Starting /dee2/code/volunteer_pipeline.sh SRR5579233 current disk space = 1523143442432 free memory = 1601597412 SRR5579233 SRAfilesize 755c157be6154062f9d6eb68d1afc3d7 SRR5579233.sra SRR5579233.sra file validated SRR5579233 is paired end SRR5579233 is conventional basespace SRR5579233 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579233_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.36 34.0 33.0 34.0 2.0 34.0 2 32.44525 34.0 33.0 34.0 28.0 34.0 3 32.7145 34.0 33.0 34.0 28.0 34.0 4 33.11275 34.0 33.0 34.0 32.0 34.0 5 33.1925 34.0 33.0 34.0 32.0 34.0 6 36.845 38.0 37.0 38.0 35.0 38.0 7 37.2115 38.0 38.0 38.0 36.0 38.0 8 37.40325 38.0 38.0 38.0 37.0 38.0 9 37.405 38.0 38.0 38.0 37.0 38.0 10-14 37.4133 38.0 38.0 38.0 37.0 38.0 15-19 37.3443 38.0 38.0 38.0 37.0 38.0 20-24 37.33445 38.0 38.0 38.0 37.0 38.0 25-29 37.3231 38.0 38.0 38.0 37.0 38.0 30-34 37.307100000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.2187 38.0 38.0 38.0 36.6 38.0 40-44 37.03655 38.0 38.0 38.0 36.0 38.0 45-49 36.94565 38.0 38.0 38.0 35.4 38.0 50-54 36.89805 38.0 38.0 38.0 35.2 38.0 55-59 36.767250000000004 38.0 38.0 38.0 34.8 38.0 60-64 36.77235 38.0 38.0 38.0 35.0 38.0 65-69 36.737849999999995 38.0 38.0 38.0 34.4 38.0 70-74 36.60545 38.0 38.0 38.0 34.0 38.0 75-79 36.56925 38.0 38.0 38.0 34.0 38.0 80-84 36.5202 38.0 38.0 38.0 34.0 38.0 85-89 36.327799999999996 38.0 37.8 38.0 33.6 38.0 90-94 36.26825 38.0 37.2 38.0 33.4 38.0 95-99 36.0743 38.0 37.0 38.0 33.0 38.0 100-104 35.92925 38.0 36.8 38.0 32.4 38.0 105-109 35.789300000000004 38.0 36.6 38.0 31.2 38.0 110-114 35.6537 38.0 36.0 38.0 31.0 38.0 115-119 35.370250000000006 38.0 36.0 38.0 29.4 38.0 120-124 35.2035 38.0 35.8 38.0 28.8 38.0 125-129 34.99235 38.0 35.2 38.0 27.8 38.0 130-134 34.820949999999996 38.0 35.0 38.0 27.6 38.0 135-139 34.41895 38.0 35.0 38.0 25.4 38.0 140-144 33.92715 38.0 34.6 38.0 22.8 38.0 145-149 33.17225 38.0 34.0 38.0 17.0 38.0 150-151 28.991 36.0 24.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 2.0 13 4.0 14 0.0 15 1.0 16 3.0 17 3.0 18 3.0 19 3.0 20 6.0 21 8.0 22 3.0 23 8.0 24 17.0 25 15.0 26 14.0 27 34.0 28 37.0 29 45.0 30 51.0 31 69.0 32 96.0 33 139.0 34 182.0 35 338.0 36 770.0 37 2148.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.67996580222285 13.194642348247365 7.893986890852095 32.231404958677686 2 24.85 17.45 34.625 23.075000000000003 3 20.875 25.75 24.95 28.425 4 28.075 29.7 19.650000000000002 22.575 5 24.825 33.074999999999996 20.474999999999998 21.625 6 22.5 32.95 21.4 23.150000000000002 7 17.45 19.45 41.075 22.025 8 21.7 20.674999999999997 25.95 31.674999999999997 9 22.225 18.8 29.975 28.999999999999996 10-14 23.674999999999997 25.755 24.565 26.005 15-19 24.66 25.045 24.445 25.85 20-24 23.465 25.035 25.205 26.295 25-29 23.97 24.85 25.415 25.765 30-34 24.0 24.14 25.374999999999996 26.484999999999996 35-39 24.279999999999998 24.65 25.064999999999998 26.005 40-44 24.32 24.51 25.34 25.83 45-49 23.735 24.915000000000003 24.8 26.55 50-54 24.38 24.34 24.884999999999998 26.395000000000003 55-59 24.635 23.995 24.79 26.58 60-64 24.279999999999998 24.64 24.625 26.455000000000002 65-69 24.38 24.279999999999998 24.785 26.555 70-74 