Starting /dee2/code/volunteer_pipeline.sh SRR5579236 current disk space = 1523095666688 free memory = 1421430368 SRR5579236 SRAfilesize 8e39ab412dda7ca0e6bd44a5ca65e2fa SRR5579236.sra SRR5579236.sra file validated SRR5579236 is paired end SRR5579236 is conventional basespace SRR5579236 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579236_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.356 34.0 33.0 34.0 2.0 34.0 2 32.418 34.0 33.0 34.0 28.0 34.0 3 32.673 34.0 33.0 34.0 28.0 34.0 4 33.06775 34.0 33.0 34.0 32.0 34.0 5 33.21125 34.0 33.0 34.0 33.0 34.0 6 36.9495 38.0 37.0 38.0 36.0 38.0 7 37.24825 38.0 38.0 38.0 36.0 38.0 8 37.41075 38.0 38.0 38.0 37.0 38.0 9 37.428 38.0 38.0 38.0 37.0 38.0 10-14 37.41724999999999 38.0 38.0 38.0 37.0 38.0 15-19 37.40895 38.0 38.0 38.0 37.0 38.0 20-24 37.4062 38.0 38.0 38.0 37.0 38.0 25-29 37.3645 38.0 38.0 38.0 37.0 38.0 30-34 37.30655 38.0 38.0 38.0 37.0 38.0 35-39 37.26105 38.0 38.0 38.0 36.8 38.0 40-44 37.1293 38.0 38.0 38.0 36.2 38.0 45-49 37.0553 38.0 38.0 38.0 36.0 38.0 50-54 36.9884 38.0 38.0 38.0 35.8 38.0 55-59 36.9756 38.0 38.0 38.0 36.0 38.0 60-64 36.9765 38.0 38.0 38.0 35.8 38.0 65-69 36.90345 38.0 38.0 38.0 35.4 38.0 70-74 36.81845 38.0 38.0 38.0 35.0 38.0 75-79 36.72045 38.0 38.0 38.0 34.6 38.0 80-84 36.647800000000004 38.0 38.0 38.0 34.6 38.0 85-89 36.541799999999995 38.0 38.0 38.0 34.2 38.0 90-94 36.48145 38.0 38.0 38.0 34.0 38.0 95-99 36.40235 38.0 38.0 38.0 34.0 38.0 100-104 36.25365 38.0 38.0 38.0 33.8 38.0 105-109 36.19175 38.0 38.0 38.0 33.4 38.0 110-114 35.9935 38.0 37.4 38.0 33.0 38.0 115-119 35.710950000000004 38.0 36.8 38.0 31.6 38.0 120-124 35.399 38.0 36.2 38.0 29.4 38.0 125-129 35.39175 38.0 36.0 38.0 30.6 38.0 130-134 35.1716 38.0 36.0 38.0 29.2 38.0 135-139 35.08475 38.0 36.0 38.0 28.8 38.0 140-144 34.68255 38.0 35.2 38.0 27.2 38.0 145-149 34.14565 38.0 35.0 38.0 25.0 38.0 150-151 30.728 36.5 29.5 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 1.0 14 1.0 15 1.0 16 4.0 17 5.0 18 4.0 19 3.0 20 8.0 21 3.0 22 6.0 23 12.0 24 10.0 25 13.0 26 18.0 27 25.0 28 35.0 29 27.0 30 47.0 31 60.0 32 72.0 33 113.0 34 158.0 35 240.0 36 631.0 37 2499.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.19239904988123 14.222090261282661 11.163895486935866 35.42161520190024 2 23.425 19.025 34.75 22.8 3 21.9 24.525 23.9 29.675 4 27.200000000000003 31.65 19.8 21.349999999999998 5 25.374999999999996 33.800000000000004 21.224999999999998 19.6 6 19.45 34.949999999999996 22.625 22.975 7 16.375 20.724999999999998 41.199999999999996 21.7 8 19.25 20.95 26.85 32.95 9 19.950000000000003 20.925 30.349999999999998 28.775000000000002 10-14 22.264999999999997 27.139999999999997 24.965 25.629999999999995 15-19 22.86 26.0 25.174999999999997 25.965 20-24 22.695 25.915 25.865 25.525 25-29 22.97 25.924999999999997 25.575 25.53 30-34 22.38 25.685000000000002 26.009999999999998 25.924999999999997 35-39 23.585 25.765 25.180000000000003 25.47 40-44 23.49 25.569999999999997 25.240000000000002 25.7 45-49 22.84 25.490000000000002 25.430000000000003 26.240000000000002 50-54 22.935 26.095000000000002 25.15 25.82 55-59 22.715 25.835 25.64 25.81 