Starting /dee2/code/volunteer_pipeline.sh SRR5579238 current disk space = 1523118542848 free memory = 1562659548 SRR5579238 SRAfilesize 7c1d90e41b2489776b97528f6e9c14f1 SRR5579238.sra SRR5579238.sra file validated SRR5579238 is paired end SRR5579238 is conventional basespace SRR5579238 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579238_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.45725 34.0 33.0 34.0 2.0 34.0 2 32.311 34.0 33.0 34.0 28.0 34.0 3 32.55325 34.0 33.0 34.0 28.0 34.0 4 33.02125 34.0 33.0 34.0 32.0 34.0 5 33.14075 34.0 33.0 34.0 32.0 34.0 6 36.93425 38.0 37.0 38.0 35.0 38.0 7 37.28275 38.0 38.0 38.0 36.0 38.0 8 37.3795 38.0 38.0 38.0 37.0 38.0 9 37.34975 38.0 38.0 38.0 37.0 38.0 10-14 37.408 38.0 38.0 38.0 37.0 38.0 15-19 37.386700000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.31835 38.0 38.0 38.0 37.0 38.0 25-29 37.322649999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.2889 38.0 38.0 38.0 37.0 38.0 35-39 37.23665 38.0 38.0 38.0 36.6 38.0 40-44 37.00925 38.0 38.0 38.0 35.8 38.0 45-49 36.94495 38.0 38.0 38.0 35.6 38.0 50-54 36.94255 38.0 38.0 38.0 35.6 38.0 55-59 36.8214 38.0 38.0 38.0 35.0 38.0 60-64 36.8304 38.0 38.0 38.0 35.0 38.0 65-69 36.75735 38.0 38.0 38.0 34.8 38.0 70-74 36.7235 38.0 38.0 38.0 34.6 38.0 75-79 36.70925 38.0 38.0 38.0 34.4 38.0 80-84 36.599199999999996 38.0 38.0 38.0 34.0 38.0 85-89 36.43665 38.0 38.0 38.0 34.0 38.0 90-94 36.218399999999995 38.0 37.2 38.0 33.2 38.0 95-99 36.12825 38.0 37.0 38.0 33.0 38.0 100-104 36.0372 38.0 37.2 38.0 32.8 38.0 105-109 35.8815 38.0 36.8 38.0 32.2 38.0 110-114 35.790850000000006 38.0 36.6 38.0 31.0 38.0 115-119 35.64435 38.0 36.0 38.0 31.4 38.0 120-124 35.346199999999996 38.0 36.0 38.0 29.8 38.0 125-129 35.18095 38.0 35.4 38.0 28.4 38.0 130-134 35.06125 38.0 35.2 38.0 28.2 38.0 135-139 34.775999999999996 38.0 35.0 38.0 27.6 38.0 140-144 34.32725000000001 38.0 35.0 38.0 25.8 38.0 145-149 33.4824 38.0 34.2 38.0 20.6 38.0 150-151 29.705125 36.0 27.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 2.0 14 1.0 15 2.0 16 1.0 17 3.0 18 2.0 19 1.0 20 2.0 21 7.0 22 8.0 23 11.0 24 13.0 25 19.0 26 18.0 27 21.0 28 36.0 29 42.0 30 63.0 31 65.0 32 85.0 33 103.0 34 180.0 35 307.0 36 789.0 37 2217.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.336382413691354 13.661847152552376 10.002950722927118 35.99881971082915 2 24.625 19.475 34.449999999999996 21.45 3 21.325 26.400000000000002 22.75 29.525000000000002 4 26.424999999999997 32.225 19.075 22.275 5 25.074999999999996 33.800000000000004 22.05 19.075 6 20.925 33.900000000000006 22.825 22.35 7 16.025 20.7 41.275 22.0 8 21.099999999999998 19.475 27.250000000000004 32.175 9 21.075 19.0 29.975 29.95 10-14 22.715 26.615 24.665 26.005 15-19 23.580000000000002 24.925 25.545 25.95 20-24 23.25 25.0 26.015 25.735000000000003 25-29 23.31 25.490000000000002 25.480000000000004 25.72 30-34 23.23 25.355 25.490000000000002 25.924999999999997 35-39 23.525 25.419999999999998 25.155 25.900000000000002 40-44 23.61 25.424999999999997 25.085 25.88 45-49 23.200000000000003 25.535000000000004 24.959999999999997 26.305 50-54 23.35 25.21 25.19 26.25 55-59 23.69 25.56 24.745 26.005 60-64 24.055 24.72 25.115 26.11 65-69 23.53 24.834999999999997 25.155 26.479999999999997 