24.72 24.52 24.555 26.205000000000002 75-79 24.825 24.51 24.349999999999998 26.314999999999998 80-84 24.08 24.785 24.935 26.200000000000003 85-89 24.884999999999998 24.529999999999998 24.69 25.895000000000003 90-94 25.06 24.474999999999998 24.46 26.005 95-99 24.52 24.0 24.675 26.805 100-104 25.740000000000002 23.945 24.275 26.040000000000003 105-109 24.515 24.15 25.245 26.090000000000003 110-114 24.709999999999997 24.7 24.18 26.41 115-119 25.155 24.490000000000002 24.275 26.08 120-124 25.305 24.315 24.36 26.02 125-129 24.884999999999998 24.605 23.830000000000002 26.68 130-134 24.735 25.045 23.68 26.540000000000003 135-139 24.315 24.709999999999997 24.125 26.85 140-144 25.014999999999997 24.990000000000002 23.880000000000003 26.115 145-149 24.654999999999998 25.069999999999997 23.785 26.490000000000002 150-151 25.2 24.1875 23.799999999999997 26.8125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 1.0 27 2.0 28 3.0 29 2.5 30 4.5 31 7.0 32 12.5 33 17.0 34 24.5 35 39.0 36 51.0 37 66.0 38 70.0 39 86.0 40 116.0 41 141.5 42 170.0 43 162.5 44 163.5 45 183.0 46 189.0 47 179.0 48 167.0 49 161.0 50 137.0 51 126.5 52 124.5 53 117.5 54 110.5 55 108.5 56 114.5 57 108.5 58 84.0 59 79.5 60 80.0 61 77.0 62 84.5 63 80.5 64 70.5 65 69.0 66 64.5 67 56.5 68 51.5 69 57.5 70 51.5 71 32.5 72 24.0 73 21.5 74 19.5 75 12.0 76 7.0 77 5.5 78 3.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 12.275 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01490275322051 98.0 2 0.9345794392523363 1.8499999999999999 3 0.050517807527153326 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.38749999999999996 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.5625 0.0 0.0 0.0 0.0 88-89 0.7375 0.0 0.0 0.0 0.0 90-91 0.95 0.0 0.0 0.0 0.0 92-93 1.1125 0.0 0.0 0.0 0.0 94-95 1.225 0.0 0.0 0.0 0.0 96-97 1.4125 0.0 0.0 0.0 0.0 98-99 1.6625 0.0 0.0 0.0 0.0 100-101 1.9875 0.0 0.0 0.0 0.0 102-103 2.3125 0.0 0.0 0.0 0.0 104-105 2.6625 0.0 0.0 0.0 0.0 106-107 2.95 0.0 0.0 0.0 0.0 108-109 3.1125 0.0 0.0 0.0 0.0 110-111 3.3125 0.0 0.0 0.0 0.0 112-113 3.7 0.0 0.0 0.0 0.0 114-115 3.95 0.0 0.0 0.0 0.0 116-117 4.35 0.0 0.0 0.0 0.0 118-119 4.9 0.0 0.0 0.0 0.0 120-121 5.525 0.0 0.0 0.0 0.0 122-123 6.0 0.0 0.0 0.0 0.0 124-125 6.637499999999999 0.0 0.0 0.0 0.0 126-127 7.15 0.0 0.0 0.0 0.0 128-129 7.6375 0.0 0.0 0.0 0.0 130-131 8.1375 0.0 0.0 0.0 0.0 132-133 8.6375 0.0 0.0 0.0 0.0 134-135 9.162500000000001 0.0 0.0 0.0 0.0 136-137 9.912500000000001 0.0 0.0 0.0 0.0 138-139 10.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5579233 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579233_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.50975 33.0 33.0 34.0 32.0 34.0 2 32.6635 33.0 33.0 34.0 32.0 34.0 3 32.7355 34.0 33.0 34.0 32.0 34.0 4 32.61575 34.0 33.0 34.0 32.0 34.0 5 32.66525 34.0 33.0 34.0 32.0 34.0 6 36.73975 38.0 38.0 38.0 35.0 38.0 7 36.7745 38.0 38.0 38.0 36.0 38.0 8 36.83925 38.0 38.0 38.0 36.0 38.0 9 36.77775 38.0 38.0 38.0 36.0 38.0 10-14 36.7352 38.0 38.0 38.0 35.8 38.0 15-19 36.66775 38.0 38.0 38.0 35.2 38.0 20-24 36.618849999999995 38.0 38.0 38.0 35.2 38.0 25-29 36.5945 38.0 38.0 38.0 35.2 38.0 30-34 36.624849999999995 38.0 