Starting /dee2/code/volunteer_pipeline.sh SRR5579234 current disk space = 1523142529024 free memory = 1570212372 SRR5579234 SRAfilesize a3e10a1f5f822f727198c7a4f64ca3af SRR5579234.sra SRR5579234.sra file validated SRR5579234 is paired end SRR5579234 is conventional basespace SRR5579234 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579234_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.57875 34.0 33.0 34.0 2.0 34.0 2 32.27075 34.0 32.0 34.0 28.0 34.0 3 32.62825 34.0 33.0 34.0 28.0 34.0 4 33.0475 34.0 33.0 34.0 32.0 34.0 5 33.06 34.0 33.0 34.0 32.0 34.0 6 36.80025 38.0 37.0 38.0 35.0 38.0 7 37.101 38.0 38.0 38.0 36.0 38.0 8 37.32175 38.0 38.0 38.0 37.0 38.0 9 37.3545 38.0 38.0 38.0 37.0 38.0 10-14 37.31250000000001 38.0 38.0 38.0 36.8 38.0 15-19 37.27745 38.0 38.0 38.0 37.0 38.0 20-24 37.28465 38.0 38.0 38.0 37.0 38.0 25-29 37.261900000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.24589999999999 38.0 38.0 38.0 37.0 38.0 35-39 37.1253 38.0 38.0 38.0 36.4 38.0 40-44 36.912600000000005 38.0 38.0 38.0 35.6 38.0 45-49 36.8072 38.0 38.0 38.0 35.0 38.0 50-54 36.82040000000001 38.0 38.0 38.0 35.0 38.0 55-59 36.7002 38.0 38.0 38.0 34.4 38.0 60-64 36.68925 38.0 38.0 38.0 34.4 38.0 65-69 36.586400000000005 38.0 38.0 38.0 34.2 38.0 70-74 36.5379 38.0 38.0 38.0 34.0 38.0 75-79 36.4856 38.0 38.0 38.0 34.0 38.0 80-84 36.35525 38.0 38.0 38.0 34.0 38.0 85-89 36.2574 38.0 38.0 38.0 33.8 38.0 90-94 36.016200000000005 38.0 37.0 38.0 33.0 38.0 95-99 35.926 38.0 37.0 38.0 32.2 38.0 100-104 35.8267 38.0 37.0 38.0 32.0 38.0 105-109 35.7008 38.0 36.6 38.0 31.4 38.0 110-114 35.4837 38.0 36.0 38.0 30.8 38.0 115-119 35.34635 38.0 36.2 38.0 29.6 38.0 120-124 35.12650000000001 38.0 35.8 38.0 28.6 38.0 125-129 34.9293 38.0 35.2 38.0 28.0 38.0 130-134 34.69575 38.0 35.0 38.0 27.2 38.0 135-139 34.3582 38.0 35.0 38.0 24.6 38.0 140-144 33.9024 38.0 34.6 38.0 22.6 38.0 145-149 33.05415 38.0 34.0 38.0 15.8 38.0 150-151 29.066499999999998 36.0 24.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 3.0 9 0.0 10 2.0 11 2.0 12 2.0 13 1.0 14 4.0 15 2.0 16 4.0 17 3.0 18 0.0 19 7.0 20 8.0 21 10.0 22 7.0 23 8.0 24 11.0 25 22.0 26 23.0 27 31.0 28 35.0 29 58.0 30 54.0 31 72.0 32 101.0 33 112.0 34 165.0 35 301.0 36 733.0 37 2217.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.75526932084309 13.466042154566745 8.694379391100702 32.08430913348946 2 23.599999999999998 18.9 34.599999999999994 22.900000000000002 3 20.875 24.375 24.925 29.825000000000003 4 28.15 32.225 19.5 20.125 5 25.75 33.15 20.7 20.4 6 19.125 34.375 23.025000000000002 23.474999999999998 7 17.275 18.6 42.275 21.85 8 19.950000000000003 19.825 27.85 32.375 9 20.474999999999998 19.875 29.975 29.675 10-14 23.315 26.195 24.04 26.450000000000003 15-19 23.775 24.865000000000002 25.235000000000003 26.125 20-24 23.435 25.83 25.324999999999996 25.41 25-29 24.165 25.345000000000002 24.92 25.569999999999997 