70-74 24.11 24.745 25.35 25.795 75-79 24.305 24.490000000000002 25.155 26.05 80-84 23.43 24.81 25.419999999999998 26.340000000000003 85-89 23.86 24.83 25.455 25.855 90-94 24.345 24.77 24.91 25.974999999999998 95-99 24.349999999999998 24.83 25.0 25.82 100-104 24.15 24.965 25.155 25.729999999999997 105-109 24.834999999999997 24.745 24.515 25.905 110-114 24.37 24.895 24.89 25.845000000000002 115-119 24.005000000000003 25.080000000000002 24.8 26.115 120-124 24.685000000000002 25.11 24.104999999999997 26.1 125-129 24.605 24.709999999999997 23.815 26.87 130-134 23.9 24.845 24.58 26.674999999999997 135-139 24.175 25.055 24.07 26.700000000000003 140-144 24.72 24.89 24.099999999999998 26.290000000000003 145-149 23.775 24.58 25.069999999999997 26.575 150-151 23.2625 24.962500000000002 24.95 26.825 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 1.0 26 1.0 27 3.5 28 3.5 29 3.5 30 6.5 31 13.0 32 18.5 33 24.5 34 26.5 35 31.0 36 46.5 37 61.5 38 77.5 39 102.5 40 123.0 41 143.5 42 156.0 43 177.5 44 207.5 45 213.0 46 206.0 47 200.0 48 186.5 49 160.5 50 150.0 51 134.0 52 124.0 53 122.5 54 107.0 55 97.0 56 93.5 57 89.0 58 82.5 59 83.0 60 74.5 61 64.5 62 63.5 63 63.0 64 65.5 65 58.5 66 55.0 67 50.0 68 41.5 69 44.0 70 42.0 71 29.0 72 19.0 73 15.5 74 12.5 75 9.5 76 4.0 77 1.5 78 3.0 79 2.5 80 1.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 15.275 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.32007051120625 98.6 2 0.6295643414756988 1.25 3 0.0503651473180559 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0125 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.38749999999999996 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.55 0.0 0.0 0.0 0.0 88-89 0.6375 0.0 0.0 0.0 0.0 90-91 0.7875000000000001 0.0 0.0 0.0 0.0 92-93 1.025 0.0 0.0 0.0 0.0 94-95 1.2375 0.0 0.0 0.0 0.0 96-97 1.4625 0.0 0.0 0.0 0.0 98-99 1.625 0.0 0.0 0.0 0.0 100-101 1.9874999999999998 0.0 0.0 0.0 0.0 102-103 2.2125 0.0 0.0 0.0 0.0 104-105 2.5 0.0 0.0 0.0 0.0 106-107 2.8625 0.0 0.0 0.0 0.0 108-109 3.2375 0.0 0.0 0.0 0.0 110-111 3.4749999999999996 0.0 0.0 0.0 0.0 112-113 3.9499999999999997 0.0 0.0 0.0 0.0 114-115 4.4875 0.0 0.0 0.0 0.0 116-117 5.0 0.0 0.0 0.0 0.0 118-119 5.425000000000001 0.0 0.0 0.0 0.0 120-121 5.9 0.0 0.0 0.0 0.0 122-123 6.4375 0.0 0.0 0.0 0.0 124-125 6.987500000000001 0.0 0.0 0.0 0.0 126-127 7.4125 0.0 0.0 0.0 0.0 128-129 7.8375 0.0 0.0 0.0 0.0 130-131 8.2375 0.0 0.0 0.0 0.0 132-133 8.625 0.0 0.0 0.0 0.0 134-135 9.3375 0.0 0.0 0.0 0.0 136-137 10.0125 0.0 0.0 0.0 0.0 138-139 10.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGGCA 10 0.0068519996 144.85 145 >>END_MODULE SRR5579238 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579238_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4885 33.0 33.0 34.0 32.0 34.0 2 32.61775 33.0 33.0 34.0 32.0 34.0 3 32.63925 33.0 33.0 34.0 32.0 34.0 4 32.572 33.0 33.0 34.0 32.0 34.0 5 32.554 34.0 33.0 34.0 32.0 34.0 6 36.62375 38.0 38.0 38.0 35.0 38.0 7 36.6675 38.0 38.0 38.0 36.0 38.0 8 36.61475 38.0 38.0 38.0 35.0 38.0 9 36.674 38.0 38.0 38.0 35.0 38.0 10-14 36.675399999999996 38.0 38.0 38.0 35.6 38.0 15-19 36.582649999999994 38.0 38.0 38.0 35.4 38.0 20-24 36.5318 38.0 38.0 38.0 35.4 38.0 25-29 36.546350000000004 38.0 38.0 38.0 