60-64 22.835 25.525 25.455 26.185000000000002 65-69 22.73 25.485000000000003 25.509999999999998 26.275 70-74 22.695 26.115 25.355 25.835 75-79 24.03 25.2 25.35 25.419999999999998 80-84 23.47 25.430000000000003 25.264999999999997 25.835 85-89 23.805 25.629999999999995 25.290000000000003 25.275 90-94 23.630000000000003 25.840000000000003 25.105 25.424999999999997 95-99 23.875 25.330000000000002 25.124999999999996 25.669999999999998 100-104 23.695 25.485000000000003 25.080000000000002 25.740000000000002 105-109 23.925 25.569999999999997 24.654999999999998 25.85 110-114 23.835 25.779999999999998 24.27 26.115 115-119 24.07 26.040000000000003 24.59 25.3 120-124 24.04 26.009999999999998 24.29 25.66 125-129 23.875 25.66 24.605 25.86 130-134 24.22 24.69 24.959999999999997 26.13 135-139 24.52 25.374999999999996 24.075 26.029999999999998 140-144 23.955000000000002 25.41 24.285 26.35 145-149 24.315 25.580000000000002 23.705000000000002 26.400000000000002 150-151 24.55 25.5125 24.075 25.8625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 1.0 26 1.5 27 1.0 28 2.0 29 6.0 30 8.5 31 10.5 32 14.5 33 18.5 34 33.0 35 52.5 36 61.0 37 68.5 38 87.5 39 98.0 40 133.5 41 161.0 42 160.0 43 177.5 44 197.5 45 194.0 46 192.5 47 202.5 48 182.0 49 178.0 50 185.5 51 162.0 52 143.5 53 130.5 54 118.5 55 113.5 56 94.5 57 78.5 58 79.0 59 79.0 60 68.0 61 57.5 62 51.0 63 53.0 64 55.0 65 47.5 66 35.5 67 28.0 68 33.0 69 38.0 70 33.0 71 23.5 72 17.5 73 9.5 74 5.5 75 8.0 76 5.5 77 1.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 15.8 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.5125 0.0 0.0 0.0 0.0 88-89 0.6625 0.0 0.0 0.0 0.0 90-91 0.8625 0.0 0.0 0.0 0.0 92-93 1.0625 0.0 0.0 0.0 0.0 94-95 1.425 0.0 0.0 0.0 0.0 96-97 1.7625 0.0 0.0 0.0 0.0 98-99 2.05 0.0 0.0 0.0 0.0 100-101 2.2249999999999996 0.0 0.0 0.0 0.0 102-103 2.5625 0.0 0.0 0.0 0.0 104-105 2.8625 0.0 0.0 0.0 0.0 106-107 3.1875 0.0 0.0 0.0 0.0 108-109 3.6 0.0 0.0 0.0 0.0 110-111 4.0625 0.0 0.0 0.0 0.0 112-113 4.4625 0.0 0.0 0.0 0.0 114-115 4.85 0.0 0.0 0.0 0.0 116-117 5.4125 0.0 0.0 0.0 0.0 118-119 5.7625 0.0 0.0 0.0 0.0 120-121 6.362500000000001 0.0 0.0 0.0 0.0 122-123 6.8125 0.0 0.0 0.0 0.0 124-125 7.2625 0.0 0.0 0.0 0.0 126-127 7.975 0.0 0.0 0.0 0.0 128-129 8.662500000000001 0.0 0.0 0.0 0.0 130-131 9.4125 0.0 0.0 0.0 0.0 132-133 9.9875 0.0 0.0 0.0 0.0 134-135 10.662500000000001 0.0 0.0 0.0 0.0 136-137 11.425 0.0 0.0 0.0 0.0 138-139 12.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5579236 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579236_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6185 33.0 33.0 34.0 32.0 34.0 2 32.727 34.0 33.0 34.0 32.0 34.0 3 32.73225 34.0 33.0 34.0 32.0 34.0 4 32.717 34.0 33.0 34.0 32.0 34.0 5 32.72025 34.0 33.0 34.0 32.0 34.0 6 36.75475 38.0 38.0 38.0 35.0 38.0 7 36.87875 38.0 38.0 38.0 36.0 38.0 8 36.85675 38.0 38.0 38.0 36.0 38.0 9 36.802 38.0 38.0 38.0 36.0 38.0 10-14 36.73555 38.0 38.0 38.0 35.8 38.0 15-19 36.762 38.0 38.0 38.0 36.0 38.0 20-24 36.6965 38.0 38.0 38.0 35.8 38.0 25-29 36.76675 38.0 38.0 38.0 36.0 38.0 30-34 36.73725 38.0 38.0 38.0 36.0 38.0 35-39 36.70785 38.0 38.0 38.0 