Starting /dee2/code/volunteer_pipeline.sh SRR5579235 current disk space = 1523090137088 free memory = 1566968012 SRR5579235 SRAfilesize c48f8a1a8cb56a075792a10fd45051c1 SRR5579235.sra SRR5579235.sra file validated SRR5579235 is paired end SRR5579235 is conventional basespace SRR5579235 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579235_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.164 34.0 33.0 34.0 2.0 34.0 2 32.5055 34.0 33.0 34.0 28.0 34.0 3 32.7805 34.0 33.0 34.0 30.0 34.0 4 33.106 34.0 33.0 34.0 32.0 34.0 5 33.16725 34.0 33.0 34.0 32.0 34.0 6 37.00175 38.0 37.0 38.0 36.0 38.0 7 37.248 38.0 38.0 38.0 36.0 38.0 8 37.4225 38.0 38.0 38.0 37.0 38.0 9 37.4285 38.0 38.0 38.0 37.0 38.0 10-14 37.3737 38.0 38.0 38.0 37.0 38.0 15-19 37.417449999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.36525 38.0 38.0 38.0 37.0 38.0 25-29 37.372400000000006 38.0 38.0 38.0 37.0 38.0 30-34 37.307599999999994 38.0 38.0 38.0 37.0 38.0 35-39 37.234750000000005 38.0 38.0 38.0 36.8 38.0 40-44 37.03025 38.0 38.0 38.0 36.2 38.0 45-49 36.95605 38.0 38.0 38.0 35.8 38.0 50-54 36.97605 38.0 38.0 38.0 35.8 38.0 55-59 36.8035 38.0 38.0 38.0 35.0 38.0 60-64 36.8717 38.0 38.0 38.0 35.0 38.0 65-69 36.7774 38.0 38.0 38.0 34.8 38.0 70-74 36.6955 38.0 38.0 38.0 34.4 38.0 75-79 36.6529 38.0 38.0 38.0 34.8 38.0 80-84 36.62985 38.0 38.0 38.0 34.2 38.0 85-89 36.46475 38.0 38.0 38.0 34.0 38.0 90-94 36.303250000000006 38.0 38.0 38.0 33.8 38.0 95-99 36.2168 38.0 37.6 38.0 33.2 38.0 100-104 36.14835 38.0 37.6 38.0 33.2 38.0 105-109 35.9269 38.0 37.0 38.0 32.8 38.0 110-114 35.842 38.0 37.0 38.0 32.2 38.0 115-119 35.634499999999996 38.0 36.6 38.0 31.4 38.0 120-124 35.407349999999994 38.0 36.0 38.0 30.6 38.0 125-129 35.32505 38.0 36.0 38.0 30.6 38.0 130-134 35.086299999999994 38.0 35.8 38.0 29.0 38.0 135-139 34.76755 38.0 35.0 38.0 27.8 38.0 140-144 34.393899999999995 38.0 35.0 38.0 26.0 38.0 145-149 33.6299 38.0 34.8 38.0 20.8 38.0 150-151 30.0285 36.0 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 1.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 3.0 16 2.0 17 3.0 18 3.0 19 7.0 20 7.0 21 9.0 22 6.0 23 10.0 24 12.0 25 13.0 26 19.0 27 26.0 28 35.0 29 39.0 30 45.0 31 56.0 32 78.0 33 113.0 34 176.0 35 277.0 36 674.0 37 2381.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.01897096866916 15.607933314170738 8.39321644150618 29.979879275653925 2 24.05 18.425 34.9 22.625 3 20.275000000000002 27.150000000000002 24.15 28.425 4 24.775 31.874999999999996 21.8 21.55 5 24.875 33.0 22.475 19.650000000000002 6 21.3 33.225 23.724999999999998 21.75 7 17.4 20.0 41.9 20.7 8 19.875 18.875 28.825 32.425 9 20.724999999999998 20.4 28.575 30.3 10-14 22.355 26.625 25.15 25.869999999999997 15-19 22.689999999999998 26.19 25.495 25.624999999999996 20-24 22.59 25.115 26.195 26.1 25-29 22.915 25.490000000000002 25.895000000000003 25.7 