30-34 23.845 25.19 24.815 26.150000000000002 35-39 23.705000000000002 25.130000000000003 25.374999999999996 25.790000000000003 40-44 24.15 24.825 25.185000000000002 25.840000000000003 45-49 23.235 25.264999999999997 25.240000000000002 26.26 50-54 23.54 25.5 25.124999999999996 25.835 55-59 24.09 25.014999999999997 24.92 25.974999999999998 60-64 24.14 25.374999999999996 24.605 25.88 65-69 23.64 25.119999999999997 24.88 26.36 70-74 23.995 25.119999999999997 25.074999999999996 25.81 75-79 24.77 24.8 24.240000000000002 26.19 80-84 24.365000000000002 24.715 24.985 25.935000000000002 85-89 24.104999999999997 25.47 24.02 26.405 90-94 23.96 25.474999999999998 24.055 26.51 95-99 24.66 24.995 24.7 25.645 100-104 24.285 25.095 24.69 25.929999999999996 105-109 24.635 24.985 24.775 25.605 110-114 24.47 25.09 24.525 25.915 115-119 24.785 25.430000000000003 23.84 25.945 120-124 24.884999999999998 25.174999999999997 23.849999999999998 26.090000000000003 125-129 24.64 25.419999999999998 23.82 26.119999999999997 130-134 24.905 25.495 23.655 25.945 135-139 24.104999999999997 25.540000000000003 24.18 26.174999999999997 140-144 23.955000000000002 25.46 24.224999999999998 26.36 145-149 24.265 25.82 23.990000000000002 25.924999999999997 150-151 24.15 25.5 24.099999999999998 26.25 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 1.0 24 1.5 25 1.5 26 1.5 27 1.0 28 3.0 29 5.5 30 6.0 31 7.5 32 11.0 33 19.0 34 26.5 35 32.0 36 44.0 37 65.0 38 94.5 39 113.5 40 115.5 41 148.5 42 180.5 43 179.5 44 188.5 45 189.5 46 185.5 47 188.0 48 170.0 49 159.0 50 155.5 51 150.0 52 133.5 53 108.5 54 93.5 55 84.5 56 94.5 57 91.0 58 81.0 59 88.0 60 80.5 61 74.5 62 71.5 63 60.5 64 54.0 65 57.0 66 62.0 67 58.0 68 54.5 69 47.5 70 39.5 71 31.0 72 24.5 73 20.0 74 13.5 75 10.5 76 8.5 77 5.0 78 4.0 79 2.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 14.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3195564516129 98.52499999999999 2 0.5796370967741935 1.15 3 0.07560483870967742 0.22499999999999998 4 0.025201612903225805 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.025 30-31 0.025 0.0 0.0 0.0 0.025 32-33 0.025 0.0 0.0 0.0 0.025 34-35 0.025 0.0 0.0 0.0 0.025 36-37 0.025 0.0 0.0 0.0 0.025 38-39 0.025 0.0 0.0 0.0 0.025 40-41 0.025 0.0 0.0 0.0 0.025 42-43 0.025 0.0 0.0 0.0 0.025 44-45 0.025 0.0 0.0 0.0 0.025 46-47 0.025 0.0 0.0 0.0 0.025 48-49 0.025 0.0 0.0 0.0 0.025 50-51 0.025 0.0 0.0 0.0 0.025 52-53 0.025 0.0 0.0 0.0 0.025 54-55 0.025 0.0 0.0 0.0 0.025 56-57 0.025 0.0 0.0 0.0 0.025 58-59 0.037500000000000006 0.0 0.0 0.0 0.025 60-61 0.05 0.0 0.0 0.0 0.025 62-63 0.05 0.0 0.0 0.0 0.025 64-65 0.075 0.0 0.0 0.0 0.025 66-67 0.1 0.0 0.0 0.0 0.025 68-69 0.125 0.0 0.0 0.0 0.025 70-71 0.1875 0.0 0.0 0.0 0.025 72-73 0.225 0.0 0.0 0.0 0.025 74-75 0.2875 0.0 0.0 0.0 0.025 76-77 0.375 0.0 0.0 0.0 0.025 78-79 0.5 0.0 0.0 0.0 0.025 80-81 0.525 0.0 0.0 0.0 0.025 82-83 0.5375000000000001 