36.0 38.0 40-44 36.672450000000005 38.0 38.0 38.0 35.8 38.0 45-49 36.6764 38.0 38.0 38.0 35.8 38.0 50-54 36.617050000000006 38.0 38.0 38.0 35.4 38.0 55-59 36.5303 38.0 38.0 38.0 35.0 38.0 60-64 36.52625 38.0 38.0 38.0 35.0 38.0 65-69 36.44605 38.0 38.0 38.0 34.8 38.0 70-74 36.394850000000005 38.0 38.0 38.0 34.2 38.0 75-79 36.3531 38.0 38.0 38.0 34.0 38.0 80-84 36.3288 38.0 38.0 38.0 34.0 38.0 85-89 36.2018 38.0 38.0 38.0 34.0 38.0 90-94 36.03685 38.0 38.0 38.0 33.4 38.0 95-99 35.9392 38.0 38.0 38.0 32.8 38.0 100-104 35.77645 38.0 38.0 38.0 32.6 38.0 105-109 35.761 38.0 38.0 38.0 32.4 38.0 110-114 35.59455 38.0 38.0 38.0 31.6 38.0 115-119 35.3082 38.0 37.2 38.0 30.6 38.0 120-124 35.2643 38.0 36.6 38.0 31.0 38.0 125-129 34.9981 38.0 36.0 38.0 28.8 38.0 130-134 34.726350000000004 38.0 35.8 38.0 27.6 38.0 135-139 34.26950000000001 38.0 35.2 38.0 24.8 38.0 140-144 33.644499999999994 38.0 34.0 38.0 20.2 38.0 145-149 32.59035 38.0 33.0 38.0 10.2 38.0 150-151 27.765875 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 7.0 4 2.0 5 1.0 6 3.0 7 4.0 8 2.0 9 5.0 10 2.0 11 1.0 12 4.0 13 6.0 14 4.0 15 5.0 16 4.0 17 3.0 18 7.0 19 12.0 20 5.0 21 9.0 22 13.0 23 20.0 24 21.0 25 14.0 26 22.0 27 35.0 28 32.0 29 38.0 30 54.0 31 62.0 32 81.0 33 94.0 34 161.0 35 233.0 36 470.0 37 2552.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.7 14.424999999999999 11.85 29.025000000000002 2 27.675 21.95 29.9 20.474999999999998 3 24.5 22.900000000000002 26.35 26.25 4 28.375 30.3 18.85 22.475 5 27.825 32.175 18.85 21.15 6 21.525 34.575 20.7 23.200000000000003 7 21.4 15.625 37.675 25.3 8 22.825 20.424999999999997 23.474999999999998 33.275 9 23.875 21.099999999999998 26.125 28.9 10-14 25.085 25.89 22.96 26.064999999999998 15-19 26.029999999999998 24.84 24.169999999999998 24.959999999999997 20-24 25.69 25.1 24.42 24.79 25-29 25.775 25.205 24.34 24.68 30-34 25.445 24.765 24.279999999999998 25.509999999999998 35-39 25.89 24.575 24.445 25.09 40-44 25.95 25.28 23.849999999999998 24.92 45-49 26.39 24.529999999999998 24.65 24.43 50-54 25.974999999999998 24.91 24.315 24.8 55-59 26.229999999999997 24.83 24.7 24.240000000000002 60-64 26.075 25.21 24.685000000000002 24.03 65-69 25.4 25.540000000000003 24.13 24.93 70-74 25.44 25.424999999999997 24.085 25.05 75-79 26.445 24.18 24.935 24.44 80-84 26.400000000000002 25.240000000000002 24.474999999999998 23.885 85-89 25.840000000000003 25.27 24.85 24.04 90-94 26.369999999999997 25.4 23.865 24.365000000000002 95-99 26.924999999999997 25.06 24.125 23.89 100-104 26.63 25.16 24.75 23.46 105-109 26.25 25.905 24.39 23.455000000000002 110-114 27.13 25.53 24.21 23.13 115-119 27.185 25.19 24.404999999999998 23.22 120-124 27.29 25.735000000000003 24.26 22.715 125-129 27.3 25.230000000000004 24.235 23.235 130-134 27.439999999999998 25.805 24.224999999999998 22.53 135-139 27.54 25.81 24.38 22.27 140-144 27.6 25.81 24.075 22.515 145-149 27.839999999999996 26.125 23.855 22.18 150-151 28.249999999999996 25.7875 24.6125 21.349999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 0.5 27 1.0 28 1.5 29 2.0 30 3.5 31 5.5 32 8.5 33 12.0 34 22.0 35 27.5 36 34.0 37 48.5 38 65.5 39 87.5 40 100.0 41 118.0 42 150.5 43 170.0 44 166.0 45 180.0 46 195.5 47 194.0 48 198.0 49 174.5 50 153.0 51 149.0 52 141.5 53 137.5 54 129.0 55 116.5 56 99.5 57 82.0 58 83.0 59 94.5 60 91.5 61 76.5 62 78.5 63 78.0 64 64.5 65 57.0 66 61.0 67 70.5 68 62.5 69 51.5 70 41.5 71 30.0 72 24.0 73 21.5 74 15.0 75 8.0 76 6.0 77 5.0 78 3.