Starting /dee2/code/volunteer_pipeline.sh SRR5579237 current disk space = 1523120152576 free memory = 1598106816 SRR5579237 SRAfilesize 9fa213c8638d9fe7d1e2667530cca3b9 SRR5579237.sra SRR5579237.sra file validated SRR5579237 is paired end SRR5579237 is conventional basespace SRR5579237 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579237_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.593 34.0 33.0 34.0 2.0 34.0 2 32.665 34.0 33.0 34.0 28.0 34.0 3 32.90075 34.0 33.0 34.0 31.0 34.0 4 33.1125 34.0 33.0 34.0 32.0 34.0 5 33.27075 34.0 33.0 34.0 33.0 34.0 6 37.0165 38.0 37.0 38.0 36.0 38.0 7 37.32025 38.0 38.0 38.0 37.0 38.0 8 37.42325 38.0 38.0 38.0 37.0 38.0 9 37.49175 38.0 38.0 38.0 37.0 38.0 10-14 37.4925 38.0 38.0 38.0 37.6 38.0 15-19 37.49085 38.0 38.0 38.0 38.0 38.0 20-24 37.42785 38.0 38.0 38.0 37.8 38.0 25-29 37.45215 38.0 38.0 38.0 38.0 38.0 30-34 37.44585 38.0 38.0 38.0 38.0 38.0 35-39 37.3706 38.0 38.0 38.0 37.4 38.0 40-44 37.1328 38.0 38.0 38.0 36.2 38.0 45-49 37.12285000000001 38.0 38.0 38.0 36.0 38.0 50-54 37.02660000000001 38.0 38.0 38.0 36.0 38.0 55-59 37.0826 38.0 38.0 38.0 36.0 38.0 60-64 37.0424 38.0 38.0 38.0 36.0 38.0 65-69 36.9465 38.0 38.0 38.0 35.4 38.0 70-74 36.7291 38.0 38.0 38.0 34.8 38.0 75-79 36.2054 38.0 38.0 38.0 34.0 38.0 80-84 36.15235 38.0 38.0 38.0 34.0 38.0 85-89 36.071600000000004 38.0 38.0 38.0 34.0 38.0 90-94 35.97455 38.0 38.0 38.0 33.8 38.0 95-99 35.898450000000004 38.0 38.0 38.0 33.6 38.0 100-104 35.75765 38.0 38.0 38.0 33.0 38.0 105-109 35.672900000000006 38.0 38.0 38.0 32.6 38.0 110-114 35.5336 38.0 37.6 38.0 32.8 38.0 115-119 35.24755 38.0 37.0 38.0 30.0 38.0 120-124 34.923950000000005 38.0 36.0 38.0 29.0 38.0 125-129 34.905499999999996 38.0 36.0 38.0 28.4 38.0 130-134 34.64545 38.0 35.8 38.0 27.2 38.0 135-139 34.50515 38.0 35.6 38.0 26.6 38.0 140-144 34.12965 38.0 35.2 38.0 23.6 38.0 145-149 33.512950000000004 38.0 35.0 38.0 17.4 38.0 150-151 30.316499999999998 36.5 29.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 0.0 11 1.0 12 1.0 13 3.0 14 3.0 15 4.0 16 5.0 17 3.0 18 28.0 19 40.0 20 8.0 21 7.0 22 12.0 23 6.0 24 7.0 25 12.0 26 16.0 27 18.0 28 37.0 29 35.0 30 43.0 31 52.0 32 64.0 33 96.0 34 123.0 35 249.0 36 552.0 37 2573.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.94892167990919 12.287173666288309 9.364358683314416 33.399545970488084 2 24.525 17.9 32.15 25.424999999999997 3 23.65 21.75 23.95 30.65 4 27.275 28.475 19.175 25.074999999999996 5 28.275 29.5 21.8 20.424999999999997 6 23.5 31.6 21.75 23.150000000000002 7 18.375 21.925 37.974999999999994 21.725 8 20.225 22.1 26.5 31.175000000000004 9 24.425 20.075000000000003 27.650000000000002 27.85 10-14 24.515 25.91 23.06 26.515 15-19 24.51 24.65 24.02 26.82 20-24 24.05 24.755 24.23 26.965 25-29 24.759999999999998 24.25 23.775 27.215 30-34 23.580000000000002 