0.0 0.0 0.0 0.025 84-85 0.6125 0.0 0.0 0.0 0.025 86-87 0.7625 0.0 0.0 0.0 0.025 88-89 1.0375 0.0 0.0 0.0 0.025 90-91 1.3 0.0 0.0 0.0 0.025 92-93 1.55 0.0 0.0 0.0 0.025 94-95 1.8250000000000002 0.0 0.0 0.0 0.025 96-97 2.0875 0.0 0.0 0.0 0.025 98-99 2.4749999999999996 0.0 0.0 0.0 0.025 100-101 2.725 0.0 0.0 0.0 0.025 102-103 3.0875000000000004 0.0 0.0 0.0 0.025 104-105 3.55 0.0 0.0 0.0 0.025 106-107 4.0625 0.0 0.0 0.0 0.025 108-109 4.5875 0.0 0.0 0.0 0.025 110-111 5.137499999999999 0.0 0.0 0.0 0.025 112-113 5.7125 0.0 0.0 0.0 0.025 114-115 6.325 0.0 0.0 0.0 0.025 116-117 7.0625 0.0 0.0 0.0 0.025 118-119 7.6875 0.0 0.0 0.0 0.025 120-121 8.425 0.0 0.0 0.0 0.025 122-123 8.9875 0.0 0.0 0.0 0.025 124-125 9.6625 0.0 0.0 0.0 0.025 126-127 10.325 0.0 0.0 0.0 0.025 128-129 10.9875 0.0 0.0 0.0 0.025 130-131 11.55 0.0 0.0 0.0 0.025 132-133 12.1375 0.0 0.0 0.0 0.025 134-135 12.9375 0.0 0.0 0.0 0.025 136-137 13.6375 0.0 0.0 0.0 0.025 138-139 14.3875 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAACAG 10 0.0041860803 170.41177 1 TTGTCCT 10 0.0068519996 144.85 6 CGGAGTT 10 0.0068519996 144.85 2 CAATATA 10 0.0068519996 144.85 4 AATATAA 10 0.0068519996 144.85 5 >>END_MODULE SRR5579234 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579234_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.50975 33.0 33.0 34.0 32.0 34.0 2 32.60375 33.0 33.0 34.0 32.0 34.0 3 32.62875 34.0 33.0 34.0 32.0 34.0 4 32.5405 34.0 33.0 34.0 32.0 34.0 5 32.58375 34.0 33.0 34.0 32.0 34.0 6 36.605 38.0 38.0 38.0 35.0 38.0 7 36.5845 38.0 38.0 38.0 35.0 38.0 8 36.711 38.0 38.0 38.0 36.0 38.0 9 36.5915 38.0 38.0 38.0 35.0 38.0 10-14 36.5818 38.0 38.0 38.0 35.6 38.0 15-19 36.504149999999996 38.0 38.0 38.0 35.2 38.0 20-24 36.4447 38.0 38.0 38.0 35.0 38.0 25-29 36.38099999999999 38.0 38.0 38.0 35.0 38.0 30-34 36.3995 38.0 38.0 38.0 34.8 38.0 35-39 36.34135 38.0 38.0 38.0 34.6 38.0 40-44 36.3822 38.0 38.0 38.0 35.0 38.0 45-49 36.343849999999996 38.0 38.0 38.0 35.0 38.0 50-54 36.3107 38.0 38.0 38.0 34.8 38.0 55-59 36.1721 38.0 38.0 38.0 34.0 38.0 60-64 36.14745 38.0 38.0 38.0 34.2 38.0 65-69 36.00775 38.0 38.0 38.0 34.0 38.0 70-74 35.94865 38.0 38.0 38.0 33.2 38.0 75-79 35.88565 38.0 38.0 38.0 33.2 38.0 80-84 35.8501 38.0 38.0 38.0 33.0 38.0 85-89 35.731950000000005 38.0 38.0 38.0 32.8 38.0 90-94 35.62455 38.0 38.0 38.0 32.2 38.0 95-99 35.48975 38.0 38.0 38.0 31.4 38.0 100-104 35.32515 38.0 37.8 38.0 31.0 38.0 105-109 35.1571 38.0 37.0 38.0 29.4 38.0 110-114 34.97415 38.0 36.8 38.0 28.6 38.0 115-119 34.691950000000006 38.0 36.0 38.0 27.4 38.0 120-124 34.42015 38.0 36.0 38.0 25.0 38.0 125-129 34.061749999999996 38.0 35.4 38.0 22.8 38.0 130-134 33.4573 38.0 33.8 38.0 16.2 38.0 135-139 32.82365 38.0 33.0 38.0 13.0 38.0 140-144 32.07875 38.0 33.0 38.0 10.0 38.0 145-149 31.00355 38.0 32.6 38.0 2.0 38.0 150-151 25.25675 33.