35.4 38.0 30-34 36.5449 38.0 38.0 38.0 35.6 38.0 35-39 36.498149999999995 38.0 38.0 38.0 35.2 38.0 40-44 36.48675 38.0 38.0 38.0 35.0 38.0 45-49 36.441449999999996 38.0 38.0 38.0 35.0 38.0 50-54 36.3135 38.0 38.0 38.0 34.4 38.0 55-59 36.3106 38.0 38.0 38.0 34.0 38.0 60-64 36.2487 38.0 38.0 38.0 34.0 38.0 65-69 36.13905 38.0 38.0 38.0 34.0 38.0 70-74 36.07735 38.0 38.0 38.0 34.0 38.0 75-79 36.0361 38.0 38.0 38.0 33.6 38.0 80-84 36.0223 38.0 38.0 38.0 33.6 38.0 85-89 35.85719999999999 38.0 38.0 38.0 33.0 38.0 90-94 35.81605 38.0 38.0 38.0 33.4 38.0 95-99 35.64465 38.0 38.0 38.0 32.6 38.0 100-104 35.47255 38.0 37.6 38.0 30.6 38.0 105-109 35.35505 38.0 37.0 38.0 31.0 38.0 110-114 35.2296 38.0 37.0 38.0 30.2 38.0 115-119 34.963 38.0 36.0 38.0 28.2 38.0 120-124 34.69945 38.0 36.0 38.0 26.4 38.0 125-129 34.401349999999994 38.0 35.4 38.0 24.8 38.0 130-134 33.824650000000005 38.0 34.2 38.0 21.6 38.0 135-139 33.25795000000001 38.0 33.0 38.0 17.0 38.0 140-144 32.5761 38.0 33.0 38.0 12.8 38.0 145-149 31.61065 38.0 32.6 38.0 5.6 38.0 150-151 25.950625000000002 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 12.0 4 6.0 5 1.0 6 6.0 7 2.0 8 3.0 9 2.0 10 7.0 11 3.0 12 5.0 13 4.0 14 3.0 15 10.0 16 3.0 17 9.0 18 7.0 19 9.0 20 11.0 21 12.0 22 13.0 23 20.0 24 21.0 25 26.0 26 28.0 27 37.0 28 43.0 29 27.0 30 62.0 31 66.0 32 91.0 33 102.0 34 158.0 35 273.0 36 555.0 37 2346.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.099999999999994 13.0 13.100000000000001 32.800000000000004 2 28.65 21.525 29.375 20.45 3 24.3 24.25 25.35 26.1 4 27.450000000000003 32.025 17.75 22.775000000000002 5 26.8 32.6 19.75 20.849999999999998 6 21.175 35.475 20.3 23.05 7 20.474999999999998 15.225 38.1 26.200000000000003 8 23.35 20.525 22.55 33.575 9 24.2 20.4 26.05 29.349999999999998 10-14 24.990000000000002 25.41 23.785 25.814999999999998 15-19 25.77 24.474999999999998 23.78 25.974999999999998 20-24 25.509999999999998 24.93 24.315 25.245 25-29 25.655 24.47 24.25 25.624999999999996 30-34 26.26 24.365000000000002 23.9 25.474999999999998 35-39 26.090000000000003 24.060000000000002 24.285 25.564999999999998 40-44 25.545 24.565 24.09 25.8 45-49 25.95 24.625 24.305 25.119999999999997 50-54 25.795 24.58 24.25 25.374999999999996 55-59 25.955000000000002 24.305 24.42 25.319999999999997 60-64 26.295 25.025 24.055 24.625 65-69 26.195 24.41 24.445 24.95 70-74 26.555 24.759999999999998 23.965 24.72 75-79 26.035000000000004 24.9 23.61 25.455 80-84 25.979999999999997 24.98 24.365000000000002 24.675 85-89 26.205000000000002 24.285 24.59 24.92 90-94 25.895000000000003 24.495 24.59 25.019999999999996 95-99 26.88 24.87 23.895 24.355 100-104 26.38 25.169999999999998 24.0 24.45 105-109 26.36 25.025 24.015 24.6 110-114 26.915 25.259999999999998 24.0 23.825 115-119 27.61 25.03 23.544999999999998 23.815 120-124 26.985 25.06 24.08 23.875 125-129 27.500000000000004 25.39 23.755000000000003 23.355 130-134 27.58 25.490000000000002 23.57 23.36 135-139 28.035 25.655 23.705000000000002 22.605 140-144 27.785 25.575 23.665 22.975 145-149 27.42 26.064999999999998 23.84 22.675 150-151 28.1875 25.75 23.3375 22.725 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 0.0 26 1.0 27 2.0 28 4.5 29 5.5 30 5.5 31 7.5 32 12.5 33 17.0 34 23.5 35 32.0 36 34.5 