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34459289135367 98.52499999999999 2 0.5293672800604992 1.05 3 0.10083186286866651 0.3 4 0.0 0.0 5 0.025207965717166627 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCAAGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.6625 0.0 0.0 0.0 0.0 90-91 0.8625 0.0 0.0 0.0 0.0 92-93 1.075 0.0 0.0 0.0 0.0 94-95 1.45 0.0 0.0 0.0 0.0 96-97 1.7875 0.0 0.0 0.0 0.0 98-99 2.075 0.0 0.0 0.0 0.0 100-101 2.2750000000000004 0.0 0.0 0.0 0.0 102-103 2.5999999999999996 0.0 0.0 0.0 0.0 104-105 2.8875 0.0 0.0 0.0 0.0 106-107 3.2375 0.0 0.0 0.0 0.0 108-109 3.65 0.0 0.0 0.0 0.0 110-111 4.175000000000001 0.0 0.0 0.0 0.0 112-113 4.5625 0.0 0.0 0.0 0.0 114-115 4.9625 0.0 0.0 0.0 0.0 116-117 5.5375 0.0 0.0 0.0 0.0 118-119 5.875 0.0 0.0 0.0 0.0 120-121 6.487500000000001 0.0 0.0 0.0 0.0 122-123 6.95 0.0 0.0 0.0 0.0 124-125 7.375 0.0 0.0 0.0 0.0 126-127 8.125 0.0 0.0 0.0 0.0 128-129 8.787500000000001 0.0 0.0 0.0 0.0 130-131 9.524999999999999 0.0 0.0 0.0 0.0 132-133 10.1375 0.0 0.0 0.0 0.0 134-135 10.85 0.0 0.0 0.0 0.0 136-137 11.625 0.0 0.0 0.0 0.0 138-139 12.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1468754 spots for SRR5579236.sra Written 1468754 spots for SRR5579236.sra Read 1468754 spots for SRR5579236.sra Written 1468754 spots for SRR5579236.sra Read 1468754 spots for SRR5579236.sra Written 1468754 spots for SRR5579236.sra Read 1468754 spots for SRR5579236.sra Written 1468754 spots for SRR5579236.sra Read 1468754 spots for SRR5579236.sra Written 1468754 spots for SRR5579236.sra Read 1468754 spots for SRR5579236.sra Written 1468754 spots for SRR5579236.sra Read 1468754 spots for SRR5579236.sra Written 1468754 spots for SRR5579236.sra Read 1468754 spots for SRR5579236.sra Written 1468754 spots for SRR5579236.sra Read 1468754 spots for SRR5579236.sra Written 1468754 spots for SRR5579236.sra Read 1468754 spots for SRR5579236.sra Written 1468754 spots for SRR5579236.sra Read 1468754 spots for SRR5579236.sra Written 1468754 spots for SRR5579236.sra Read 1468754 spots for SRR5579236.sra Written 1468754 spots for SRR5579236.sra Read 1468754 spots for SRR5579236.sra Written 1468754 spots for SRR5579236.sra Read 1468754 spots for SRR5579236.sra Written 1468754 spots for SRR5579236.sra Read 1468754 spots for SRR5579236.sra Written 1468754 spots for SRR5579236.sra Read 1468754 spots for SRR5579236.sra Written 1468754 spots for SRR5579236.sra Read 1468754 spots for SRR5579236.sra Written 1468754 spots for SRR5579236.sra Read 1468770 spots for SRR5579236.sra Written 1468770 spots for SRR5579236.sra Read 1468754 spots for SRR5579236.sra Written 1468754 spots for SRR5579236.sra Read 1468754 spots for SRR5579236.sra Written 1468754 spots for SRR5579236.sra SRR ids: ['SRR5579236.