Starting /dee2/code/volunteer_pipeline.sh SRR5579239 current disk space = 1523138736128 free memory = 1601572920 SRR5579239 SRAfilesize b66718976d8e46206fc4c23dae891fde SRR5579239.sra SRR5579239.sra file validated SRR5579239 is paired end SRR5579239 is conventional basespace SRR5579239 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579239_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.051 34.0 33.0 34.0 2.0 34.0 2 32.3985 34.0 33.0 34.0 28.0 34.0 3 32.69825 34.0 33.0 34.0 28.0 34.0 4 33.109 34.0 33.0 34.0 32.0 34.0 5 33.12625 34.0 33.0 34.0 32.0 34.0 6 36.866 38.0 37.0 38.0 35.0 38.0 7 37.24975 38.0 38.0 38.0 36.0 38.0 8 37.2935 38.0 38.0 38.0 37.0 38.0 9 37.4075 38.0 38.0 38.0 37.0 38.0 10-14 37.37425 38.0 38.0 38.0 37.0 38.0 15-19 37.3754 38.0 38.0 38.0 37.0 38.0 20-24 37.34025 38.0 38.0 38.0 37.0 38.0 25-29 37.286199999999994 38.0 38.0 38.0 37.0 38.0 30-34 37.28115 38.0 38.0 38.0 37.0 38.0 35-39 37.243199999999995 38.0 38.0 38.0 36.6 38.0 40-44 37.04935 38.0 38.0 38.0 36.0 38.0 45-49 36.9316 38.0 38.0 38.0 35.4 38.0 50-54 36.8712 38.0 38.0 38.0 35.0 38.0 55-59 36.81735 38.0 38.0 38.0 35.0 38.0 60-64 36.845600000000005 38.0 38.0 38.0 35.0 38.0 65-69 36.7086 38.0 38.0 38.0 34.6 38.0 70-74 36.6454 38.0 38.0 38.0 34.2 38.0 75-79 36.611399999999996 38.0 38.0 38.0 34.2 38.0 80-84 36.5868 38.0 38.0 38.0 34.0 38.0 85-89 36.39515 38.0 37.8 38.0 33.8 38.0 90-94 36.2676 38.0 37.6 38.0 33.4 38.0 95-99 36.18345 38.0 37.4 38.0 33.4 38.0 100-104 36.00925 38.0 37.0 38.0 32.6 38.0 105-109 35.951299999999996 38.0 36.8 38.0 32.2 38.0 110-114 35.8263 38.0 36.4 38.0 32.0 38.0 115-119 35.51905 38.0 36.0 38.0 31.0 38.0 120-124 35.2583 38.0 35.8 38.0 29.4 38.0 125-129 35.072950000000006 38.0 35.6 38.0 28.2 38.0 130-134 34.942150000000005 38.0 35.2 38.0 28.0 38.0 135-139 34.5028 38.0 35.0 38.0 27.0 38.0 140-144 34.1244 38.0 35.0 38.0 23.8 38.0 145-149 33.3779 38.0 34.2 38.0 18.4 38.0 150-151 29.290625 36.0 27.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 2.0 10 0.0 11 0.0 12 0.0 13 2.0 14 0.0 15 1.0 16 1.0 17 0.0 18 3.0 19 6.0 20 7.0 21 5.0 22 7.0 23 12.0 24 16.0 25 17.0 26 26.0 27 23.0 28 33.0 29 37.0 30 57.0 31 66.0 32 87.0 33 134.0 34 173.0 35 303.0 36 750.0 37 2231.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.899280575539564 11.856115107913668 10.158273381294965 36.086330935251794 2 23.625 19.0 34.925 22.45 3 21.45 23.674999999999997 24.025 30.85 4 27.275 30.349999999999998 19.7 22.675 5 25.75 32.574999999999996 22.675 19.0 6 22.05 33.45 22.025 22.475 7 17.25 19.35 42.1 21.3 8 21.6 20.45 26.075 31.874999999999996 9 20.75 20.9 29.925 28.425 10-14 23.44 26.165 24.279999999999998 26.115 15-19 23.56 25.040000000000003 25.759999999999998 25.64 20-24 23.46 25.365 25.485000000000003 25.69 25-29 23.665 25.14 25.355 25.840000000000003 30-34 23.27 26.295 24.815 25.619999999999997 35-39 24.21 25.5 24.395 25.895000000000003 40-44 23.91 25.485000000000003 24.93 25.674999999999997 45-49 24.125 25.205 24.740000000000002 25.929999999999996 50-54 24.11 25.45 24.645 25.795 55-59 23.785 25.324999999999996 24.66 26.229999999999997 60-64 23.78 25.41 25.009999999999998 25.8 65-69 