24.115000000000002 24.66 27.644999999999996 35-39 24.285 23.474999999999998 24.115000000000002 28.125 40-44 24.685000000000002 23.435 24.555 27.325 45-49 24.995 24.16 24.585 26.26 50-54 24.685000000000002 23.400000000000002 23.86 28.055000000000003 55-59 25.080000000000002 23.235 24.474999999999998 27.21 60-64 25.105 23.015 24.805 27.075 65-69 23.919999999999998 25.615 22.905 27.560000000000002 70-74 24.825 25.2 23.3 26.674999999999997 75-79 25.185000000000002 24.645 22.865 27.305 80-84 25.575 23.465 23.75 27.21 85-89 25.230000000000004 23.74 23.615 27.415 90-94 25.53 23.685000000000002 23.49 27.295 95-99 25.419999999999998 24.560000000000002 22.95 27.07 100-104 25.805 24.195 23.025000000000002 26.974999999999998 105-109 25.619999999999997 25.645 22.285 26.450000000000003 110-114 25.22 25.635 22.365 26.779999999999998 115-119 25.064999999999998 25.019999999999996 22.175 27.74 120-124 24.990000000000002 25.045 22.755 27.21 125-129 24.455 24.695 22.695 28.155 130-134 24.39 24.775 23.11 27.725 135-139 23.535 24.36 23.7 28.405 140-144 23.93 23.810000000000002 24.104999999999997 28.155 145-149 23.14 24.205 24.215 28.439999999999998 150-151 23.225 24.6125 23.7875 28.375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 1.0 22 1.0 23 0.5 24 1.0 25 0.5 26 1.0 27 3.0 28 4.0 29 5.5 30 8.5 31 15.0 32 17.5 33 19.0 34 32.0 35 41.0 36 53.0 37 69.0 38 73.5 39 89.0 40 105.5 41 112.5 42 117.5 43 115.5 44 125.0 45 140.5 46 147.0 47 150.5 48 149.0 49 145.0 50 147.5 51 137.0 52 127.5 53 132.5 54 123.0 55 108.0 56 99.5 57 106.0 58 110.0 59 93.5 60 82.5 61 82.5 62 83.5 63 88.0 64 87.5 65 81.0 66 75.0 67 66.5 68 61.5 69 60.0 70 54.5 71 53.0 72 47.0 73 35.5 74 31.0 75 23.5 76 16.0 77 11.5 78 8.0 79 7.0 80 7.0 81 4.5 82 2.0 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 11.899999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.05 #Duplication Level Percentage of deduplicated Percentage of total 1 98.23008849557522 94.35 2 1.353461738677772 2.6 3 0.20822488287350338 0.6 4 0.15616866215512754 0.6 5 0.026028110359187923 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.026028110359187923 1.725 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTCTCCATCTCGTATGC 69 1.725 TruSeq Adapter, Index 1 (97% over 36bp) NATCGGAAGAGCACACGTCTGAACTCCAGTCACTTCTCCATCTCGTATGC 5 0.125 TruSeq Adapter, Index 3 (97% over 35bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.07500000000000001 0.0 0.0 0.0 0.0 60-61 0.1875 0.0 0.0 0.0 0.0 62-63 0.2375 0.0 0.0 0.0 0.0 64-65 0.275 0.0 0.0 0.0 0.0 66-67 0.30000000000000004 0.0 0.0 0.0 0.0 68-69 0.4125 0.0 0.0 0.0 0.0 70-71 0.475 0.0 0.0 0.0 0.0 72-73 0.6125 0.0 0.0 0.0 0.0 74-75 0.7625 0.0 0.0 0.0 0.0 76-77 0.9874999999999999 0.0 0.0 0.0 0.0 78-79 1.1875 0.0 0.0 0.0 0.0 80-81 1.4874999999999998 0.0 0.0 0.0 0.0 82-83 1.7625000000000002 0.0 0.0 0.0 0.0 84-85 