 0.15 120-124 0.11 125-129 0.22 130-134 0.20500000000000002 135-139 0.24 140-144 0.255 145-149 0.19 150-151 0.22499999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82434127979924 99.45 2 0.10037641154328732 0.2 3 0.0 0.0 4 0.02509410288582183 0.1 5 0.05018820577164366 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 5 0.125 No Hit GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 5 0.125 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.5875 0.0 0.0 0.0 0.0 90-91 0.75 0.0 0.0 0.0 0.0 92-93 0.825 0.0 0.0 0.0 0.0 94-95 0.9375 0.0 0.0 0.0 0.0 96-97 1.15 0.0 0.0 0.0 0.0 98-99 1.3624999999999998 0.0 0.0 0.0 0.0 100-101 1.625 0.0 0.0 0.0 0.0 102-103 2.0125 0.0 0.0 0.0 0.0 104-105 2.2625 0.0 0.0 0.0 0.0 106-107 2.5 0.0 0.0 0.0 0.0 108-109 2.875 0.0 0.0 0.0 0.0 110-111 3.3 0.0 0.0 0.0 0.0 112-113 3.7625 0.0 0.0 0.0 0.0 114-115 4.300000000000001 0.0 0.0 0.0 0.0 116-117 4.6875 0.0 0.0 0.0 0.0 118-119 5.1875 0.0 0.0 0.0 0.0 120-121 5.6375 0.0 0.0 0.0 0.0 122-123 6.25 0.0 0.0 0.0 0.0 124-125 6.825 0.0 0.0 0.0 0.0 126-127 7.4875 0.0 0.0 0.0 0.0 128-129 8.125 0.0 0.0 0.0 0.0 130-131 8.6125 0.0 0.0 0.0 0.0 132-133 9.175 0.0 0.0 0.0 0.0 134-135 9.8125 0.0 0.0 0.0 0.0 136-137 10.3625 0.0 0.0 0.0 0.0 138-139 10.962499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATCCTT 10 0.006830828 145.0 145 ACGATTC 10 0.006830828 145.0 8 >>END_MODULE Read 952342 spots for SRR5579232.sra Written 952342 spots for SRR5579232.sra Read 952342 spots for SRR5579232.sra Written 952342 spots for SRR5579232.sra Read 952342 spots for SRR5579232.sra Written 952342 spots for SRR5579232.sra Read 952342 spots for SRR5579232.sra Written 952342 spots for SRR5579232.sra Read 952342 spots for SRR5579232.sra Written 952342 spots for SRR5579232.sra Read 952342 spots for SRR5579232.sra Written 952342 spots for SRR5579232.sra Read 952342 spots for SRR5579232.sra Written 952342 spots for SRR5579232.sra Read 952342 spots for SRR5579232.sra Written 952342 spots for SRR5579232.sra Read 952342 spots for SRR5579232.sra Written 952342 spots for SRR5579232.sra Read 952342 spots for SRR5579232.sra Written 952342 spots for SRR5579232.sra Read 952342 spots for SRR5579232.sra Written 952342 spots for SRR5579232.sra Read 952342 spots for SRR5579232.sra Written 952342 spots for SRR5579232.sra Read 952343 spots for SRR5579232.sra Written 952343 spots for SRR5579232.sra Read 952342 spots for SRR5579232.sra Written 952342 spots for SRR5579232.sra Read 952342 spots for SRR5579232.sra Written 952342 spots for SRR5579232.sra Read 952342 spots for SRR5579232.sra Written 952342 spots for SRR5579232.sra Read 952342 spots for SRR5579232.sra Written 952342 spots for SRR5579232.sra Read 952342 spots for SRR5579232.sra Written 952342 spots for SRR5579232.sra Read 952342 spots for SRR5579232.sra Written 952342 spots for SRR5579232.sra Read 952342 spots for SRR5579232.sra Written 952342 spots for SRR5579232.sra SRR ids: ['SRR5579232.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_83uk_q_d SRR5579232.sra spots: 19046841 blocks: [[1, 952342], [952343, 1904684], [1904685, 2857026], [2857027, 3809368], [3809369, 4761710], [4761711, 5714052], [5714053, 6666394], [6666395, 7618736], [7618737, 8571078], [8571079, 9523420], [9523421, 10475762], [10475763, 11428104], [11428105, 12380446], [12380447, 13332788], [13332789, 14285130], [14285131, 15237472], [15237473, 16189814], [16189815, 17142156], [17142157, 18094498], [18094499, 19046841]] SRR5579232 file size 6432649 SRR5579232 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579232 SRR5579232_1.fastq SRR5579232_2.fastq Input file: SRR5579232_1.fastq Paired file: SRR5579232_2.fastq trimmed: SRR5579232-trimmed-pair1.fastq, SRR5579232-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 22:58:18 2024 >> started Mon Dec 9 22:58:57 2024 >> done (38.977s) 19046841 read pairs processed; of these: 19203 ( 0.10%) short read pairs filtered out after trimming by size control 82343 ( 0.43%) empty read pairs filtered out after trimming by size control 18945295 (99.47%) read pairs available; of these: 11499539 (60.70%) trimmed read pairs available after processing 7445756 (39.30%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 9 0.00% 20 14 0.00% 21 18 0.00% 22 22 0.00% 23 17 0.00% 24 13 0.00% 25 12 0.00% 26 12 0.00% 27 23 0.00% 28 18 0.00% 29 14 0.00% 30 18 0.00% 31 25 0.00% 32 25 0.00% 33 19 0.00% 34 24 0.00% 35 28 0.00% 36 45 0.00% 37 48 0.00% 38 41 0.00% 39 54 0.00% 40 51 0.00% 41 70 0.00% 