23.925 25.264999999999997 25.074999999999996 25.735000000000003 70-74 23.990000000000002 25.064999999999998 25.019999999999996 25.924999999999997 75-79 24.84 25.495 24.36 25.305 80-84 23.875 25.555 24.85 25.72 85-89 23.485 25.4 25.095 26.02 90-94 24.305 25.629999999999995 24.69 25.374999999999996 95-99 24.07 25.03 25.28 25.619999999999997 100-104 24.19 25.235000000000003 24.88 25.695 105-109 24.34 24.89 25.46 25.31 110-114 24.26 25.555 24.58 25.605 115-119 24.9 25.72 24.515 24.865000000000002 120-124 24.565 25.585 24.325 25.525 125-129 25.045 24.985 24.385 25.585 130-134 24.55 25.34 24.4 25.71 135-139 24.759999999999998 25.074999999999996 24.8 25.365 140-144 24.34 24.975 24.675 26.009999999999998 145-149 23.9 26.119999999999997 24.4 25.580000000000002 150-151 24.4875 25.0375 23.9375 26.5375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 1.0 22 1.0 23 0.0 24 1.0 25 1.0 26 0.5 27 1.5 28 2.0 29 4.0 30 11.0 31 14.5 32 15.5 33 20.0 34 33.0 35 43.5 36 47.0 37 60.5 38 78.5 39 90.5 40 110.0 41 127.0 42 141.5 43 174.5 44 193.0 45 181.0 46 178.5 47 188.5 48 179.0 49 162.0 50 169.5 51 168.5 52 150.0 53 137.0 54 126.5 55 116.5 56 103.5 57 96.5 58 97.5 59 88.5 60 79.0 61 76.0 62 74.5 63 73.0 64 68.5 65 62.0 66 46.5 67 42.5 68 41.5 69 27.5 70 17.0 71 15.0 72 16.0 73 16.0 74 10.5 75 7.5 76 5.5 77 2.0 78 1.0 79 0.5 80 0.0 81 0.5 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 13.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.45 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.8 0.0 0.0 0.0 0.0 94-95 0.95 0.0 0.0 0.0 0.0 96-97 1.15 0.0 0.0 0.0 0.0 98-99 1.275 0.0 0.0 0.0 0.0 100-101 1.4375 0.0 0.0 0.0 0.0125 102-103 1.7125 0.0 0.0 0.0 0.025 104-105 1.975 0.0 0.0 0.0 0.025 106-107 2.2625 0.0 0.0 0.0 0.025 108-109 2.6 0.0 0.0 0.0 0.025 110-111 3.125 0.0 0.0 0.0 0.025 112-113 3.375 0.0 0.0 0.0 0.025 114-115 3.9124999999999996 0.0 0.0 0.0 0.025 116-117 4.4 0.0 0.0 0.0 0.025 118-119 5.074999999999999 0.0 0.0 0.0 0.025 120-121 5.5625 0.0 0.0 0.0 0.025 122-123 5.9125 0.0 0.0 0.0 0.025 124-125 6.449999999999999 0.0 0.0 0.0 0.025 126-127 6.9875 0.0 0.0 0.0 0.025 128-129 7.512499999999999 0.0 0.0 0.0 0.025 130-131 8.2 0.0 0.0 0.0 0.025 132-133 8.7375 0.0 0.0 0.0 0.025 134-135 9.425 0.0 0.0 0.0 0.025 136-137 10.15 0.0 0.0 0.0 0.025 138-139 10.8 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATCCTC 10 0.006846698 144.88751 9 >>END_MODULE SRR5579239 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579239_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5395 33.0 33.0 34.0 32.0 34.0 2 32.67875 33.0 33.0 34.0 32.0 34.0 3 32.712 34.0 33.0 34.0 32.0 34.0 4 32.63275 34.0 33.0 34.0 32.0 34.0 5 32.6375 34.0 33.0 34.0 32.0 34.0 6 36.73675 38.0 38.0 38.0 36.0 38.0 7 36.81475 38.0 38.0 38.0 36.0 38.0 8 36.7575 38.0 38.0 38.0 36.0 38.0 9 36.7565 38.0 38.0 38.0 36.0 38.0 10-14 36.7547 38.0 38.0 38.0 36.0 38.0 15-19 36.683749999999996 38.0 38.0 38.0 35.8 38.0 20-24 36.6812 38.0 38.0 38.0 35.8 38.0 25-29 36.6627 38.0 38.0 38.0 36.0 38.0 30-34 36.652950000000004 38.0 38.0 38.0 35.8 38.0 35-39 36.52595 38.0 38.0 38.0 35.0 38.0 40-44 36.57735 38.0 38.0 38.0 35.0 38.0 45-49 36.53725 