30-34 23.36 25.814999999999998 25.525 25.3 35-39 23.23 25.15 26.06 25.56 40-44 22.97 25.869999999999997 25.645 25.515 45-49 22.82 25.650000000000002 25.795 25.735000000000003 50-54 23.305 25.314999999999998 25.935000000000002 25.445 55-59 23.51 25.235000000000003 25.295 25.96 60-64 23.064999999999998 25.7 25.5 25.735000000000003 65-69 23.419999999999998 26.025 25.255 25.3 70-74 23.285 25.405 25.39 25.919999999999998 75-79 23.98 25.105 25.505 25.41 80-84 23.355 25.014999999999997 25.480000000000004 26.150000000000002 85-89 24.115000000000002 25.085 25.319999999999997 25.480000000000004 90-94 23.93 26.325 23.91 25.835 95-99 23.745 25.36 25.230000000000004 25.665 100-104 24.395 25.264999999999997 25.009999999999998 25.330000000000002 105-109 23.724999999999998 25.814999999999998 25.395 25.064999999999998 110-114 24.425 25.275 24.505 25.795 115-119 23.724999999999998 26.035000000000004 24.34 25.900000000000002 120-124 24.035 25.505 24.44 26.02 125-129 23.635 25.740000000000002 24.81 25.814999999999998 130-134 24.135 25.665 24.44 25.759999999999998 135-139 24.349999999999998 26.035000000000004 24.145 25.47 140-144 24.345 25.755 24.175 25.724999999999998 145-149 23.84 25.94 24.33 25.89 150-151 23.2125 24.95 25.525 26.3125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 0.0 25 1.0 26 3.0 27 5.0 28 5.0 29 2.5 30 8.5 31 12.5 32 14.0 33 22.0 34 30.5 35 37.0 36 46.5 37 66.5 38 84.0 39 96.5 40 132.5 41 160.5 42 175.0 43 191.0 44 199.5 45 212.5 46 216.5 47 188.5 48 164.0 49 167.5 50 164.5 51 153.0 52 134.5 53 124.5 54 121.0 55 115.5 56 99.0 57 87.0 58 82.0 59 80.0 60 76.0 61 58.5 62 54.0 63 56.0 64 56.5 65 51.5 66 39.5 67 36.0 68 35.5 69 31.0 70 26.5 71 22.5 72 20.5 73 14.0 74 6.5 75 3.5 76 3.0 77 3.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 13.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69879518072288 99.3 2 0.25100401606425704 0.5 3 0.0 0.0 4 0.0502008032128514 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.025 10-11 0.0 0.0 0.0 0.0 0.025 12-13 0.0 0.0 0.0 0.0 0.025 14-15 0.0 0.0 0.0 0.0 0.025 16-17 0.0 0.0 0.0 0.0 0.025 18-19 0.0 0.0 0.0 0.0 0.025 20-21 0.0 0.0 0.0 0.0 0.025 22-23 0.0 0.0 0.0 0.0 0.025 24-25 0.0 0.0 0.0 0.0 0.025 26-27 0.0 0.0 0.0 0.0 0.025 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0125 0.0 0.0 0.0 0.025 62-63 0.025 0.0 0.0 0.0 0.025 64-65 0.025 0.0 0.0 0.0 0.025 66-67 0.05 0.0 0.0 0.0 0.025 68-69 0.05 0.0 0.0 0.0 0.025 70-71 0.0875 0.0 0.0 0.0 0.025 72-73 0.16249999999999998 0.0 0.0 0.0 0.025 74-75 0.175 0.0 0.0 0.0 0.025 76-77 0.1875 0.0 0.0 0.0 0.025 78-79 0.225 0.0 0.0 0.0 0.025 80-81 0.275 0.0 0.0 0.0 0.025 82-83 0.4 0.0 0.0 0.0 0.025 84-85 0.6000000000000001 0.0 0.0 0.0 0.025 86-87 0.775 0.0 0.0 0.0 0.025 88-89 0.875 0.0 0.0 0.0 0.025 90-91 0.9624999999999999 0.0 0.0 0.0 0.025 92-93 1.05 0.0 0.0 0.0 0.025 94-95 1.4125 0.0 0.0 0.0 0.025 96-97 