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 27.0 3 9.0 4 8.0 5 6.0 6 6.0 7 2.0 8 0.0 9 7.0 10 4.0 11 5.0 12 4.0 13 5.0 14 5.0 15 11.0 16 4.0 17 6.0 18 15.0 19 3.0 20 15.0 21 16.0 22 22.0 23 22.0 24 21.0 25 22.0 26 32.0 27 22.0 28 38.0 29 50.0 30 48.0 31 63.0 32 85.0 33 124.0 34 170.0 35 265.0 36 578.0 37 2280.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.800000000000004 13.950000000000001 11.200000000000001 28.050000000000004 2 26.125 22.175 28.825 22.875 3 24.05 24.375 25.025 26.55 4 28.65 31.924999999999997 17.275 22.15 5 26.424999999999997 33.550000000000004 18.95 21.075 6 21.7 33.925 20.4 23.974999999999998 7 21.975 14.875 37.85 25.3 8 22.275 18.85 24.55 34.325 9 25.124999999999996 20.349999999999998 25.775 28.749999999999996 10-14 25.619999999999997 24.54 23.630000000000003 26.21 15-19 26.02 24.19 24.099999999999998 25.69 20-24 26.085 24.709999999999997 23.799999999999997 25.405 25-29 26.555 24.335 23.68 25.430000000000003 30-34 25.665 24.635 24.0 25.7 35-39 26.685 24.705 23.150000000000002 25.46 40-44 26.740000000000002 24.315 23.405 25.540000000000003 45-49 26.484999999999996 24.205 23.880000000000003 25.430000000000003 50-54 26.424999999999997 24.635 23.64 25.3 55-59 26.640000000000004 24.36 24.09 24.91 60-64 26.605 24.69 23.630000000000003 25.074999999999996 65-69 25.95 24.69 24.125 25.235000000000003 70-74 26.229999999999997 24.315 24.265 25.19 75-79 26.484999999999996 24.45 24.104999999999997 24.959999999999997 80-84 26.6 24.54 23.66 25.2 85-89 26.229999999999997 25.145 24.325 24.3 90-94 25.814999999999998 25.34 24.36 24.485 95-99 27.0 24.725 23.84 24.435000000000002 100-104 27.465 24.845 23.775 23.915 105-109 26.775 24.959999999999997 23.87 24.395 110-114 27.465 25.41 23.405 23.72 115-119 27.72 25.415 23.29 23.575 120-124 27.405 25.124999999999996 23.849999999999998 23.62 125-129 27.575 25.595000000000002 23.745 23.085 130-134 27.79 25.095 23.880000000000003 23.235 135-139 28.255000000000003 26.1 23.74 21.905 140-144 28.244999999999997 25.900000000000002 23.615 22.24 145-149 28.605000000000004 25.88 23.465 22.05 150-151 28.299999999999997 27.187499999999996 23.0875 21.425 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 1.0 28 5.0 29 7.0 30 4.5 31 7.0 32 12.0 33 11.5 34 15.0 35 24.0 36 31.5 37 43.0 38 59.5 39 83.5 40 100.5 41 124.5 42 142.5 43 156.5 44 178.5 45 173.0 46 165.0 47 172.0 48 173.5 49 157.5 50 136.5 51 133.5 52 134.0 53 124.0 54 111.0 55 95.5 56 87.0 57 89.0 58 96.0 59 105.5 60 109.0 61 104.5 62 92.5 63 88.0 64 80.0 65 75.5 66 75.5 67 75.0 68 74.0 69 57.5 70 47.5 71 47.0 72 38.5 73 26.5 74 19.0 75 10.0 76 6.0 77 6.0 78 4.0 79 1.0 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16687705124968 98.2 2 0.7068921989396617 1.4000000000000001 3 0.10098459984852311 0.3 4 0.025246149962130777 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.2875 0.0 0.0 0.0 0.0 76-77 0.375 0.0 0.0 0.0 0.0 78-79 0.525 0.0 0.0 0.0 0.0 80-81 0.55 0.0 0.0 0.0 