38.0 38.0 38.0 35.2 38.0 50-54 36.52355000000001 38.0 38.0 38.0 35.2 38.0 55-59 36.456900000000005 38.0 38.0 38.0 34.8 38.0 60-64 36.383449999999996 38.0 38.0 38.0 34.6 38.0 65-69 36.31965 38.0 38.0 38.0 34.0 38.0 70-74 36.2178 38.0 38.0 38.0 34.0 38.0 75-79 36.1952 38.0 38.0 38.0 34.0 38.0 80-84 36.17505 38.0 38.0 38.0 33.8 38.0 85-89 36.01835 38.0 38.0 38.0 33.4 38.0 90-94 35.97025 38.0 38.0 38.0 33.4 38.0 95-99 35.810950000000005 38.0 38.0 38.0 33.0 38.0 100-104 35.587599999999995 38.0 37.6 38.0 31.8 38.0 105-109 35.47715 38.0 37.0 38.0 31.0 38.0 110-114 35.406150000000004 38.0 36.8 38.0 30.8 38.0 115-119 35.131600000000006 38.0 36.4 38.0 29.2 38.0 120-124 34.904 38.0 36.0 38.0 28.2 38.0 125-129 34.4875 38.0 35.4 38.0 26.0 38.0 130-134 33.8261 38.0 33.8 38.0 21.8 38.0 135-139 33.456900000000005 38.0 33.0 38.0 19.8 38.0 140-144 32.798700000000004 38.0 33.0 38.0 13.8 38.0 145-149 31.865850000000002 38.0 32.6 38.0 8.0 38.0 150-151 26.43175 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 28.0 3 6.0 4 2.0 5 4.0 6 1.0 7 1.0 8 2.0 9 1.0 10 3.0 11 2.0 12 2.0 13 3.0 14 3.0 15 3.0 16 8.0 17 9.0 18 3.0 19 11.0 20 10.0 21 9.0 22 10.0 23 12.0 24 15.0 25 27.0 26 18.0 27 34.0 28 51.0 29 37.0 30 56.0 31 79.0 32 102.0 33 109.0 34 161.0 35 267.0 36 575.0 37 2336.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.675 14.274999999999999 13.4 31.65 2 27.650000000000002 22.175 28.95 21.224999999999998 3 22.425 25.074999999999996 27.375 25.124999999999996 4 27.55 30.725 18.5 23.225 5 27.800000000000004 34.175 17.875 20.150000000000002 6 21.65 33.85 20.1 24.4 7 21.425 15.299999999999999 38.175 25.1 8 21.75 20.7 23.799999999999997 33.75 9 24.175 21.2 27.750000000000004 26.875 10-14 25.655 25.555 23.26 25.53 15-19 25.715 24.97 23.810000000000002 25.505 20-24 25.15 25.240000000000002 24.465 25.145 25-29 25.240000000000002 25.275 24.345 25.14 30-34 24.89 24.715 24.44 25.955000000000002 35-39 25.55 25.290000000000003 24.185000000000002 24.975 40-44 25.905 24.345 24.385 25.365 45-49 25.705 25.230000000000004 24.099999999999998 24.965 50-54 25.974999999999998 25.145 24.19 24.69 55-59 26.029999999999998 25.009999999999998 24.505 24.455 60-64 25.82 24.59 24.43 25.16 65-69 26.275 24.740000000000002 24.69 24.295 70-74 25.89 25.259999999999998 24.12 24.73 75-79 25.47 24.62 24.635 25.275 80-84 25.615 25.130000000000003 24.97 24.285 85-89 26.275 24.6 24.32 24.805 90-94 26.33 24.625 24.875 24.169999999999998 95-99 25.919999999999998 25.009999999999998 24.455 24.615000000000002 100-104 26.555 24.755 24.349999999999998 24.34 105-109 26.165 25.25 24.125 24.46 110-114 26.25 25.09 24.525 24.135 115-119 26.43 25.945 23.880000000000003 23.745 120-124 27.32 25.055 24.245 23.380000000000003 125-129 26.11 25.665 24.404999999999998 23.82 130-134 27.189999999999998 25.865 23.77 23.175 135-139 27.185 25.985000000000003 23.87 22.96 140-144 27.095000000000002 25.7 24.215 22.99 145-149 27.3 25.685000000000002 24.41 22.605 150-151 27.975 24.6 25.2125 22.2125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 0.5 26 1.0 27 3.0 28 2.5 29 2.0 30 3.5 31 5.5 32 10.0 33 12.5 34 17.5 35 24.5 36 39.5 37 60.0 38 72.0 39 83.0 40 93.0 41 108.5 42 135.0 43 160.0 44 174.0 45 177.5 46 173.0 47 182.0 48 188.5 49 161.5 50 146.5 51 160.5 52 150.0 53 133.5 54 142.0 55 130.0 56 115.5 57 112.5 58 102.0 59 103.5 60 96.0 61 83.5 62 84.5 63 79.0 64 68.5 65 62.0 66 66.0 67 61.5 68 46.0 69 36.5 70 34.5 71 28.5 72 18.0 73 15.0 74 9.5 75 7.0 76 6.5 77 3.0 78 2.0 79 1.0 80 1.0 81 1.