1.675 0.0 0.0 0.0 0.025 98-99 1.875 0.0 0.0 0.0 0.025 100-101 2.25 0.0 0.0 0.0 0.025 102-103 2.4625000000000004 0.0 0.0 0.0 0.025 104-105 3.0 0.0 0.0 0.0 0.025 106-107 3.4124999999999996 0.0 0.0 0.0 0.025 108-109 3.8625 0.0 0.0 0.0 0.025 110-111 4.1875 0.0 0.0 0.0 0.025 112-113 4.7 0.0 0.0 0.0 0.025 114-115 5.125 0.0 0.0 0.0 0.025 116-117 5.4625 0.0 0.0 0.0 0.025 118-119 5.9375 0.0 0.0 0.0 0.025 120-121 6.425000000000001 0.0 0.0 0.0 0.025 122-123 6.9375 0.0 0.0 0.0 0.025 124-125 7.275 0.0 0.0 0.0 0.025 126-127 8.0625 0.0 0.0 0.0 0.025 128-129 8.6625 0.0 0.0 0.0 0.025 130-131 9.375 0.0 0.0 0.0 0.025 132-133 10.175 0.0 0.0 0.0 0.025 134-135 10.8875 0.0 0.0 0.0 0.025 136-137 11.7625 0.0 0.0 0.0 0.025 138-139 12.6125 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5579235 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579235_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.62825 33.0 33.0 34.0 32.0 34.0 2 32.671 33.0 33.0 34.0 32.0 34.0 3 32.64825 34.0 33.0 34.0 32.0 34.0 4 32.597 34.0 33.0 34.0 32.0 34.0 5 32.533 34.0 33.0 34.0 32.0 34.0 6 36.5915 38.0 38.0 38.0 35.0 38.0 7 36.71125 38.0 38.0 38.0 36.0 38.0 8 36.716 38.0 38.0 38.0 36.0 38.0 9 36.678 38.0 38.0 38.0 36.0 38.0 10-14 36.7006 38.0 38.0 38.0 35.8 38.0 15-19 36.62745 38.0 38.0 38.0 35.8 38.0 20-24 36.6122 38.0 38.0 38.0 35.8 38.0 25-29 36.531949999999995 38.0 38.0 38.0 35.4 38.0 30-34 36.563 38.0 38.0 38.0 35.8 38.0 35-39 36.4805 38.0 38.0 38.0 35.2 38.0 40-44 36.50964999999999 38.0 38.0 38.0 35.0 38.0 45-49 36.4533 38.0 38.0 38.0 35.0 38.0 50-54 36.3507 38.0 38.0 38.0 34.6 38.0 55-59 36.31115 38.0 38.0 38.0 34.6 38.0 60-64 36.30385 38.0 38.0 38.0 34.2 38.0 65-69 36.222950000000004 38.0 38.0 38.0 34.0 38.0 70-74 36.0921 38.0 38.0 38.0 33.8 38.0 75-79 36.0236 38.0 38.0 38.0 33.6 38.0 80-84 35.97055 38.0 38.0 38.0 33.6 38.0 85-89 35.8826 38.0 38.0 38.0 33.0 38.0 90-94 35.8044 38.0 38.0 38.0 33.0 38.0 95-99 35.60745 38.0 38.0 38.0 32.0 38.0 100-104 35.41674999999999 38.0 37.4 38.0 30.6 38.0 105-109 35.325450000000004 38.0 37.2 38.0 30.2 38.0 110-114 35.1715 38.0 36.8 38.0 29.6 38.0 115-119 34.96195 38.0 36.2 38.0 28.8 38.0 120-124 34.594100000000005 38.0 36.0 38.0 26.2 38.0 125-129 34.292500000000004 38.0 35.4 38.0 24.2 38.0 130-134 33.65585 38.0 34.0 38.0 21.0 38.0 135-139 33.07875 38.0 33.0 38.0 14.2 38.0 140-144 32.34675 38.0 33.0 38.0 12.4 38.0 145-149 31.4897 38.0 33.0 38.0 3.8 38.0 150-151 26.148875 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 10.0 4 5.0 5 8.0 6 7.0 7 3.0 8 1.0 9 4.0 10 3.0 11 7.0 12 3.0 13 4.0 14 8.0 15 6.0 16 8.0 17 8.0 18 6.0 19 12.0 20 4.0 21 11.0 22 16.0 23 17.0 24 16.0 25 23.0 26 24.0 27 35.0 28 38.0 29 51.0 30 45.0 31 72.0 32 87.0 33 116.0 34 164.0 35 287.0 36 521.0 37 2352.