37 42.0 38 62.0 39 83.5 40 103.5 41 134.0 42 149.5 43 160.5 44 179.0 45 177.5 46 177.5 47 168.5 48 162.5 49 156.0 50 142.5 51 138.5 52 122.0 53 116.5 54 119.5 55 114.5 56 109.0 57 104.5 58 95.0 59 86.0 60 85.0 61 84.5 62 79.0 63 73.0 64 67.0 65 64.5 66 67.0 67 71.0 68 65.5 69 58.5 70 56.5 71 46.5 72 38.5 73 27.5 74 17.0 75 18.0 76 13.0 77 4.5 78 3.0 79 3.5 80 2.5 81 0.5 82 0.5 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.13989375158107 97.975 2 0.6071338224133569 1.2 3 0.17708069820389577 0.525 4 0.07589172780166961 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0125 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.3 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.4875 0.0 0.0 0.0 0.0 86-87 0.575 0.0 0.0 0.0 0.0 88-89 0.65 0.0 0.0 0.0 0.0 90-91 0.7875000000000001 0.0 0.0 0.0 0.0 92-93 1.025 0.0 0.0 0.0 0.0 94-95 1.25 0.0 0.0 0.0 0.0 96-97 1.4874999999999998 0.0 0.0 0.0 0.0 98-99 1.675 0.0 0.0 0.0 0.0 100-101 2.0375 0.0 0.0 0.0 0.0 102-103 2.2625 0.0 0.0 0.0 0.0 104-105 2.55 0.0 0.0 0.0 0.0 106-107 2.9125 0.0 0.0 0.0 0.0 108-109 3.2875 0.0 0.0 0.0 0.0 110-111 3.575 0.0 0.0 0.0 0.0 112-113 4.0375 0.0 0.0 0.0 0.0 114-115 4.525 0.0 0.0 0.0 0.0 116-117 5.012499999999999 0.0 0.0 0.0 0.0 118-119 5.4375 0.0 0.0 0.0 0.0 120-121 5.875 0.0 0.0 0.0 0.0 122-123 6.4375 0.0 0.0 0.0 0.0 124-125 7.0 0.0 0.0 0.0 0.0 126-127 7.45 0.0 0.0 0.0 0.0 128-129 7.8875 0.0 0.0 0.0 0.0 130-131 8.3 0.0 0.0 0.0 0.0 132-133 8.7 0.0 0.0 0.0 0.0 134-135 9.4125 0.0 0.0 0.0 0.0 136-137 10.075 0.0 0.0 0.0 0.0 138-139 10.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 20 0.00593511 29.0 120-124 >>END_MODULE Read 1404085 spots for SRR5579238.sra Written 1404085 spots for SRR5579238.sra Read 1404085 spots for SRR5579238.sra Written 1404085 spots for SRR5579238.sra Read 1404085 spots for SRR5579238.sra Written 1404085 spots for SRR5579238.sra Read 1404085 spots for SRR5579238.sra Written 1404085 spots for SRR5579238.sra Read 1404085 spots for SRR5579238.sra Written 1404085 spots for SRR5579238.sra Read 1404085 spots for SRR5579238.sra Written 1404085 spots for SRR5579238.sra Read 1404085 spots for SRR5579238.sra Written 1404085 spots for SRR5579238.sra Read 1404085 spots for SRR5579238.sra Written 1404085 spots for SRR5579238.sra Read 1404085 spots for SRR5579238.sra Written 1404085 spots for SRR5579238.sra Read 1404085 spots for SRR5579238.sra Written 1404085 spots for SRR5579238.sra Read 1404085 spots for SRR5579238.sra Written 1404085 spots for SRR5579238.sra Read 1404085 spots for SRR5579238.sra Written 1404085 spots for SRR5579238.sra Read 1404085 spots for SRR5579238.sra Written 1404085 spots for SRR5579238.sra Read 1404085 spots for SRR5579238.sra Written 1404085 spots for SRR5579238.sra Read 1404085 spots for SRR5579238.sra Written 1404085 spots for SRR5579238.sra Read 1404094 spots for SRR5579238.sra Written 1404094 spots for SRR5579238.sra Read 1404085 spots for SRR5579238.sra Written 1404085 spots for SRR5579238.sra Read 1404085 spots for SRR5579238.sra Written 1404085 spots for SRR5579238.sra Read 1404085 spots for SRR5579238.sra Written 1404085 spots for SRR5579238.sra Read 1404085 spots for SRR5579238.sra Written 1404085 spots for SRR5579238.sra SRR ids: ['SRR5579238.