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84966173891256 99.625 2 0.12528188423953898 0.25 3 0.0 0.0 4 0.0 0.0 5 0.025056376847907794 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.725 0.0 0.0 0.0 0.0 92-93 0.825 0.0 0.0 0.0 0.0 94-95 0.975 0.0 0.0 0.0 0.0 96-97 1.175 0.0 0.0 0.0 0.0 98-99 1.3 0.0 0.025 0.0 0.0 100-101 1.4875 0.0 0.025 0.0 0.0 102-103 1.7875 0.0 0.025 0.0 0.0 104-105 2.0375 0.0 0.025 0.0 0.0 106-107 2.325 0.0 0.025 0.0 0.0 108-109 2.675 0.0 0.025 0.0 0.0 110-111 3.2249999999999996 0.0 0.025 0.0 0.0 112-113 3.4875 0.0 0.025 0.0 0.0 114-115 4.0 0.0 0.025 0.0 0.0 116-117 4.4875 0.0 0.025 0.0 0.0 118-119 5.175000000000001 0.0 0.025 0.0 0.0 120-121 5.6625 0.0 0.025 0.0 0.0 122-123 5.9625 0.0 0.025 0.0 0.0 124-125 6.550000000000001 0.0 0.025 0.0 0.0 126-127 7.0875 0.0 0.025 0.0 0.0 128-129 7.612500000000001 0.0 0.025 0.0 0.0 130-131 8.287500000000001 0.0 0.025 0.0 0.0 132-133 8.8625 0.0 0.025 0.0 0.0 134-135 9.55 0.0 0.025 0.0 0.0 136-137 10.3 0.0 0.025 0.0 0.0 138-139 11.025 0.0 0.05 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTTTG 10 0.006830828 145.0 3 CCTCTCA 20 0.00593511 29.0 15-19 >>END_MODULE Read 1319227 spots for SRR5579239.sra Written 1319227 spots for SRR5579239.sra Read 1319227 spots for SRR5579239.sra Written 1319227 spots for SRR5579239.sra Read 1319227 spots for SRR5579239.sra Written 1319227 spots for SRR5579239.sra Read 1319227 spots for SRR5579239.sra Written 1319227 spots for SRR5579239.sra Read 1319227 spots for SRR5579239.sra Written 1319227 spots for SRR5579239.sra Read 1319227 spots for SRR5579239.sra Written 1319227 spots for SRR5579239.sra Read 1319227 spots for SRR5579239.sra Written 1319227 spots for SRR5579239.sra Read 1319227 spots for SRR5579239.sra Written 1319227 spots for SRR5579239.sra Read 1319227 spots for SRR5579239.sra Written 1319227 spots for SRR5579239.sra Read 1319239 spots for SRR5579239.sra Written 1319239 spots for SRR5579239.sra Read 1319227 spots for SRR5579239.sra Written 1319227 spots for SRR5579239.sra Read 1319227 spots for SRR5579239.sra Written 1319227 spots for SRR5579239.sra Read 1319227 spots for SRR5579239.sra Written 1319227 spots for SRR5579239.sra Read 1319227 spots for SRR5579239.sra Written 1319227 spots for SRR5579239.sra Read 1319227 spots for SRR5579239.sra Written 1319227 spots for SRR5579239.sra Read 1319227 spots for SRR5579239.sra Written 1319227 spots for SRR5579239.sra Read 1319227 spots for SRR5579239.sra Written 1319227 spots for SRR5579239.sra Read 1319227 spots for SRR5579239.sra Written 1319227 spots for SRR5579239.sra Read 1319227 spots for SRR5579239.sra Written 1319227 spots for SRR5579239.sra Read 1319227 spots for SRR5579239.sra Written 1319227 spots for SRR5579239.sra SRR ids: ['SRR5579239.