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.949999999999996 15.75 11.200000000000001 26.1 2 27.900000000000002 21.85 28.549999999999997 21.7 3 23.875 23.3 28.725 24.099999999999998 4 28.199999999999996 31.75 18.65 21.4 5 27.05 33.25 19.6 20.1 6 21.275 34.8 21.25 22.675 7 21.349999999999998 15.075 39.45 24.125 8 21.4 21.125 23.9 33.575 9 23.825 20.45 27.075 28.65 10-14 25.445 25.605 23.525 25.424999999999997 15-19 26.240000000000002 24.625 24.515 24.62 20-24 25.645 25.15 24.625 24.58 25-29 25.779999999999998 25.295 24.305 24.62 30-34 25.650000000000002 24.85 25.119999999999997 24.38 35-39 25.924999999999997 25.040000000000003 24.175 24.86 40-44 26.36 24.955 24.490000000000002 24.195 45-49 25.96 25.074999999999996 24.465 24.5 50-54 25.645 24.72 24.98 24.654999999999998 55-59 26.25 24.5 24.755 24.495 60-64 25.69 25.040000000000003 24.555 24.715 65-69 25.624999999999996 24.87 24.685000000000002 24.82 70-74 25.56 25.255 25.05 24.135 75-79 26.169999999999998 24.51 25.03 24.29 80-84 26.105 25.040000000000003 25.055 23.799999999999997 85-89 25.929999999999996 24.834999999999997 24.905 24.33 90-94 26.185000000000002 25.080000000000002 24.67 24.065 95-99 26.46 25.305 24.62 23.615 100-104 26.290000000000003 25.759999999999998 24.385 23.565 105-109 26.76 25.695 24.235 23.31 110-114 26.605 25.465 24.8 23.13 115-119 26.575 25.669999999999998 24.740000000000002 23.015 120-124 26.515 25.845000000000002 24.38 23.26 125-129 27.125 25.72 24.29 22.865 130-134 27.439999999999998 26.240000000000002 24.04 22.28 135-139 27.345000000000002 25.955000000000002 24.25 22.45 140-144 28.42 25.605 24.01 21.965 145-149 27.52 26.645000000000003 24.23 21.605 150-151 29.125 25.8125 23.849999999999998 21.212500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 0.5 25 1.0 26 1.5 27 2.5 28 2.0 29 3.0 30 5.5 31 6.5 32 11.0 33 15.5 34 20.0 35 27.5 36 36.5 37 50.0 38 65.5 39 91.5 40 117.0 41 124.5 42 146.0 43 168.5 44 184.0 45 195.0 46 202.5 47 205.5 48 169.5 49 151.5 50 158.5 51 150.5 52 134.5 53 120.5 54 110.0 55 101.5 56 98.0 57 101.0 58 97.5 59 86.5 60 98.5 61 96.0 62 82.0 63 80.0 64 75.0 65 69.0 66 61.5 67 53.0 68 41.0 69 37.5 70 36.0 71 26.5 72 21.5 73 19.0 74 14.5 75 10.0 76 5.0 77 3.5 78 2.0 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.42724302588590096 0.8500000000000001 3 0.050263885398341285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.30000000000000004 0.0 0.0 0.0 0.0 82-83 0.425 0.0 0.0 0.0 0.0 84-85 0.6375 0.0 0.0 0.0 0.0 86-87 0.8125 0.0 0.0 0.0 0.0 88-89 0.925 0.0 0.0 0.0 0.0 90-91 1.0125 0.0 0.0 0.0 0.0 92-93 1.1 0.0 0.0 0.0 0.0 94-95 1.4625 0.0 0.0 0.0 0.0 96-97 1.725 0.0 0.0 0.0 0.0 98-99 1.9625 0.0 0.0 0.0 0.0 100-101 2.3499999999999996 0.0 0.0 0.0 0.0 102-103 2.525 0.0 0.0 0.0 0.0 104-105 3.05 0.0 0.0 0.0 0.0 106-107 3.45 0.0 0.0 0.0 0.0 108-109 3.9000000000000004 0.0 0.0 0.0 0.0 110-111 4.275 0.0 0.0 0.0 0.0 112-113 4.8 0.0 0.0 0.0 0.0 114-115 5.1875 0.0 0.0 0.0 0.0 116-117 5.525 0.0 0.0 0.0 0.0 118-119 6.0125 0.0 0.0 0.0 0.0 120-121 6.525 0.0 0.0 0.0 0.0 122-123 7.0625 0.0 0.0 0.0 0.0 124-125 7.4 0.0 0.0 0.0 0.0 126-127 8.1625 0.0 0.0 0.0 0.0 128-129 8.774999999999999 0.0 0.0 0.0 0.0 130-131 9.4625 0.0 0.0 0.0 0.0 132-133 10.25 0.0 0.0 0.0 0.0 134-135 10.9875 0.0 0.0 0.0 0.0 136-137 11.875 0.0 0.0 0.0 0.0 138-139 12.