42 61 0.00% 43 82 0.00% 44 95 0.00% 45 116 0.00% 46 108 0.00% 47 124 0.00% 48 158 0.00% 49 180 0.00% 50 181 0.00% 51 190 0.00% 52 239 0.00% 53 258 0.00% 54 317 0.00% 55 338 0.00% 56 381 0.00% 57 414 0.00% 58 475 0.00% 59 576 0.00% 60 640 0.00% 61 680 0.00% 62 816 0.00% 63 936 0.00% 64 985 0.01% 65 1160 0.01% 66 1344 0.01% 67 1473 0.01% 68 1746 0.01% 69 2113 0.01% 70 2363 0.01% 71 2564 0.01% 72 2984 0.02% 73 3255 0.02% 74 3595 0.02% 75 3951 0.02% 76 4400 0.02% 77 4750 0.03% 78 5415 0.03% 79 5973 0.03% 80 6856 0.04% 81 7976 0.04% 82 8746 0.05% 83 9867 0.05% 84 11246 0.06% 85 12542 0.07% 86 13232 0.07% 87 14471 0.08% 88 14969 0.08% 89 16308 0.09% 90 18700 0.10% 91 18464 0.10% 92 20050 0.11% 93 21420 0.11% 94 22638 0.12% 95 23087 0.12% 96 24029 0.13% 97 24816 0.13% 98 25832 0.14% 99 27548 0.15% 100 28541 0.15% 101 31126 0.16% 102 33276 0.18% 103 34295 0.18% 104 35882 0.19% 105 37876 0.20% 106 38069 0.20% 107 38802 0.20% 108 40061 0.21% 109 40807 0.22% 110 42350 0.22% 111 45235 0.24% 112 47013 0.25% 113 49336 0.26% 114 51890 0.27% 115 53130 0.28% 116 54078 0.29% 117 54879 0.29% 118 55581 0.29% 119 56638 0.30% 120 58270 0.31% 121 60513 0.32% 122 63479 0.34% 123 65806 0.35% 124 69366 0.37% 125 71573 0.38% 126 73398 0.39% 127 74458 0.39% 128 76183 0.40% 129 77814 0.41% 130 78973 0.42% 131 82608 0.44% 132 87998 0.46% 133 90557 0.48% 134 95540 0.50% 135 102255 0.54% 136 106663 0.56% 137 111841 0.59% 138 117244 0.62% 139 122510 0.65% 140 129544 0.68% 141 141270 0.75% 142 155364 0.82% 143 170849 0.90% 144 197292 1.04% 145 233166 1.23% 146 289791 1.53% 147 391070 2.06% 148 587387 3.10% 149 1151063 6.08% 150 5097970 26.91% 151 7445756 39.30% 18945295 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=13.33 fanout-score-rank=18 prefix-density=0.27 prefix-fanout=7.2 sequence=CTTGATGACACCA criterion=fanout-score sequence-density=0.06 sequence-density-rank=23 fanout-score=643.87 fanout-score-rank=1 prefix-density=1.02 prefix-fanout=36.5 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=33 prefix-density=0.37 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=580.37 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=20.3 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR5579232 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 23:00:22 Started mapping on | Dec 09 23:00:22 Finished on | Dec 09 23:14:40 Mapping speed, Million of reads per hour | 79.49 Number of input reads | 18945295 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 14311896 Uniquely mapped reads % | 75.54% Average mapped length | 289.88 Number of splices: Total | 15249409 Number of splices: Annotated (sjdb) | 14428671 Number of splices: GT/AG | 15049304 Number of splices: GC/AG | 178098 Number of splices: AT/AC | 11707 Number of splices: Non-canonical | 10300 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.01% Deletion average length | 1.32 Insertion rate per base | 0.00% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 181607 % of reads mapped to multiple loci | 0.96% Number of reads mapped to too many loci | 7044 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 23.19% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4469555 4469555 4469555 N_multimapping 181607 181607 181607 N_noFeature 403368 13909030 557332 N_ambiguous 280210 1873 32189 UnstrandedReadsAssigned:13628318 PositiveStrandReadsAssigned:400993 NegativeStrandReadsAssigned:13722375 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR5579232 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579232-trimmed-pair1.fastq SRR5579232-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,945,295 reads, 13,953,179 reads pseudoaligned [quant] estimated average fragment length: 254.189 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,048 rounds 52973 SRR5579232.ke.tsv 35125 SRR5579232.se.tsv 88098 total ==> SRR5579232.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 683.627 0 0 PNS24247 1044 790.811 65.5155 8.61796 PNS24249 1928 1674.81 113.697 7.06179 PNS24246 1044 790.811 65.5155 8.61796 PNS24248 1044 790.811 65.5155 8.61796 PNS24244 1471 1217.81 124.757 10.6566 PNS24243 293 104.045 0 0 KQK14069 1603 1349.81 3655.24 281.693 KQK14071 474 244.634 61.558 26.1759 ==> SRR5579232.se.tsv <== BRADI_1g14170v3 4062 BRADI_1g53295v3 44 BRADI_1g59795v3 323 BRADI_1g07683v3 0 BRADI_1g00485v3 45 BRADI_1g20270v3 913 BRADI_1g74790v3 18 BRADI_1g09890v3 1 BRADI_1g77505v3 150 BRADI_1g48960v3 0 SRR5579232 completed mapping pipeline successfully