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__9y3iq_f SRR5579239.sra spots: 26384552 blocks: [[1, 1319227], [1319228, 2638454], [2638455, 3957681], [3957682, 5276908], [5276909, 6596135], [6596136, 7915362], [7915363, 9234589], [9234590, 10553816], [10553817, 11873043], [11873044, 13192270], [13192271, 14511497], [14511498, 15830724], [15830725, 17149951], [17149952, 18469178], [18469179, 19788405], [19788406, 21107632], [21107633, 22426859], [22426860, 23746086], [23746087, 25065313], [25065314, 26384552]] SRR5579239 file size 8919158 SRR5579239 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579239 SRR5579239_1.fastq SRR5579239_2.fastq Input file: SRR5579239_1.fastq Paired file: SRR5579239_2.fastq trimmed: SRR5579239-trimmed-pair1.fastq, SRR5579239-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 23:13:25 2024 >> started Mon Dec 9 23:13:54 2024 >> done (29.367s) 26384552 read pairs processed; of these: 49839 ( 0.19%) short read pairs filtered out after trimming by size control 51459 ( 0.20%) empty read pairs filtered out after trimming by size control 26283254 (99.62%) read pairs available; of these: 13071365 (49.73%) trimmed read pairs available after processing 13211889 (50.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 4 0.00% 20 13 0.00% 21 9 0.00% 22 12 0.00% 23 12 0.00% 24 10 0.00% 25 17 0.00% 26 13 0.00% 27 22 0.00% 28 13 0.00% 29 20 0.00% 30 21 0.00% 31 21 0.00% 32 23 0.00% 33 29 0.00% 34 26 0.00% 35 43 0.00% 36 35 0.00% 37 29 0.00% 38 38 0.00% 39 48 0.00% 40 64 0.00% 41 63 0.00% 42 63 0.00% 43 80 0.00% 44 80 0.00% 45 109 0.00% 46 128 0.00% 47 150 0.00% 48 175 0.00% 49 213 0.00% 50 237 0.00% 51 245 0.00% 52 292 0.00% 53 320 0.00% 54 349 0.00% 55 414 0.00% 56 503 0.00% 57 548 0.00% 58 615 0.00% 59 756 0.00% 60 873 0.00% 61 930 0.00% 62 1060 0.00% 63 1253 0.00% 64 1331 0.01% 65 1577 0.01% 66 1759 0.01% 67 1976 0.01% 68 2381 0.01% 69 2754 0.01% 70 3222 0.01% 71 3577 0.01% 72 4066 0.02% 73 4492 0.02% 74 4997 0.02% 75 5411 0.02% 76 6020 0.02% 77 6822 0.03% 78 7681 0.03% 79 8845 0.03% 80 9800 0.04% 81 11026 0.04% 82 12558 0.05% 83 13730 0.05% 84 16905 0.06% 85 18693 0.07% 86 19473 0.07% 87 20677 0.08% 88 22289 0.08% 89 23525 0.09% 90 25617 0.10% 91 27724 0.11% 92 29805 0.11% 93 31981 0.12% 94 33421 0.13% 95 35188 0.13% 96 36237 0.14% 97 37723 0.14% 98 39221 0.15% 99 41359 0.16% 100 43648 0.17% 101 46122 0.18% 102 48963 0.19% 103 51144 0.19% 104 52890 0.20% 105 54968 0.21% 106 56085 0.21% 107 57128 0.22% 108 59253 0.23% 109 61312 0.23% 110 62908 0.24% 111 66374 0.25% 112 69678 0.27% 113 72124 0.27% 114 75196 0.29% 115 76844 0.29% 116 78074 0.30% 117 79683 0.30% 118 80282 0.31% 119 82420 0.31% 120 84893 0.32% 121 88631 0.34% 122 91671 0.35% 123 94981 0.36% 124 98717 0.38% 125 100627 0.38% 126 103095 0.39% 127 103715 0.39% 128 105118 0.40% 129 108368 0.41% 130 110288 0.42% 131 114311 0.43% 132 119046 0.45% 133 122880 0.47% 134 126007 0.48% 135 132891 0.51% 136 137792 0.52% 137 141423 0.54% 138 146151 0.56% 139 150563 0.57% 140 158660 0.60% 141 169640 0.65% 142 183179 0.70% 143 198626 0.76% 144 222677 0.85% 145 253303 0.96% 146 301657 1.15% 147 384879 1.46% 148 