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCACTG 10 0.006830828 145.0 5 CGGTGGT 10 0.006830828 145.0 145 >>END_MODULE Read 1211032 spots for SRR5579235.sra Written 1211032 spots for SRR5579235.sra Read 1211032 spots for SRR5579235.sra Written 1211032 spots for SRR5579235.sra Read 1211032 spots for SRR5579235.sra Written 1211032 spots for SRR5579235.sra Read 1211032 spots for SRR5579235.sra Written 1211032 spots for SRR5579235.sra Read 1211033 spots for SRR5579235.sra Written 1211033 spots for SRR5579235.sra Read 1211032 spots for SRR5579235.sra Written 1211032 spots for SRR5579235.sra Read 1211032 spots for SRR5579235.sra Written 1211032 spots for SRR5579235.sra Read 1211032 spots for SRR5579235.sra Written 1211032 spots for SRR5579235.sra Read 1211032 spots for SRR5579235.sra Written 1211032 spots for SRR5579235.sra Read 1211032 spots for SRR5579235.sra Written 1211032 spots for SRR5579235.sra Read 1211032 spots for SRR5579235.sra Written 1211032 spots for SRR5579235.sra Read 1211032 spots for SRR5579235.sra Written 1211032 spots for SRR5579235.sra Read 1211032 spots for SRR5579235.sra Written 1211032 spots for SRR5579235.sra Read 1211032 spots for SRR5579235.sra Written 1211032 spots for SRR5579235.sra Read 1211032 spots for SRR5579235.sra Written 1211032 spots for SRR5579235.sra Read 1211032 spots for SRR5579235.sra Written 1211032 spots for SRR5579235.sra Read 1211032 spots for SRR5579235.sra Written 1211032 spots for SRR5579235.sra Read 1211032 spots for SRR5579235.sra Written 1211032 spots for SRR5579235.sra Read 1211032 spots for SRR5579235.sra Written 1211032 spots for SRR5579235.sra Read 1211032 spots for SRR5579235.sra Written 1211032 spots for SRR5579235.sra SRR ids: ['SRR5579235.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4vt9a5x1 SRR5579235.sra spots: 24220641 blocks: [[1, 1211032], [1211033, 2422064], [2422065, 3633096], [3633097, 4844128], [4844129, 6055160], [6055161, 7266192], [7266193, 8477224], [8477225, 9688256], [9688257, 10899288], [10899289, 12110320], [12110321, 13321352], [13321353, 14532384], [14532385, 15743416], [15743417, 16954448], [16954449, 18165480], [18165481, 19376512], [19376513, 20587544], [20587545, 21798576], [21798577, 23009608], [23009609, 24220641]] SRR5579235 file size 8185880 SRR5579235 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579235 SRR5579235_1.fastq SRR5579235_2.fastq Input file: SRR5579235_1.fastq Paired file: SRR5579235_2.fastq trimmed: SRR5579235-trimmed-pair1.fastq, SRR5579235-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 23:03:39 2024 >> started Mon Dec 9 23:04:07 2024 >> done (28.554s) 24220641 read pairs processed; of these: 57875 ( 0.24%) short read pairs filtered out after trimming by size control 60873 ( 0.25%) empty read pairs filtered out after trimming by size control 24101893 (99.51%) read pairs available; of these: 11895200 (49.35%) trimmed read pairs available after processing 12206693 (50.