2.225 0.0 0.0 0.0 0.0 86-87 2.75 0.0 0.0 0.0 0.0 88-89 3.2625 0.0 0.0 0.0 0.0 90-91 3.65 0.0 0.0 0.0 0.0 92-93 4.1375 0.0 0.0 0.0 0.0 94-95 4.7875 0.0 0.0 0.0 0.0 96-97 5.5625 0.0 0.0 0.0 0.0 98-99 6.5 0.0 0.0 0.0 0.0 100-101 7.2875 0.0 0.0 0.0 0.0 102-103 8.1375 0.0 0.0 0.0 0.0 104-105 9.1 0.0 0.0 0.0 0.0 106-107 10.2125 0.0 0.0 0.0 0.0 108-109 10.899999999999999 0.0 0.0 0.0 0.0 110-111 11.8375 0.0 0.0 0.0 0.0 112-113 12.925 0.0 0.0 0.0 0.0 114-115 14.0125 0.0 0.0 0.0 0.0 116-117 14.9875 0.0 0.0 0.0 0.0 118-119 15.837499999999999 0.0 0.0 0.0 0.0 120-121 17.1 0.0 0.0 0.0 0.0 122-123 18.225 0.0 0.0 0.0 0.0 124-125 19.35 0.0 0.0 0.0 0.0 126-127 20.6 0.0 0.0 0.0 0.0 128-129 21.7625 0.0 0.0 0.0 0.0 130-131 23.0125 0.0 0.0 0.0 0.0 132-133 24.0 0.0 0.0 0.0 0.0 134-135 25.025 0.0 0.0 0.0 0.0 136-137 26.237499999999997 0.0 0.0 0.0 0.0 138-139 27.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCTCAC 10 0.0068449317 144.90001 8 CCGGACT 10 0.0068449317 144.90001 2 GACTCCT 10 0.0068449317 144.90001 5 GGTATAG 10 0.0068449317 144.90001 5 GACCACC 10 0.0068449317 144.90001 9 CGACCAC 10 0.0068449317 144.90001 8 GTCGGTG 10 0.0068449317 144.90001 145 CACTTCT 115 0.0025678077 10.079999 140-144 CCAGTCA 120 0.0036543105 9.66 135-139 CGTCTGA 120 0.0036543105 9.66 125-129 >>END_MODULE SRR5579237 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579237_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.75325 33.0 33.0 34.0 32.0 34.0 2 32.72825 34.0 33.0 34.0 32.0 34.0 3 32.71675 34.0 33.0 34.0 32.0 34.0 4 32.712 34.0 33.0 34.0 32.0 34.0 5 32.70175 34.0 33.0 34.0 32.0 34.0 6 36.83425 38.0 38.0 38.0 36.0 38.0 7 36.75675 38.0 38.0 38.0 36.0 38.0 8 36.7695 38.0 38.0 38.0 36.0 38.0 9 36.67425 38.0 38.0 38.0 36.0 38.0 10-14 36.66685 38.0 38.0 38.0 36.0 38.0 15-19 36.63799999999999 38.0 38.0 38.0 36.0 38.0 20-24 36.568850000000005 38.0 38.0 38.0 36.0 38.0 25-29 36.518299999999996 38.0 38.0 38.0 36.0 38.0 30-34 36.443200000000004 38.0 38.0 38.0 35.6 38.0 35-39 36.404399999999995 38.0 38.0 38.0 35.6 38.0 40-44 36.40005 38.0 38.0 38.0 36.0 38.0 45-49 36.27425000000001 38.0 38.0 38.0 35.0 38.0 50-54 36.2903 38.0 38.0 38.0 34.8 38.0 55-59 36.2672 38.0 38.0 38.0 35.0 38.0 60-64 36.287549999999996 38.0 38.0 38.0 35.0 38.0 65-69 36.0472 38.0 38.0 38.0 34.6 38.0 70-74 35.6562 38.0 38.0 38.0 33.8 38.0 75-79 35.59074999999999 38.0 38.0 38.0 33.6 38.0 80-84 35.59505 38.0 38.0 38.0 33.6 38.0 85-89 35.506150000000005 38.0 38.0 38.0 33.4 38.0 90-94 35.356 38.0 38.0 38.0 32.8 38.0 95-99 35.22355 38.0 38.0 38.0 31.8 38.0 100-104 35.0339 38.0 38.0 38.0 30.6 38.0 105-109 34.9064 38.0 38.0 38.0 29.8 38.0 110-114 34.83145 38.0 38.0 38.0 29.6 38.0 115-119 34.585249999999995 38.0 36.8 38.0 27.2 38.0 120-124 34.23015 38.0 36.0 38.0 23.6 38.0 125-129 33.8628 38.0 35.2 38.0 21.8 38.0 130-134 33.40475 38.0 35.0 38.0 15.6 38.0 135-139 32.73615 38.0 34.0 38.0 13.2 38.0 140-144 31.85435 38.0 32.4 38.0 6.4 38.0 145-149 30.444049999999997 38.0 30.6 38.0 2.0 38.0 150-151 25.198749999999997 33.