562952 2.14% 149 1052209 4.00% 150 5443469 20.71% 151 13211889 50.27% 26283254 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=4.24 fanout-score-rank=29 prefix-density=0.18 prefix-fanout=3.1 sequence=CGCTGCTGGTCCGGGGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=986.91 fanout-score-rank=1 prefix-density=0.75 prefix-fanout=29.9 sequence=CAGCAGCAGTCGGACATGGGTTCACGAAACTAAACGATGAGACGACGAAACGGAGGGCATTGACGCCGGCCGAACGAACTCGGAAGCAGAAGCAGCTTGCATCGATCTGCTTAGTAGTCGGTGGTGGGGAGCTGCTCATGG criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=2.55 fanout-score-rank=29 prefix-density=0.29 prefix-fanout=2.4 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=630.29 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=20.7 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR5579239 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 23:15:10 Started mapping on | Dec 09 23:15:11 Finished on | Dec 09 23:32:14 Mapping speed, Million of reads per hour | 92.49 Number of input reads | 26283254 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 20804689 Uniquely mapped reads % | 79.16% Average mapped length | 290.00 Number of splices: Total | 21814204 Number of splices: Annotated (sjdb) | 20591405 Number of splices: GT/AG | 21523662 Number of splices: GC/AG | 257229 Number of splices: AT/AC | 16020 Number of splices: Non-canonical | 17293 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.01% Deletion average length | 1.30 Insertion rate per base | 0.00% Insertion average length | 1.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 233568 % of reads mapped to multiple loci | 0.89% Number of reads mapped to too many loci | 12701 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 19.56% % of reads unmapped: other | 0.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5269861 5269861 5269861 N_multimapping 233568 233568 233568 N_noFeature 559391 20222829 760865 N_ambiguous 426386 2582 47565 UnstrandedReadsAssigned:19818912 PositiveStrandReadsAssigned:579278 NegativeStrandReadsAssigned:19996259 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR5579239 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579239-trimmed-pair1.fastq SRR5579239-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,283,254 reads, 20,238,876 reads pseudoaligned [quant] estimated average fragment length: 249.088 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,173 rounds 52973 SRR5579239.ke.tsv 35125 SRR5579239.se.tsv 88098 total ==> SRR5579239.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 688.469 17.5652 1.79998 PNS24247 1044 795.912 81.5555 7.22916 PNS24249 1928 1679.91 117.643 4.94061 PNS24246 1044 795.912 81.5555 7.22916 PNS24248 1044 795.912 81.5555 7.22916 PNS24244 1471 1222.91 159.125 9.17999 PNS24243 293 104.653 1 0.674135 KQK14069 1603 1354.91 6815.07 354.861 KQK14071 474 246.512 88.8445 25.4268 ==> SRR5579239.se.tsv <== BRADI_1g14170v3 7303 BRADI_1g53295v3 91 BRADI_1g59795v3 356 BRADI_1g07683v3 0 BRADI_1g00485v3 47 BRADI_1g20270v3 1222 BRADI_1g74790v3 60 BRADI_1g09890v3 0 BRADI_1g77505v3 209 BRADI_1g48960v3 2 SRR5579239 completed mapping pipeline successfully