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0xdbbt7b SRR5579236.sra spots: 29375096 blocks: [[1, 1468754], [1468755, 2937508], [2937509, 4406262], [4406263, 5875016], [5875017, 7343770], [7343771, 8812524], [8812525, 10281278], [10281279, 11750032], [11750033, 13218786], [13218787, 14687540], [14687541, 16156294], [16156295, 17625048], [17625049, 19093802], [19093803, 20562556], [20562557, 22031310], [22031311, 23500064], [23500065, 24968818], [24968819, 26437572], [26437573, 27906326], [27906327, 29375096]] SRR5579236 file size 9932555 SRR5579236 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579236 SRR5579236_1.fastq SRR5579236_2.fastq Input file: SRR5579236_1.fastq Paired file: SRR5579236_2.fastq trimmed: SRR5579236-trimmed-pair1.fastq, SRR5579236-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 23:05:14 2024 >> started Mon Dec 9 23:06:00 2024 >> done (46.336s) 29375096 read pairs processed; of these: 55362 ( 0.19%) short read pairs filtered out after trimming by size control 74691 ( 0.25%) empty read pairs filtered out after trimming by size control 29245043 (99.56%) read pairs available; of these: 13920798 (47.60%) trimmed read pairs available after processing 15324245 (52.40%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 17 0.00% 20 18 0.00% 21 22 0.00% 22 19 0.00% 23 18 0.00% 24 21 0.00% 25 28 0.00% 26 21 0.00% 27 23 0.00% 28 17 0.00% 29 30 0.00% 30 34 0.00% 31 38 0.00% 32 39 0.00% 33 27 0.00% 34 37 0.00% 35 51 0.00% 36 55 0.00% 37 70 0.00% 38 68 0.00% 39 85 0.00% 40 92 0.00% 41 95 0.00% 42 107 0.00% 43 119 0.00% 44 126 0.00% 45 142 0.00% 46 160 0.00% 47 224 0.00% 48 253 0.00% 49 296 0.00% 50 326 0.00% 51 415 0.00% 52 426 0.00% 53 437 0.00% 54 462 0.00% 55 582 0.00% 56 681 0.00% 57 754 0.00% 58 878 0.00% 59 1014 0.00% 60 1221 0.00% 61 1304 0.00% 62 1530 0.01% 63 1709 0.01% 64 1794 0.01% 65 2035 0.01% 66 2380 0.01% 67 2661 0.01% 68 3066 0.01% 69 3823 0.01% 70 4362 0.01% 71 4704 0.02% 72 5411 0.02% 73 6124 0.02% 74 6527 0.02% 75 7245 0.02% 76 8142 0.03% 77 8892 0.03% 78 9975 0.03% 79 11472 0.04% 80 12699 0.04% 81 14455 0.05% 82 16270 0.06% 83 17989 0.06% 84 20948 0.07% 85 23351 0.08% 86 24720 0.08% 87 25912 0.09% 88 27912 0.10% 89 29720 0.10% 90 32073 0.11% 91 34292 0.12% 92 36984 0.13% 93 39004 0.13% 94 41152 0.14% 95 43126 0.15% 96 44763 0.15% 97 46107 0.16% 98 47925 0.16% 99 50551 0.17% 100 53223 0.18% 101 55558 0.19% 102 59324 0.20% 103 61697 0.21% 104 64009 0.22% 105 65830 0.23% 106 67342 0.23% 107 68307 0.23% 108 70828 0.24% 109 72382 0.25% 110 75023 0.26% 111 77918 0.27% 112 82013 0.28% 113 83869 0.29% 114 87088 0.30% 115 89658 0.31% 116 90236 0.31% 117 92278 0.32% 118 93035 0.32% 119 95310 0.33% 120 97303 0.33% 121 100098 0.34% 122 103825 0.36% 123 108525 0.37% 124 110859 0.38% 125 113198 0.39% 126 115011 0.39% 127 117125 0.40% 128 117856 0.40% 129 120612 0.41% 130 122570 0.42% 131 126198 0.43% 132 131314 0.45% 133 135667 0.46% 134 140398 0.48% 135 145614 0.50% 136 150654 0.52% 137 153526 0.52% 138 156732 0.54% 139 162735 0.56% 140 168676 0.58% 141 179246 0.61% 142 191687 0.66% 143 206380 0.71% 144 228665 0.78% 145 262076 0.90% 146 309531 1.06% 147 391288 1.34% 148 576012 1.97% 149 