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 33.0 3 15.0 4 9.0 5 6.0 6 6.0 7 3.0 8 3.0 9 8.0 10 4.0 11 1.0 12 4.0 13 5.0 14 18.0 15 17.0 16 30.0 17 14.0 18 13.0 19 4.0 20 14.0 21 7.0 22 11.0 23 9.0 24 8.0 25 16.0 26 14.0 27 23.0 28 41.0 29 31.0 30 51.0 31 86.0 32 77.0 33 88.0 34 141.0 35 247.0 36 525.0 37 2418.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.85 13.55 11.525 28.075 2 28.050000000000004 22.375 25.324999999999996 24.25 3 26.275 23.400000000000002 24.9 25.424999999999997 4 30.125 30.0 14.924999999999999 24.95 5 29.975 31.8 17.325 20.9 6 24.6 32.025 19.2 24.175 7 23.0 17.599999999999998 33.300000000000004 26.1 8 23.425 22.95 20.7 32.925 9 27.025 20.8 23.549999999999997 28.625 10-14 26.919999999999998 24.525 21.29 27.265 15-19 27.700000000000003 23.53 22.42 26.35 20-24 28.465 23.98 21.07 26.484999999999996 25-29 28.555000000000003 23.86 21.85 25.735000000000003 30-34 27.58 23.575 22.28 26.565 35-39 27.029999999999998 23.119999999999997 22.975 26.875 40-44 28.610000000000003 23.189999999999998 22.314999999999998 25.885 45-49 27.96 22.6 22.79 26.650000000000002 50-54 26.865 22.97 23.200000000000003 26.965 55-59 28.03 23.580000000000002 23.06 25.330000000000002 60-64 26.82 25.155 22.325 25.7 65-69 27.565 24.709999999999997 22.395 25.330000000000002 70-74 26.865 24.875 22.71 25.55 75-79 27.54 24.560000000000002 22.505 25.395 80-84 27.98 24.23 22.415 25.374999999999996 85-89 27.445000000000004 24.65 23.265 24.64 90-94 28.410000000000004 23.580000000000002 23.125 24.884999999999998 95-99 28.275 24.68 22.48 24.565 100-104 28.595 24.79 22.125 24.490000000000002 105-109 29.125 25.509999999999998 22.115000000000002 23.25 110-114 28.78 25.96 21.740000000000002 23.52 115-119 29.744999999999997 25.515 22.065 22.675 120-124 29.330000000000002 25.900000000000002 21.86 22.91 125-129 29.73 25.740000000000002 22.264999999999997 22.264999999999997 130-134 29.75 25.290000000000003 22.835 22.125 135-139 29.875 25.91 22.335 21.88 140-144 30.285 25.895000000000003 22.665 21.154999999999998 145-149 29.799999999999997 26.995 22.09 21.115000000000002 150-151 29.862499999999997 28.249999999999996 21.212500000000002 20.674999999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.0 24 0.0 25 0.5 26 4.0 27 4.5 28 3.0 29 5.0 30 5.5 31 4.0 32 7.5 33 15.5 34 21.0 35 22.5 36 26.5 37 37.5 38 58.0 39 66.0 40 80.5 41 101.0 42 100.5 43 103.0 44 114.5 45 133.5 46 149.5 47 140.0 48 130.0 49 137.0 50 135.5 51 125.0 52 139.0 53 150.0 54 137.5 55 118.5 56 104.5 57 110.5 58 116.0 59 116.5 60 109.0 61 93.5 62 88.5 63 97.5 64 92.5 65 86.5 66 86.0 67 84.5 68 82.0 69 79.5 70 74.5 71 60.5 72 55.5 73 50.5 74 38.5 75 30.5 76 23.0 77 15.0 78 10.5 79 7.0 80 3.5 81 1.0 82 1.