0.0 82-83 0.5874999999999999 0.0 0.0 0.0 0.0 84-85 0.6625000000000001 0.0 0.0 0.0 0.0 86-87 0.8 0.0 0.0 0.0 0.0 88-89 1.05 0.0 0.0 0.0 0.0 90-91 1.2625 0.0 0.0 0.0 0.0 92-93 1.4875 0.0 0.0 0.0 0.0 94-95 1.775 0.0 0.0 0.0 0.0 96-97 2.0375 0.0 0.0 0.0 0.0 98-99 2.45 0.0 0.0 0.0 0.0 100-101 2.725 0.0 0.0 0.0 0.0 102-103 3.0875 0.0 0.0 0.0 0.0 104-105 3.4875 0.0 0.0 0.0 0.0 106-107 4.0125 0.0 0.0 0.0 0.0 108-109 4.5375 0.0 0.0 0.0 0.0 110-111 5.0625 0.0 0.0 0.0 0.0 112-113 5.6375 0.0 0.0 0.0 0.0 114-115 6.25 0.0 0.0 0.0 0.0 116-117 6.9875 0.0 0.0 0.0 0.0 118-119 7.5875 0.0 0.0 0.0 0.0 120-121 8.2375 0.0 0.0 0.0 0.0 122-123 8.787500000000001 0.0 0.0 0.0 0.0 124-125 9.45 0.0 0.0 0.0 0.0 126-127 10.0875 0.0 0.0 0.0 0.0 128-129 10.7625 0.0 0.0 0.0 0.0 130-131 11.3125 0.0 0.0 0.0 0.0 132-133 11.8875 0.0 0.0 0.0 0.0 134-135 12.7125 0.0 0.0 0.0 0.0 136-137 13.425 0.0 0.0 0.0 0.0 138-139 14.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCCAAC 10 0.006830828 145.0 9 AAAAAAA 35 0.0035366106 20.714287 120-124 >>END_MODULE Read 1428729 spots for SRR5579234.sra Read 1428729 spots for SRR5579234.sra Written 1428729 spots for SRR5579234.sra Written 1428729 spots for SRR5579234.sra Read 1428729 spots for SRR5579234.sra Written 1428729 spots for SRR5579234.sra Read 1428729 spots for SRR5579234.sra Written 1428729 spots for SRR5579234.sra Read 1428729 spots for SRR5579234.sra Written 1428729 spots for SRR5579234.sra Read 1428729 spots for SRR5579234.sra Written 1428729 spots for SRR5579234.sra Read 1428729 spots for SRR5579234.sra Written 1428729 spots for SRR5579234.sra Read 1428729 spots for SRR5579234.sra Written 1428729 spots for SRR5579234.sra Read 1428729 spots for SRR5579234.sra Written 1428729 spots for SRR5579234.sra Read 1428729 spots for SRR5579234.sra Written 1428729 spots for SRR5579234.sra Read 1428729 spots for SRR5579234.sra Written 1428729 spots for SRR5579234.sra Read 1428729 spots for SRR5579234.sra Written 1428729 spots for SRR5579234.sra Read 1428729 spots for SRR5579234.sra Written 1428729 spots for SRR5579234.sra Read 1428729 spots for SRR5579234.sra Written 1428729 spots for SRR5579234.sra Read 1428729 spots for SRR5579234.sra Written 1428729 spots for SRR5579234.sra Read 1428729 spots for SRR5579234.sra Written 1428729 spots for SRR5579234.sra Read 1428729 spots for SRR5579234.sra Written 1428729 spots for SRR5579234.sra Read 1428729 spots for SRR5579234.sra Written 1428729 spots for SRR5579234.sra Read 1428748 spots for SRR5579234.sra Written 1428748 spots for SRR5579234.sra Read 1428729 spots for SRR5579234.sra Written 1428729 spots for SRR5579234.sra SRR ids: ['SRR5579234.