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_opqpa6dh SRR5579238.sra spots: 28081709 blocks: [[1, 1404085], [1404086, 2808170], [2808171, 4212255], [4212256, 5616340], [5616341, 7020425], [7020426, 8424510], [8424511, 9828595], [9828596, 11232680], [11232681, 12636765], [12636766, 14040850], [14040851, 15444935], [15444936, 16849020], [16849021, 18253105], [18253106, 19657190], [19657191, 21061275], [21061276, 22465360], [22465361, 23869445], [23869446, 25273530], [25273531, 26677615], [26677616, 28081709]] SRR5579238 file size 9494269 SRR5579238 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579238 SRR5579238_1.fastq SRR5579238_2.fastq Input file: SRR5579238_1.fastq Paired file: SRR5579238_2.fastq trimmed: SRR5579238-trimmed-pair1.fastq, SRR5579238-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 23:12:45 2024 >> started Mon Dec 9 23:13:15 2024 >> done (30.057s) 28081709 read pairs processed; of these: 54954 ( 0.20%) short read pairs filtered out after trimming by size control 57993 ( 0.21%) empty read pairs filtered out after trimming by size control 27968762 (99.60%) read pairs available; of these: 13835738 (49.47%) trimmed read pairs available after processing 14133024 (50.53%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 11 0.00% 20 5 0.00% 21 17 0.00% 22 19 0.00% 23 13 0.00% 24 21 0.00% 25 16 0.00% 26 19 0.00% 27 16 0.00% 28 19 0.00% 29 32 0.00% 30 31 0.00% 31 31 0.00% 32 29 0.00% 33 35 0.00% 34 45 0.00% 35 47 0.00% 36 51 0.00% 37 49 0.00% 38 57 0.00% 39 78 0.00% 40 74 0.00% 41 96 0.00% 42 96 0.00% 43 112 0.00% 44 107 0.00% 45 119 0.00% 46 153 0.00% 47 189 0.00% 48 187 0.00% 49 245 0.00% 50 264 0.00% 51 328 0.00% 52 364 0.00% 53 384 0.00% 54 421 0.00% 55 513 0.00% 56 585 0.00% 57 674 0.00% 58 754 0.00% 59 883 0.00% 60 949 0.00% 61 1208 0.00% 62 1328 0.00% 63 1397 0.00% 64 1531 0.01% 65 1690 0.01% 66 1967 0.01% 67 2222 0.01% 68 2570 0.01% 69 3103 0.01% 70 3479 0.01% 71 3833 0.01% 72 4303 0.02% 73 4839 0.02% 74 5352 0.02% 75 5857 0.02% 76 6611 0.02% 77 7242 0.03% 78 8106 0.03% 79 9092 0.03% 80 10513 0.04% 81 11841 0.04% 82 13150 0.05% 83 14328 0.05% 84 17591 0.06% 85 19739 0.07% 86 20438 0.07% 87 21825 0.08% 88 23043 0.08% 89 24634 0.09% 90 26617 0.10% 91 28453 0.10% 92 30649 0.11% 93 32857 0.12% 94 34989 0.13% 95 36460 0.13% 96 37953 0.14% 97 39493 0.14% 98 40468 0.14% 99 43577 0.16% 100 44817 0.16% 101 47735 0.17% 102 50246 0.18% 103 53439 0.19% 104 54875 0.20% 105 56815 0.20% 106 58385 0.21% 107 59574 0.21% 108 61586 0.22% 109 63554 0.23% 110 65991 0.24% 111 68994 0.25% 112 72211 0.26% 113 73969 0.26% 114 77382 0.28% 115 79117 0.28% 116 79663 0.28% 117 81734 0.29% 118 83167 0.30% 119 84990 0.30% 120 88143 0.32% 121 90387 0.32% 122 92871 0.33% 123 97355 0.35% 124 101131 0.36% 125 103306 0.37% 126 106008 0.38% 127 106729 0.38% 128 107981 0.39% 129 111336 0.40% 130 113638 0.41% 131 116798 0.42% 132 122558 0.44% 133 126911 0.45% 134 131673 0.47% 135 137372 0.49% 136 142304 0.51% 137 146190 0.52% 138 152757 0.55% 139 158875 0.57% 140 167256 0.60% 141 178291 0.64% 142 193366 0.69% 143 211063 0.75% 144 236781 0.85% 145 269996 0.97% 146 322214 1.15% 147 413945 1.48% 148 606826 2.17% 149 1135447 4.06% 150 5815487 20.79% 151 14133024 50.53% 27968762 reads passed