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.375 #Duplication Level Percentage of deduplicated Percentage of total 1 97.58846657929226 93.075 2 1.7562254259501964 3.35 3 0.3669724770642202 1.05 4 0.1310615989515072 0.5 5 0.07863695937090433 0.375 6 0.0 0.0 7 0.02621231979030144 0.17500000000000002 8 0.02621231979030144 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.02621231979030144 1.275 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 51 1.275 Illumina Single End PCR Primer 1 (100% over 50bp) GCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCC 8 0.2 No Hit GCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGA 7 0.17500000000000002 No Hit GAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCC 5 0.125 No Hit GGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTT 5 0.125 No Hit ATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.07500000000000001 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.21250000000000002 0.0 0.0 0.0 0.0 64-65 0.25 0.0 0.0 0.0 0.0 66-67 0.275 0.0 0.0 0.0 0.0 68-69 0.38749999999999996 0.0 0.0 0.0 0.0 70-71 0.44999999999999996 0.0 0.0 0.0 0.0 72-73 0.5875 0.0 0.0 0.0 0.0 74-75 0.7375 0.0 0.0 0.0 0.0 76-77 0.9125 0.0 0.0 0.0 0.0 78-79 1.1124999999999998 0.0 0.0 0.0 0.0 80-81 1.4125 0.0 0.0 0.0 0.0 82-83 1.725 0.0 0.0 0.0 0.0 84-85 2.175 0.0 0.0 0.0 0.0 86-87 2.7 0.0 0.0 0.0 0.0 88-89 3.225 0.0 0.0 0.0 0.0 90-91 3.6375 0.0 0.0 0.0 0.0 92-93 4.1125 0.0 0.0 0.0 0.0 94-95 4.737500000000001 0.0 0.0 0.0 0.0 96-97 5.5375 0.0 0.0 0.0 0.0 98-99 6.45 0.0 0.0 0.0 0.0 100-101 7.2125 0.0 0.0 0.0 0.0 102-103 8.0875 0.0 0.0 0.0 0.0 104-105 9.0625 0.0 0.0 0.0 0.0 106-107 10.1875 0.0 0.0 0.0 0.0 108-109 10.9375 0.0 0.0 0.0 0.0 110-111 11.875 0.0 0.0 0.0 0.0 112-113 13.024999999999999 0.0 0.0 0.0 0.0 114-115 14.1125 0.0 0.0 0.0 0.0 116-117 15.1625 0.0 0.0 0.0 0.0 118-119 15.9875 0.0 0.0 0.0 0.0 120-121 17.225 0.0 0.0 0.0 0.0 122-123 18.2875 0.0 0.0 0.0 0.0 124-125 19.3875 0.0 0.0 0.0 0.0 126-127 20.6375 0.0 0.0 0.0 0.0 128-129 21.775 0.0 0.0 0.0 0.0 130-131 22.975 0.0 0.0 0.0 0.0 132-133 23.975 0.0 0.0 0.0 0.0 134-135 25.025 0.0 0.0 0.0 0.0 136-137 26.200000000000003 0.0 0.0 0.0 0.0 138-139 27.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACTTCT 10 0.006830828 145.0 8 CTGAAAG 10 0.006830828 145.0 2 GCTGAAA 10 0.006830828 145.0 1 GAAAGCC 10 0.006830828 145.0 4 CCCTAAC 10 0.006830828 145.0 9 AGCCCTA 10 0.006830828 145.0 7 GTAGATC 90 0.0048656333 11.277777 140-144 GGGAAAG 120 0.0036335043 9.666667 130-134 >>END_MODULE Read 1141139 spots for SRR5579237.sra Written 1141139 spots for SRR5579237.sra Read 1141139 spots for SRR5579237.sra Written 1141139 spots for SRR5579237.sra Read 1141139 spots for SRR5579237.sra Written 1141139 spots for SRR5579237.sra Read 1141139 spots for SRR5579237.sra