38.0 38.0 35.4 38.0 35-39 36.51545 38.0 38.0 38.0 35.0 38.0 40-44 36.5519 38.0 38.0 38.0 35.0 38.0 45-49 36.4643 38.0 38.0 38.0 35.0 38.0 50-54 36.4154 38.0 38.0 38.0 34.8 38.0 55-59 36.3903 38.0 38.0 38.0 34.4 38.0 60-64 36.2673 38.0 38.0 38.0 34.0 38.0 65-69 36.1722 38.0 38.0 38.0 34.0 38.0 70-74 36.07915 38.0 38.0 38.0 33.8 38.0 75-79 36.063550000000006 38.0 38.0 38.0 33.4 38.0 80-84 36.030100000000004 38.0 38.0 38.0 33.4 38.0 85-89 35.829449999999994 38.0 38.0 38.0 32.6 38.0 90-94 35.761 38.0 38.0 38.0 32.2 38.0 95-99 35.6794 38.0 38.0 38.0 32.4 38.0 100-104 35.46405 38.0 37.2 38.0 31.0 38.0 105-109 35.2728 38.0 37.0 38.0 30.2 38.0 110-114 35.0814 38.0 36.4 38.0 29.0 38.0 115-119 34.885949999999994 38.0 36.0 38.0 27.6 38.0 120-124 34.532050000000005 38.0 35.8 38.0 25.4 38.0 125-129 34.135450000000006 38.0 35.2 38.0 22.8 38.0 130-134 33.611200000000004 38.0 33.8 38.0 21.0 38.0 135-139 33.0726 38.0 33.0 38.0 14.2 38.0 140-144 32.5746 38.0 33.0 38.0 12.8 38.0 145-149 31.45995 38.0 32.6 38.0 3.8 38.0 150-151 25.926000000000002 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 10.0 4 5.0 5 1.0 6 6.0 7 2.0 8 1.0 9 2.0 10 1.0 11 4.0 12 5.0 13 7.0 14 4.0 15 9.0 16 7.0 17 9.0 18 5.0 19 4.0 20 8.0 21 17.0 22 13.0 23 16.0 24 23.0 25 34.0 26 33.0 27 33.0 28 40.0 29 40.0 30 40.0 31 74.0 32 102.0 33 116.0 34 165.0 35 306.0 36 565.0 37 2275.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.75 15.174999999999999 9.825000000000001 28.249999999999996 2 27.625 20.9 28.025 23.45 3 24.2 22.975 26.275 26.55 4 28.875 30.8 17.325 23.0 5 27.625 33.900000000000006 17.95 20.525 6 22.625 33.75 19.2 24.425 7 21.099999999999998 15.475 37.525 25.900000000000002 8 22.400000000000002 20.525 23.925 33.15 9 24.425 20.4 24.95 30.225 10-14 25.509999999999998 24.77 23.14 26.58 15-19 25.974999999999998 24.34 23.025000000000002 26.66 20-24 25.924999999999997 24.23 23.830000000000002 26.015 25-29 25.814999999999998 24.5 23.655 26.029999999999998 30-34 25.935000000000002 24.67 23.945 25.45 35-39 26.515 24.2 23.595 25.69 40-44 26.674999999999997 24.05 23.485 25.790000000000003 45-49 26.63 24.165 23.51 25.695 50-54 26.150000000000002 24.8 23.525 25.525 55-59 25.8 24.85 23.575 25.775 60-64 26.52 23.865 24.065 25.55 65-69 26.529999999999998 24.12 23.57 25.779999999999998 70-74 26.424999999999997 24.099999999999998 23.995 25.480000000000004 75-79 26.63 24.21 23.565 25.595000000000002 80-84 26.584999999999997 24.615000000000002 24.025 24.775 85-89 26.584999999999997 24.265 23.735 25.415 90-94 26.845000000000002 24.845 23.255 25.055 95-99 26.3 24.654999999999998 24.005000000000003 25.040000000000003 100-104 27.08 24.88 22.985 25.055 105-109 26.61 24.335 23.785 25.27 110-114 27.145000000000003 25.624999999999996 22.634999999999998 24.595 115-119 27.715 25.419999999999998 22.965 23.9 120-124 27.345000000000002 25.040000000000003 23.52 24.095 125-129 27.105 25.11 23.655 24.13 130-134 27.779999999999998 24.735 23.23 24.255 135-139 27.83 24.695 23.880000000000003 23.595 140-144 27.975 25.405 23.43 23.189999999999998 145-149 28.18 25.4 23.465 22.955000000000002 150-151 28.9875 26.0125 22.2 22.8 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.5 28 3.5 29 5.5 30 9.0 31 9.5 32 8.5 33 9.0 34 17.0 35 27.5 36 34.5 37 47.0 38 60.0 39 75.0 40 98.5 41 127.0 42 147.0 43 148.5 44 154.5 45 159.5 46 157.5 47 157.5 48 153.0 49 137.5 50 124.5 51 128.5 52 120.0 53 121.5 54 126.0 55 105.5 56 107.5 57 109.0 58 103.5 59 109.5 60 100.0 61 95.0 62 111.0 63 111.0 64 86.0 65 77.5 66 75.5 67 68.0 68 68.0 69 71.5 70 62.0 71 53.0 72 43.0 73 26.5 74 18.0 75 10.5 76 7.0 77 5.0 78 1.5 79 1.0 80 2.5 81 1.