1034190 3.54% 150 5605632 19.17% 151 15324245 52.40% 29245043 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.86 fanout-score-rank=21 prefix-density=0.39 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=25.36 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=2.7 sequence=ATCGCCGGCCCCCATCCGCTTCCCTCCCGGCAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTCGCTATCGGTCTCTCGCCTGTATTTAGCCTTGGACGGAGTCTACCGCCCGATTTGGGCTGCATTCCCAAACAACCCGACTCGTTGACGGCGCCTCGTGGGGCGACAGGGTCCGGGCCGGACGGGGCTCTCACCCTCCCAGGCGCCCCTTTCCAGGGGACTTGGGCCCGGTCCGTCGCTGAGGACGCCTCTCCAGACTACAATTCGGACGGCACGGCCGCCCGATTCTCAAGCTGGGCTGCTCCCGGTTCGCTCGCCGTTACTAGGGGAATCCTTGTAAGTTTCTTCTCCT criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=7.42 fanout-score-rank=12 prefix-density=0.48 prefix-fanout=5.0 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=682.01 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=20.3 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR5579236 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 23:07:04 Started mapping on | Dec 09 23:07:05 Finished on | Dec 09 23:13:13 Mapping speed, Million of reads per hour | 286.09 Number of input reads | 29245043 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 26902627 Uniquely mapped reads % | 91.99% Average mapped length | 289.45 Number of splices: Total | 27575805 Number of splices: Annotated (sjdb) | 25893713 Number of splices: GT/AG | 27232642 Number of splices: GC/AG | 306998 Number of splices: AT/AC | 17898 Number of splices: Non-canonical | 18267 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 449580 % of reads mapped to multiple loci | 1.54% Number of reads mapped to too many loci | 117299 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.88% % of reads unmapped: other | 2.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1922924 1922924 1922924 N_multimapping 449580 449580 449580 N_noFeature 1016134 26133247 1303298 N_ambiguous 563471 4271 81396 UnstrandedReadsAssigned:25323022 PositiveStrandReadsAssigned:765109 NegativeStrandReadsAssigned:25517933 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR5579236 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579236-trimmed-pair1.fastq SRR5579236-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,245,043 reads, 25,784,171 reads pseudoaligned [quant] estimated average fragment length: 253.081 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,192 rounds 52973 SRR5579236.ke.tsv 35125 SRR5579236.se.tsv 88098 total ==> SRR5579236.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 684.64 0 0 PNS24247 1044 791.919 85.6807 6.11158 PNS24249 1928 1675.92 93.6752 3.15735 PNS24246 1044 791.919 85.6807 6.11158 PNS24248 1044 791.919 85.6807 6.11158 PNS24244 1471 1218.92 212.283 9.83763 PNS24243 293 106.781 0 0 KQK14069 1603 1350.92 1702.59 71.1922 KQK14071 474 246.781 32.4785 7.43422 ==> SRR5579236.se.tsv <== BRADI_1g14170v3 1897 BRADI_1g53295v3 46 BRADI_1g59795v3 635 BRADI_1g07683v3 0 BRADI_1g00485v3 29 BRADI_1g20270v3 7196 BRADI_1g74790v3 88 BRADI_1g09890v3 14 BRADI_1g77505v3 369 BRADI_1g48960v3 6 SRR5579236 completed mapping pipeline successfully