Written 1141139 spots for SRR5579237.sra Read 1141139 spots for SRR5579237.sra Written 1141139 spots for SRR5579237.sra Read 1141145 spots for SRR5579237.sra Written 1141145 spots for SRR5579237.sra Read 1141139 spots for SRR5579237.sra Written 1141139 spots for SRR5579237.sra Read 1141139 spots for SRR5579237.sra Written 1141139 spots for SRR5579237.sra Read 1141139 spots for SRR5579237.sra Written 1141139 spots for SRR5579237.sra Read 1141139 spots for SRR5579237.sra Written 1141139 spots for SRR5579237.sra Read 1141139 spots for SRR5579237.sra Written 1141139 spots for SRR5579237.sra Read 1141139 spots for SRR5579237.sra Written 1141139 spots for SRR5579237.sra Read 1141139 spots for SRR5579237.sra Written 1141139 spots for SRR5579237.sra Read 1141139 spots for SRR5579237.sra Written 1141139 spots for SRR5579237.sra Read 1141139 spots for SRR5579237.sra Written 1141139 spots for SRR5579237.sra Read 1141139 spots for SRR5579237.sra Written 1141139 spots for SRR5579237.sra Read 1141139 spots for SRR5579237.sra Written 1141139 spots for SRR5579237.sra Read 1141139 spots for SRR5579237.sra Written 1141139 spots for SRR5579237.sra Read 1141139 spots for SRR5579237.sra Written 1141139 spots for SRR5579237.sra Read 1141139 spots for SRR5579237.sra Written 1141139 spots for SRR5579237.sra SRR ids: ['SRR5579237.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_346gn1qs SRR5579237.sra spots: 22822786 blocks: [[1, 1141139], [1141140, 2282278], [2282279, 3423417], [3423418, 4564556], [4564557, 5705695], [5705696, 6846834], [6846835, 7987973], [7987974, 9129112], [9129113, 10270251], [10270252, 11411390], [11411391, 12552529], [12552530, 13693668], [13693669, 14834807], [14834808, 15975946], [15975947, 17117085], [17117086, 18258224], [18258225, 19399363], [19399364, 20540502], [20540503, 21681641], [21681642, 22822786]] SRR5579237 file size 7712192 SRR5579237 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579237 SRR5579237_1.fastq SRR5579237_2.fastq Input file: SRR5579237_1.fastq Paired file: SRR5579237_2.fastq trimmed: SRR5579237-trimmed-pair1.fastq, SRR5579237-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 23:11:57 2024 >> started Mon Dec 9 23:12:26 2024 >> done (28.803s) 22822786 read pairs processed; of these: 66921 ( 0.29%) short read pairs filtered out after trimming by size control 462838 ( 2.03%) empty read pairs filtered out after trimming by size control 22293027 (97.68%) read pairs available; of these: 13378698 (60.01%) trimmed read pairs available after processing 8914329 (39.