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.675 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96123638206232 97.65 2 0.8360780339498353 1.6500000000000001 3 0.177349885989359 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.02533569799847986 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAATGGCG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.38749999999999996 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.5625 0.0 0.0 0.0 0.0 88-89 0.7250000000000001 0.0 0.0 0.0 0.0 90-91 0.9874999999999999 0.0 0.0 0.0 0.0 92-93 1.1625 0.0 0.0 0.0 0.0 94-95 1.275 0.0 0.0 0.0 0.0 96-97 1.5125 0.0 0.0 0.0 0.0 98-99 1.7625000000000002 0.0 0.0 0.0 0.0 100-101 2.0875 0.0 0.0 0.0 0.0 102-103 2.4 0.0 0.0 0.0 0.0 104-105 2.7375 0.0 0.0 0.0 0.0 106-107 3.0250000000000004 0.0 0.0 0.0 0.0 108-109 3.1875 0.0 0.0 0.0 0.0 110-111 3.375 0.0 0.0 0.0 0.0 112-113 3.75 0.0 0.0 0.0 0.0 114-115 4.0125 0.0 0.0 0.0 0.0 116-117 4.425 0.0 0.0 0.0 0.0 118-119 4.975 0.0 0.0 0.0 0.0 120-121 5.5875 0.0 0.0 0.0 0.0 122-123 6.050000000000001 0.0 0.0 0.0 0.0 124-125 6.6 0.0 0.0 0.0 0.0 126-127 7.125 0.0 0.0 0.0 0.0 128-129 7.6375 0.0 0.0 0.0 0.0 130-131 8.1375 0.0 0.0 0.0 0.0 132-133 8.6 0.0 0.0 0.0 0.0 134-135 9.075 0.0 0.0 0.0 0.0 136-137 9.775 0.0 0.0 0.0 0.0 138-139 10.337499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1179462 spots for SRR5579233.sra Written 1179462 spots for SRR5579233.sra Read 1179462 spots for SRR5579233.sra Written 1179462 spots for SRR5579233.sra Read 1179462 spots for SRR5579233.sra Written 1179462 spots for SRR5579233.sra Read 1179462 spots for SRR5579233.sra Written 1179462 spots for SRR5579233.sra Read 1179462 spots for SRR5579233.sra Written 1179462 spots for SRR5579233.sra Read 1179462 spots for SRR5579233.sra Written 1179462 spots for SRR5579233.sra Read 1179462 spots for SRR5579233.sra Written 1179462 spots for SRR5579233.sra Read 1179462 spots for SRR5579233.sra Written 1179462 spots for SRR5579233.sra Read 1179462 spots for SRR5579233.sra Written 1179462 spots for SRR5579233.sra Read 1179462 spots for SRR5579233.sra Written 1179462 spots for SRR5579233.sra Read 1179462 spots for SRR5579233.sra Written 1179462 spots for SRR5579233.sra Read 1179462 spots for SRR5579233.sra Written 1179462 spots for SRR5579233.sra Read 1179462 spots for SRR5579233.sra Written 1179462 spots for SRR5579233.sra Read 1179462 spots for SRR5579233.sra Written 1179462 spots for SRR5579233.sra Read 1179462 spots for SRR5579233.sra Written 1179462 spots for SRR5579233.sra Read 1179462 spots for SRR5579233.sra Written 1179462 spots for SRR5579233.sra Read 1179462 spots for SRR5579233.sra Written 1179462 spots for SRR5579233.sra Read 1179477 spots for SRR5579233.sra Written 1179477 spots for SRR5579233.sra Read 1179462 spots for SRR5579233.sra Written 1179462 spots for SRR5579233.sra Read 1179462 spots for SRR5579233.sra Written 1179462 spots for SRR5579233.sra SRR ids: ['SRR5579233.