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 11 0.00% 20 18 0.00% 21 16 0.00% 22 14 0.00% 23 17 0.00% 24 11 0.00% 25 22 0.00% 26 17 0.00% 27 19 0.00% 28 20 0.00% 29 25 0.00% 30 27 0.00% 31 26 0.00% 32 30 0.00% 33 27 0.00% 34 30 0.00% 35 40 0.00% 36 31 0.00% 37 47 0.00% 38 53 0.00% 39 56 0.00% 40 84 0.00% 41 73 0.00% 42 76 0.00% 43 105 0.00% 44 105 0.00% 45 111 0.00% 46 149 0.00% 47 154 0.00% 48 189 0.00% 49 247 0.00% 50 284 0.00% 51 297 0.00% 52 301 0.00% 53 374 0.00% 54 376 0.00% 55 431 0.00% 56 510 0.00% 57 611 0.00% 58 693 0.00% 59 779 0.00% 60 992 0.00% 61 1059 0.00% 62 1226 0.01% 63 1343 0.01% 64 1541 0.01% 65 1651 0.01% 66 1836 0.01% 67 2128 0.01% 68 2443 0.01% 69 3006 0.01% 70 3532 0.01% 71 3857 0.02% 72 4407 0.02% 73 4917 0.02% 74 5232 0.02% 75 5806 0.02% 76 6192 0.03% 77 7017 0.03% 78 7876 0.03% 79 9030 0.04% 80 9787 0.04% 81 11524 0.05% 82 12730 0.05% 83 14395 0.06% 84 17392 0.07% 85 19393 0.08% 86 20439 0.08% 87 21347 0.09% 88 22304 0.09% 89 23707 0.10% 90 25669 0.11% 91 27486 0.11% 92 30057 0.12% 93 31839 0.13% 94 33238 0.14% 95 34659 0.14% 96 35684 0.15% 97 37105 0.15% 98 38166 0.16% 99 40088 0.17% 100 42427 0.18% 101 44136 0.18% 102 47791 0.20% 103 49664 0.21% 104 51692 0.21% 105 53726 0.22% 106 54819 0.23% 107 54949 0.23% 108 56740 0.24% 109 58189 0.24% 110 59214 0.25% 111 63084 0.26% 112 65895 0.27% 113 68171 0.28% 114 71626 0.30% 115 73235 0.30% 116 73811 0.31% 117 75058 0.31% 118 75380 0.31% 119 76803 0.32% 120 79076 0.33% 121 81845 0.34% 122 83985 0.35% 123 88385 0.37% 124 91795 0.38% 125 94048 0.39% 126 96687 0.40% 127 96495 0.40% 128 97010 0.40% 129 99901 0.41% 130 100486 0.42% 131 104341 0.43% 132 109437 0.45% 133 113220 0.47% 134 117485 0.49% 135 122774 0.51% 136 126520 0.52% 137 130070 0.54% 138 135145 0.56% 139 139184 0.58% 140 145453 0.60% 141 155254 0.64% 142 165792 0.69% 143 181146 0.75% 144 202983 0.84% 145 230756 0.96% 146 272849 1.13% 147 347482 1.44% 148 501521 2.08% 149 926491 3.84% 150 4852555 20.13% 151 12206693 50.65% 24101893 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=30 prefix-density=0.56 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=20.20 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=1.6 