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 41 0.00% 19 41 0.00% 20 49 0.00% 21 37 0.00% 22 43 0.00% 23 52 0.00% 24 84 0.00% 25 65 0.00% 26 82 0.00% 27 81 0.00% 28 81 0.00% 29 127 0.00% 30 136 0.00% 31 191 0.00% 32 164 0.00% 33 174 0.00% 34 212 0.00% 35 280 0.00% 36 289 0.00% 37 337 0.00% 38 381 0.00% 39 447 0.00% 40 541 0.00% 41 492 0.00% 42 563 0.00% 43 662 0.00% 44 798 0.00% 45 955 0.00% 46 1124 0.01% 47 1220 0.01% 48 1525 0.01% 49 1689 0.01% 50 1779 0.01% 51 2001 0.01% 52 2248 0.01% 53 2352 0.01% 54 2551 0.01% 55 2831 0.01% 56 3092 0.01% 57 3744 0.02% 58 4274 0.02% 59 4698 0.02% 60 5161 0.02% 61 5922 0.03% 62 6608 0.03% 63 7340 0.03% 64 7814 0.04% 65 9038 0.04% 66 11093 0.05% 67 14887 0.07% 68 18812 0.08% 69 24253 0.11% 70 25153 0.11% 71 19921 0.09% 72 20971 0.09% 73 21835 0.10% 74 24169 0.11% 75 26040 0.12% 76 27920 0.13% 77 30714 0.14% 78 33615 0.15% 79 37557 0.17% 80 40938 0.18% 81 44676 0.20% 82 49588 0.22% 83 53813 0.24% 84 58822 0.26% 85 63023 0.28% 86 64612 0.29% 87 68766 0.31% 88 73211 0.33% 89 75974 0.34% 90 81722 0.37% 91 85515 0.38% 92 90538 0.41% 93 93931 0.42% 94 97656 0.44% 95 100441 0.45% 96 101967 0.46% 97 103894 0.47% 98 104332 0.47% 99 108128 0.49% 100 111587 0.50% 101 114240 0.51% 102 117326 0.53% 103 121468 0.54% 104 122416 0.55% 105 125048 0.56% 106 125831 0.56% 107 124069 0.56% 108 126250 0.57% 109 125679 0.56% 110 127344 0.57% 111 131075 0.59% 112 133586 0.60% 113 136607 0.61% 114 139019 0.62% 115 140307 0.63% 116 139338 0.63% 117 136728 0.61% 118 135717 0.61% 119 134468 0.60% 120 135878 0.61% 121 137211 0.62% 122 139340 0.63% 123 142170 0.64% 124 143420 0.64% 125 144482 0.65% 126 146350 0.66% 127 142329 0.64% 128 140756 0.63% 129 141645 0.64% 130 139020 0.62% 131 141926 0.64% 132 144641 0.65% 133 146756 0.66% 134 146851 0.66% 135 148802 0.67% 136 151527 0.68% 137 149909 0.67% 138 151103 0.68% 139 153013 0.69% 140 154028 0.69% 141 157744 0.71% 142 165057 0.74% 143 167950 0.75% 144 181353 0.81% 145 198610 0.89% 146 223791 1.00% 147 267319 1.20% 148 366401 1.64% 149 628713 2.82% 150 3429597 15.38% 151 8914329 39.99% 22293027 reads passed initial QC criterion=sequence-density sequence-density=0.98 sequence-density-rank=1 fanout-score=2.62 fanout-score-rank=14 prefix-density=1.06 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=19 fanout-score=25.41 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=6.5 sequence=ACAAAACCAAAGTAAATAGCATACATCACGTTTATATATCACGACTTACGGCGCCAACAGCTGAGAGTGGCTGGGCGAGGGTCTATTCATCTCACTCCTCCGACTCCTCGTAGGCTGCCTCCGCCCGGAGCAGCACGAACCCGACGGCAACGCCGACGAGCGTGAGCAAGTTCATGACGACGGCGATCCTGAAGATCTCCCCGGCGGCGTTGCACTGCGCCCCGAACGTGCCCCCGCGCCTCTTCCCGGCGGGGCTCAGGGACGCGACGATCCTGGCAAACTTGTAGTCGGCGCTCTTGCGCACGCCCAGCATGGTCACCTTGTTGAGCCCCTTGAGGCCGCTGTAGGCGTTCATGCCTTCCACGTACGTCACGCCGGACCTCTTCTTCGCCGCCGCCGGGGCGGTCAGCTGCGGGAGCGTGGCCACGGAGAGGGACGCCATTAAACTCGCCTGAACCT criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=4.12 fanout-score-rank=14 prefix-density=0.79 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGG criterion=fanout-score sequence-density=0.04 sequence-density-rank=24 fanout-score=20.20 