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hy3g1m9_ SRR5579234.sra spots: 28574599 blocks: [[1, 1428729], [1428730, 2857458], [2857459, 4286187], [4286188, 5714916], [5714917, 7143645], [7143646, 8572374], [8572375, 10001103], [10001104, 11429832], [11429833, 12858561], [12858562, 14287290], [14287291, 15716019], [15716020, 17144748], [17144749, 18573477], [18573478, 20002206], [20002207, 21430935], [21430936, 22859664], [22859665, 24288393], [24288394, 25717122], [25717123, 27145851], [27145852, 28574599]] SRR5579234 file size 9661293 SRR5579234 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579234 SRR5579234_1.fastq SRR5579234_2.fastq Input file: SRR5579234_1.fastq Paired file: SRR5579234_2.fastq trimmed: SRR5579234-trimmed-pair1.fastq, SRR5579234-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 23:04:29 2024 >> started Mon Dec 9 23:05:02 2024 >> done (32.807s) 28574599 read pairs processed; of these: 71139 ( 0.25%) short read pairs filtered out after trimming by size control 64047 ( 0.22%) empty read pairs filtered out after trimming by size control 28439413 (99.53%) read pairs available; of these: 14866505 (52.27%) trimmed read pairs available after processing 13572908 (47.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 13 0.00% 20 9 0.00% 21 17 0.00% 22 23 0.00% 23 22 0.00% 24 24 0.00% 25 14 0.00% 26 29 0.00% 27 23 0.00% 28 29 0.00% 29 27 0.00% 30 35 0.00% 31 27 0.00% 32 41 0.00% 33 40 0.00% 34 44 0.00% 35 57 0.00% 36 56 0.00% 37 86 0.00% 38 82 0.00% 39 93 0.00% 40 136 0.00% 41 113 0.00% 42 126 0.00% 43 130 0.00% 44 151 0.00% 45 197 0.00% 46 213 0.00% 47 246 0.00% 48 310 0.00% 49 374 0.00% 50 429 0.00% 51 513 0.00% 52 485 0.00% 53 566 0.00% 54 597 0.00% 55 715 0.00% 56 822 0.00% 57 1003 0.00% 58 1111 0.00% 59 1280 0.00% 60 1466 0.01% 61 1616 0.01% 62 1858 0.01% 63 1987 0.01% 64 2304 0.01% 65 2556 0.01% 66 2943 0.01% 67 3238 0.01% 68 3911 0.01% 69 4728 0.02% 70 5708 0.02% 71 6097 0.02% 72 6688 0.02% 73 7417 0.03% 74 7980 0.03% 75 8735 0.03% 76 9762 0.03% 77 10858 0.04% 78 12217 0.04% 79 13620 0.05% 80 15217 0.05% 81 17120 0.06% 82 19011 0.07% 83 21192 0.07% 84 25324 0.09% 85 27920 0.10% 86 29177 0.10% 87 31072 0.11% 88 32560 0.11% 89 34758 0.12% 90 37207 0.13% 91 39576 0.14% 92 42196 0.15% 93 45618 0.16% 94 47686 0.17% 95 49073 0.17% 96 51704 0.18% 97 53438 0.19% 98 54991 0.19% 99 57753 0.20% 100 60528 0.21% 101 64336 0.23% 102 67615 0.24% 103 70392 0.25% 104 72324 0.25% 105 74750 0.26% 106 77129 0.27% 107 77531 0.27% 108 80281 0.28% 109 83240 0.29% 110 84799 0.30% 111 87711 0.31% 112 92004 0.32% 113 93375 0.33% 114 97046 0.34% 115 99565 0.35% 116 100880 0.35% 117 103322 0.36% 118 103309 0.36% 119 105575 0.37% 120 108684 0.38% 121 112232 0.39% 122 114454 0.40% 123 119721 0.42% 124 123377 0.43% 125 125622 0.44% 126 128696 0.45% 127 129283 0.45% 128 129996 0.46% 129 133199 0.47% 130 135265 0.48% 131 138273 0.49% 132 144151 0.51% 133 149013 0.52% 134 153215 0.54% 135 159090 0.56% 136 163594 0.58% 137 167485 0.59% 138 173299 0.61% 139 179849 0.63% 140 187530 0.66% 141 197985 0.70% 142 212911 0.75% 143 229299 0.81% 144 254198 0.89% 145 286795 1.01% 146 336539 