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_grxvqusb SRR5579233.sra spots: 23589255 blocks: [[1, 1179462], [1179463, 2358924], [2358925, 3538386], [3538387, 4717848], [4717849, 5897310], [5897311, 7076772], [7076773, 8256234], [8256235, 9435696], [9435697, 10615158], [10615159, 11794620], [11794621, 12974082], [12974083, 14153544], [14153545, 15333006], [15333007, 16512468], [16512469, 17691930], [17691931, 18871392], [18871393, 20050854], [20050855, 21230316], [21230317, 22409778], [22409779, 23589255]] SRR5579233 file size 7971924 SRR5579233 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579233 SRR5579233_1.fastq SRR5579233_2.fastq Input file: SRR5579233_1.fastq Paired file: SRR5579233_2.fastq trimmed: SRR5579233-trimmed-pair1.fastq, SRR5579233-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 23:02:35 2024 >> started Mon Dec 9 23:03:06 2024 >> done (30.324s) 23589255 read pairs processed; of these: 53142 ( 0.23%) short read pairs filtered out after trimming by size control 56807 ( 0.24%) empty read pairs filtered out after trimming by size control 23479306 (99.53%) read pairs available; of these: 11722807 (49.93%) trimmed read pairs available after processing 11756499 (50.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 21 0.00% 19 19 0.00% 20 7 0.00% 21 13 0.00% 22 18 0.00% 23 13 0.00% 24 24 0.00% 25 19 0.00% 26 14 0.00% 27 16 0.00% 28 24 0.00% 29 20 0.00% 30 23 0.00% 31 29 0.00% 32 33 0.00% 33 24 0.00% 34 35 0.00% 35 35 0.00% 36 28 0.00% 37 42 0.00% 38 56 0.00% 39 65 0.00% 40 63 0.00% 41 60 0.00% 42 61 0.00% 43 55 0.00% 44 78 0.00% 45 106 0.00% 46 116 0.00% 47 132 0.00% 48 171 0.00% 49 175 0.00% 50 199 0.00% 51 197 0.00% 52 252 0.00% 53 271 0.00% 54 295 0.00% 55 332 0.00% 56 397 0.00% 57 463 0.00% 58 542 0.00% 59 571 0.00% 60 721 0.00% 61 851 0.00% 62 900 0.00% 63 1057 0.00% 64 1184 0.01% 65 1240 0.01% 66 1527 0.01% 67 1575 0.01% 68 1892 0.01% 69 2394 0.01% 70 2594 0.01% 71 2891 0.01% 72 3348 0.01% 73 3656 0.02% 74 4117 0.02% 75 4415 0.02% 76 4884 0.02% 77 5558 0.02% 78 6261 0.03% 79 7059 0.03% 80 7974 0.03% 81 9099 0.04% 82 10249 0.04% 83 11576 0.05% 84 14635 0.06% 85 16583 0.07% 86 16921 0.07% 87 17903 0.08% 88 18511 0.08% 89 19980 0.09% 90 21652 0.09% 91 23218 0.10% 92 25076 0.11% 93 27042 0.12% 94 28540 0.12% 95 29993 0.13% 96 31134 0.13% 97 32292 0.14% 98 32951 0.14% 99 35159 0.15% 100 37021 0.16% 101 39399 0.17% 102 41941 0.18% 103 43867 0.19% 104 46427 0.20% 105 47920 0.20% 106 49558 0.21% 107 49925 0.21% 108 51851 0.22% 109 53278 0.23% 110 54969 0.23% 111 57518 0.24% 112 60273 0.26% 113 62988 0.27% 114 65988 0.28% 115 68788 0.29% 116 69423 0.30% 117 70819 0.30% 118 70513 0.30% 119 73206 0.31% 120 75166 0.32% 121 77219 0.33% 122 80696 0.34% 123 84590 0.36% 124 87880 0.37% 125 89667 0.38% 126 92780 0.40% 127 92999 0.40% 128 94128 0.40% 129 97702 0.42% 130 98040 0.42% 131 101441 0.43% 132 105869 0.45% 133 109487 0.47% 134 114784 0.49% 135 120041 0.51% 136 