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=5.2 sequence=CTGCTGGGTGCCAACGGCGGCGTGCTGGTGTTCGAGCCGAACGAGTTCAGCGTCAAGGCCGGGGAGACGATCACGTTCAAGAACAACGCCGGGTTCCCCCACAACATCGTGTTCGACGAGGACGCCGTGCCCAGCGGCGTCGACGTCTCCAAGATCTCCCAGGAGGAGTACCTCAACGCCCCCGGCGAGACTTTCTCCGTCACGCTCACTGTCCCTGGCACCTACGGCTTCTACTGCGAGCCACATGCCGGGGCCGGCATGGTCGGCAAGGTCACCGTCAACTGATTGATGCATCGCCCGGCCCGCCTTAATTTCTCCGTTTCAAGGGTGTCAATATATGATGATGTGTTGTTATAATGTACGCGCCTGCAAACTATATACATGCAGGATCATTGATGAGCCAGCTGATACTATATATTTCTCCATCTCTGTGAGTCATATGCT SRR5579237 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 23:13:24 Started mapping on | Dec 09 23:13:24 Finished on | Dec 09 23:22:52 Mapping speed, Million of reads per hour | 141.29 Number of input reads | 22293027 Average input read length | 274 UNIQUE READS: Uniquely mapped reads number | 18765624 Uniquely mapped reads % | 84.18% Average mapped length | 273.62 Number of splices: Total | 15633979 Number of splices: Annotated (sjdb) | 14453536 Number of splices: GT/AG | 15418935 Number of splices: GC/AG | 193647 Number of splices: AT/AC | 7375 Number of splices: Non-canonical | 14022 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.35 Insertion rate per base | 0.00% Insertion average length | 1.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 291648 % of reads mapped to multiple loci | 1.31% Number of reads mapped to too many loci | 47860 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.37% % of reads unmapped: other | 0.93% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3260805 3260805 3260805 N_multimapping 291648 291648 291648 N_noFeature 555671 18052382 823872 N_ambiguous 573398 3752 127921 UnstrandedReadsAssigned:17636555 PositiveStrandReadsAssigned:709490 NegativeStrandReadsAssigned:17813831 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=120 echo kmer=115 SRR5579237 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579237-trimmed-pair1.fastq SRR5579237-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,293,027 reads, 17,944,760 reads pseudoaligned [quant] estimated average fragment length: 191.832 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,216 rounds 52973 SRR5579237.ke.tsv 35125 SRR5579237.se.tsv 88098 total ==> SRR5579237.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 745.478 66.2257 5.25865 PNS24247 1044 853.168 0 0 PNS24249 1928 1737.17 80.6752 2.74904 PNS24246 1044 853.168 0 0 PNS24248 1044 853.168 0 0 PNS24244 1471 1280.17 153.099 7.07927 PNS24243 293 130.959 0 0 KQK14069 1603 1412.17 6849.7 287.123 KQK14071 474 290.318 143.319 29.2223 ==> SRR5579237.se.tsv <== BRADI_1g14170v3 7249 BRADI_1g53295v3 26 BRADI_1g59795v3 234 BRADI_1g07683v3 0 BRADI_1g00485v3 13 BRADI_1g20270v3 1504 BRADI_1g74790v3 622 BRADI_1g09890v3 13 BRADI_1g77505v3 654 BRADI_1g48960v3 0 SRR5579237 completed mapping pipeline successfully