1.18% 147 425611 1.50% 148 609805 2.14% 149 1119009 3.93% 150 5664011 19.92% 151 13572908 47.73% 28439413 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=25 prefix-density=0.60 prefix-fanout=1.9 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.17 sequence-density-rank=26 fanout-score=13.10 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=4.2 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=3.81 fanout-score-rank=13 prefix-density=0.70 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=133.14 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=9.0 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGC SRR5579234 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 23:05:50 Started mapping on | Dec 09 23:05:50 Finished on | Dec 09 23:08:44 Mapping speed, Million of reads per hour | 588.40 Number of input reads | 28439413 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 27361823 Uniquely mapped reads % | 96.21% Average mapped length | 287.39 Number of splices: Total | 28721815 Number of splices: Annotated (sjdb) | 27096905 Number of splices: GT/AG | 28355230 Number of splices: GC/AG | 333173 Number of splices: AT/AC | 13782 Number of splices: Non-canonical | 19630 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.30 Insertion rate per base | 0.00% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 300357 % of reads mapped to multiple loci | 1.06% Number of reads mapped to too many loci | 16772 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.37% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 820234 820234 820234 N_multimapping 300357 300357 300357 N_noFeature 834119 26540019 1139995 N_ambiguous 604500 3728 89070 UnstrandedReadsAssigned:25923204 PositiveStrandReadsAssigned:818076 NegativeStrandReadsAssigned:26132758 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=142 echo kmer=137 SRR5579234 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579234-trimmed-pair1.fastq SRR5579234-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,439,413 reads, 26,295,219 reads pseudoaligned [quant] estimated average fragment length: 238.425 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,207 rounds 52973 SRR5579234.ke.tsv 35125 SRR5579234.se.tsv 88098 total ==> SRR5579234.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 699.232 0 0 PNS24247 1044 806.575 90.0943 6.00753 PNS24249 1928 1690.57 93.0312 2.95963 PNS24246 1044 806.575 90.0943 6.00753 PNS24248 1044 806.575 90.0943 6.00753 PNS24244 1471 1233.57 129.686 5.6542 PNS24243 293 110.347 1 0.487396 KQK14069 1603 1365.57 9842.41 387.641 KQK14071 474 256.324 204.815 42.975 ==> SRR5579234.se.tsv <== BRADI_1g14170v3 10960 BRADI_1g53295v3 101 BRADI_1g59795v3 739 BRADI_1g07683v3 0 BRADI_1g00485v3 65 BRADI_1g20270v3 3413 BRADI_1g74790v3 157 BRADI_1g09890v3 2 BRADI_1g77505v3 324 BRADI_1g48960v3 0 SRR5579234 completed mapping pipeline successfully