sequence=AAAATGGTATTATAATTATATAGTTGATGTCTTTTGGTCACAAGATGACCAAATTACGCATCACAAGTACAACCCCACGTCAGAAAATGGTAGAAACTTCTATTGCTTATTACAAATTCACATCGAGCCATCCGGCATGCAGTACTGGAAAATAGCGAGTACATATACTCCATGGCATCGCATCCACATCAATGGATCGATCTGTAGGGTCATCTCCATATCTGTATGTATAAGTATACGTTGTATGTATAGGAGTTAACCGGATGAGAGGACTTAGAGCTCCCATGTGTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGGTTCCGTTGGCGACGCCTTCCTTGACGAACGGGTAGGTCTTGAGGTTCTCGAGGGACACGTTCACGGCCTCCTTTTCCAAGACGGCGCATTGGTCATCGAAAGGCATGGAGGCGCACTCGGTCTGCACCTTCTTCTTGGCCGGGAACCCGATCCTGACCCAGTCCTCGACGAAG criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=3.54 fanout-score-rank=20 prefix-density=0.59 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=106.18 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=8.5 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR5579235 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 23:05:00 Started mapping on | Dec 09 23:05:00 Finished on | Dec 09 23:08:18 Mapping speed, Million of reads per hour | 438.22 Number of input reads | 24101893 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 22725181 Uniquely mapped reads % | 94.29% Average mapped length | 289.38 Number of splices: Total | 24745631 Number of splices: Annotated (sjdb) | 23195763 Number of splices: GT/AG | 24408406 Number of splices: GC/AG | 309105 Number of splices: AT/AC | 11596 Number of splices: Non-canonical | 16524 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.37 Insertion rate per base | 0.00% Insertion average length | 1.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 306856 % of reads mapped to multiple loci | 1.27% Number of reads mapped to too many loci | 30911 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.58% % of reads unmapped: other | 0.74% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1104742 1104742 1104742 N_multimapping 306856 306856 306856 N_noFeature 992477 21982211 1298819 N_ambiguous 530092 3898 93937 UnstrandedReadsAssigned:21202612 PositiveStrandReadsAssigned:739072 NegativeStrandReadsAssigned:21332425 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR5579235 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579235-trimmed-pair1.fastq SRR5579235-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,101,893 reads, 21,516,170 reads pseudoaligned [quant] estimated average fragment length: 252.793 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,175 rounds 52973 SRR5579235.ke.tsv 35125 SRR5579235.se.tsv 88098 total ==> SRR5579235.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 684.829 0 0 PNS24247 1044 792.207 80.466 6.99296 PNS24249 1928 1676.21 90.6878 3.72485 PNS24246 1044 792.207 80.466 6.99296 PNS24248 1044 792.207 80.466 6.99296 PNS24244 1471 1219.21 166.914 9.42548 PNS24243 293 105.399 0 0 KQK14069 1603 1351.21 8052.78 410.309 KQK14071 474 245.456 165.738 46.4874 ==> SRR5579235.se.tsv <== BRADI_1g14170v3 9159 BRADI_1g53295v3 279 BRADI_1g59795v3 579 BRADI_1g07683v3 0 BRADI_1g00485v3 42 BRADI_1g20270v3 1969 BRADI_1g74790v3 215 BRADI_1g09890v3 0 BRADI_1g77505v3 372 BRADI_1g48960v3 0 SRR5579235 completed mapping pipeline successfully