initial QC criterion=sequence-density sequence-density=1.00 sequence-density-rank=1 fanout-score=2.87 fanout-score-rank=7 prefix-density=1.06 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=21 fanout-score=18.96 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=1.6 sequence=AAAATGGTATTATAATTATATAGTTGATGTCTTTTGGTCACAAGATGACCAAATTACGCATCACAAGTACAACCCCACGTCAGAAAATGGTAGAAACTTCTATTGCTTATTACAAATTCACATCGAGCCATCCGGCATGCAGTACTGGAAAATAGCGAGTACATATACTCCATGGCATCGCATCCACATCAATGGATCGATCTGTAGGGTCATCTCCATATCTGTATGTATAAGTATACGTTGTATGTATAGGAGTTAACCGGATGAGAGGACTTAGAGCTCCCATGTGTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGGTTCCGTTGGCGACGCCTTCCTTGACGAACGGGTAGGTCTTGAGGTTCTCGAGGGACACGTTCACGGCCTCCTTTTCCAAGACGGCGCATTGGTCATCGAAAGGCATGGAGGCGCACTCGGTCTGCACCTTCTTCTTGGCCGGGAACCCGATCCTGACCCAGTCCTCGACGAAG criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=3.69 fanout-score-rank=12 prefix-density=0.78 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=122.00 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=6.9 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR5579238 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 23:14:00 Started mapping on | Dec 09 23:14:00 Finished on | Dec 09 23:17:16 Mapping speed, Million of reads per hour | 513.71 Number of input reads | 27968762 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 26483822 Uniquely mapped reads % | 94.69% Average mapped length | 290.21 Number of splices: Total | 29022732 Number of splices: Annotated (sjdb) | 27389812 Number of splices: GT/AG | 28637467 Number of splices: GC/AG | 351520 Number of splices: AT/AC | 14752 Number of splices: Non-canonical | 18993 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 381624 % of reads mapped to multiple loci | 1.36% Number of reads mapped to too many loci | 54159 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.68% % of reads unmapped: other | 1.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1135769 1135769 1135769 N_multimapping 381624 381624 381624 N_noFeature 960134 25701914 1237749 N_ambiguous 597419 4061 93801 UnstrandedReadsAssigned:24926269 PositiveStrandReadsAssigned:777847 NegativeStrandReadsAssigned:25152272 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR5579238 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579238-trimmed-pair1.fastq SRR5579238-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,968,762 reads, 25,344,780 reads pseudoaligned [quant] estimated average fragment length: 255.989 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52973 SRR5579238.ke.tsv 35125 SRR5579238.se.tsv 88098 total ==> SRR5579238.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 681.685 0 0 PNS24247 1044 789.011 63.4725 4.5124 PNS24249 1928 1673.01 109.293 3.66436 PNS24246 1044 789.011 63.4725 4.5124 PNS24248 1044 789.011 63.4725 4.5124 PNS24244 1471 1216.01 122.289 5.641 PNS24243 293 103.794 0 0 KQK14069 1603 1348.01 965.597 40.1797 KQK14071 474 243.911 14.3249 3.29432 ==> SRR5579238.se.tsv <== BRADI_1g14170v3 1044 BRADI_1g53295v3 126 BRADI_1g59795v3 434 BRADI_1g07683v3 0 BRADI_1g00485v3 39 BRADI_1g20270v3 3945 BRADI_1g74790v3 265 BRADI_1g09890v3 4 BRADI_1g77505v3 359 BRADI_1g48960v3 0 SRR5579238 completed mapping pipeline successfully