123164 0.52% 137 126374 0.54% 138 131927 0.56% 139 136598 0.58% 140 142214 0.61% 141 151810 0.65% 142 164399 0.70% 143 178424 0.76% 144 201548 0.86% 145 228648 0.97% 146 272174 1.16% 147 349482 1.49% 148 509678 2.17% 149 956722 4.07% 150 4917758 20.95% 151 11756499 50.07% 23479306 reads passed initial QC criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=14 prefix-density=0.96 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.19 sequence-density-rank=27 fanout-score=28.38 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=10.1 sequence=CCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCTTGCCGCCGCTGCAGACGACGGCGAAGTTGGAGCCCCGCCGCGACAGCGACGGCAGGCTCGTCGGCGCCACCAGAGGCGACGTGATCATGGACGCTGCCATCTCGATCTCTCTCTC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=4.07 fanout-score-rank=16 prefix-density=0.74 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=90.48 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=7.6 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR5579233 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 23:03:59 Started mapping on | Dec 09 23:03:59 Finished on | Dec 09 23:07:54 Mapping speed, Million of reads per hour | 359.68 Number of input reads | 23479306 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 21695045 Uniquely mapped reads % | 92.40% Average mapped length | 290.06 Number of splices: Total | 22187687 Number of splices: Annotated (sjdb) | 20961939 Number of splices: GT/AG | 21897969 Number of splices: GC/AG | 264010 Number of splices: AT/AC | 10753 Number of splices: Non-canonical | 14955 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 352409 % of reads mapped to multiple loci | 1.50% Number of reads mapped to too many loci | 74933 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.99% % of reads unmapped: other | 1.79% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1462518 1462518 1462518 N_multimapping 352409 352409 352409 N_noFeature 794828 21069293 990040 N_ambiguous 507258 2802 77737 UnstrandedReadsAssigned:20392959 PositiveStrandReadsAssigned:622950 NegativeStrandReadsAssigned:20627268 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR5579233 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579233-trimmed-pair1.fastq SRR5579233-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,479,306 reads, 20,757,977 reads pseudoaligned [quant] estimated average fragment length: 247.292 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,204 rounds 52973 SRR5579233.ke.tsv 35125 SRR5579233.se.tsv 88098 total ==> SRR5579233.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 690.402 0 0 PNS24247 1044 797.708 56.1727 4.64579 PNS24249 1928 1681.71 89.7204 3.51981 PNS24246 1044 797.708 56.1727 4.64579 PNS24248 1044 797.708 56.1727 4.64579 PNS24244 1471 1224.71 85.7616 4.61997 PNS24243 293 105.268 0 0 KQK14069 1603 1356.71 898.47 43.6914 KQK14071 474 248.3 31.5248 8.37634 ==> SRR5579233.se.tsv <== BRADI_1g14170v3 1047 BRADI_1g53295v3 88 BRADI_1g59795v3 641 BRADI_1g07683v3 0 BRADI_1g00485v3 26 BRADI_1g20270v3 2499 BRADI_1g74790v3 51 BRADI_1g09890v3 3 BRADI_1g77505v3 305 BRADI_1g48960v3 0 SRR5579233 completed mapping pipeline successfully