Starting /dee2/code/volunteer_pipeline.sh SRR5579240 current disk space = 1523159498752 free memory = 1563241812 SRR5579240 SRAfilesize 27a26b5dcf9502b0436fc7cd1211cb71 SRR5579240.sra SRR5579240.sra file validated SRR5579240 is paired end SRR5579240 is conventional basespace SRR5579240 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579240_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.7805 34.0 33.0 34.0 25.0 34.0 2 32.91925 34.0 33.0 34.0 28.0 34.0 3 33.10275 34.0 33.0 34.0 32.0 34.0 4 33.303 34.0 33.0 34.0 32.0 34.0 5 33.31575 34.0 33.0 34.0 33.0 34.0 6 37.194 38.0 38.0 38.0 36.0 38.0 7 37.378 38.0 38.0 38.0 37.0 38.0 8 37.495 38.0 38.0 38.0 38.0 38.0 9 37.5045 38.0 38.0 38.0 38.0 38.0 10-14 37.503499999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.501799999999996 38.0 38.0 38.0 37.8 38.0 20-24 37.41415 38.0 38.0 38.0 37.6 38.0 25-29 37.299549999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.30650000000001 38.0 38.0 38.0 37.2 38.0 35-39 37.1422 38.0 38.0 38.0 36.6 38.0 40-44 37.09375 38.0 38.0 38.0 36.2 38.0 45-49 37.0673 38.0 38.0 38.0 36.2 38.0 50-54 37.244749999999996 38.0 38.0 38.0 36.8 38.0 55-59 37.180400000000006 38.0 38.0 38.0 36.8 38.0 60-64 37.145799999999994 38.0 38.0 38.0 36.6 38.0 65-69 36.752050000000004 38.0 38.0 38.0 35.0 38.0 70-74 36.88655000000001 38.0 38.0 38.0 35.6 38.0 75-79 36.91785 38.0 38.0 38.0 35.6 38.0 80-84 36.67755 38.0 38.0 38.0 34.4 38.0 85-89 36.62705 38.0 38.0 38.0 34.4 38.0 90-94 36.497550000000004 38.0 38.0 38.0 34.2 38.0 95-99 36.46325 38.0 38.0 38.0 34.0 38.0 100-104 36.16225 38.0 37.8 38.0 33.2 38.0 105-109 36.1339 38.0 37.8 38.0 33.6 38.0 110-114 36.0118 38.0 37.4 38.0 33.0 38.0 115-119 35.57755 38.0 36.6 38.0 30.8 38.0 120-124 35.69535 38.0 36.6 38.0 31.8 38.0 125-129 35.5018 38.0 36.0 38.0 31.0 38.0 130-134 35.15 38.0 36.0 38.0 29.0 38.0 135-139 34.96554999999999 38.0 35.2 38.0 28.0 38.0 140-144 34.670950000000005 38.0 34.8 38.0 27.4 38.0 145-149 33.73035 38.0 34.2 38.0 21.8 38.0 150-151 29.51925 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 2.0 11 1.0 12 1.0 13 1.0 14 1.0 15 2.0 16 3.0 17 2.0 18 4.0 19 3.0 20 3.0 21 4.0 22 8.0 23 5.0 24 11.0 25 16.0 26 17.0 27 27.0 28 31.0 29 33.0 30 38.0 31 69.0 32 91.0 33 104.0 34 125.0 35 241.0 36 677.0 37 2478.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.10204081632653 14.312925170068027 9.061224489795919 29.523809523809526 2 24.349999999999998 18.825 32.75 24.075 3 22.05 25.074999999999996 24.925 27.950000000000003 4 26.85 31.374999999999996 19.675 22.1 5 25.624999999999996 33.85 20.7 19.825 6 22.400000000000002 32.525 22.45 22.625 7 17.0 19.425 41.275 22.3 8 21.0 19.025 28.225 31.75 9 21.75 19.025 30.325000000000003 28.9 10-14 23.765 25.775 24.709999999999997 25.75 15-19 23.775 24.455 25.405 26.365 20-24 23.259651930386077 25.33006601320264 25.25505101020204 26.15523104620924 25-29 23.745 24.855 25.47 25.929999999999996 30-34 24.005000000000003 24.535 25.03 26.43 35-39 23.39 24.474999999999998 26.009999999999998 26.125 40-44 24.01 25.085 24.98 25.924999999999997 45-49 23.62 25.5 25.055 25.825 50-54 24.325 24.545 25.235000000000003 25.895000000000003 55-59 23.419999999999998 25.31 24.705 26.565 60-64 24.2 24.7 24.834999999999997 26.265 65-69 24.295 24.845 24.945 25.915 70-74 24.035 24.21 25.245 26.51 75-79 24.0 24.605 24.785 26.61 80-84 24.505 24.55 24.89 26.055 85-89 24.715 24.59 24.39 26.305 90-94 24.9 24.7 24.779999999999998 25.619999999999997 95-99 25.180000000000003 24.085 24.345 26.39 100-104 24.385 24.415 25.25 25.95 105-109 24.154999999999998 24.959999999999997 24.58 26.305 110-114 24.62 25.124999999999996 24.285 25.97 115-119 24.39 24.57 24.21 26.83 120-124 24.709999999999997 24.765 24.195 26.33 125-129 24.925 25.019999999999996 24.02 26.035000000000004 130-134 24.66 24.63 24.02 26.69 135-139 25.259999999999998 25.005 23.46 26.275 140-144 25.205 24.665 24.025 26.105 145-149 25.34 25.185000000000002 23.715 25.759999999999998 150-151 24.25 25.474999999999998 23.9 26.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 0.0 27 1.0 28 3.0 29 4.5 30 6.0 31 10.0 32 12.5 33 19.0 34 27.5 35 33.5 36 46.5 37 65.0 38 83.0 39 100.0 40 113.0 41 124.0 42 145.0 43 174.5 44 187.0 45 182.5 46 185.0 47 189.0 48 189.0 49 167.0 50 142.0 51 139.0 52 128.5 53 125.5 54 115.0 55 101.5 56 101.0 57 94.0 58 90.0 59 88.0 60 89.0 61 85.0 62 81.0 63 72.0 64 62.5 65 61.5 66 56.5 67 48.0 68 44.5 69 43.5 70 43.0 71 35.0 72 25.0 73 19.0 74 13.0 75 10.5 76 6.5 77 4.5 78 2.5 79 1.5 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.02 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42138364779875 98.8 2 0.5283018867924528 1.05 3 0.05031446540880503 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.3875 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.5125 0.0 0.0 0.0 0.0 84-85 0.6125 0.0 0.0 0.0 0.0 86-87 0.7125 0.0 0.0 0.0 0.0 88-89 0.8 0.0 0.0 0.0 0.0 90-91 0.9875 0.0 0.0 0.0 0.0 92-93 1.1125 0.0 0.0 0.0 0.0 94-95 1.2625000000000002 0.0 0.0 0.0 0.0 96-97 1.5 0.0 0.0 0.0 0.0 98-99 1.6375000000000002 0.0 0.0 0.0 0.0 100-101 1.8875000000000002 0.0 0.0 0.0 0.0 102-103 2.15 0.0 0.0 0.0 0.0 104-105 2.4749999999999996 0.0 0.0 0.0 0.0 106-107 2.7875 0.0 0.0 0.0 0.0 108-109 3.1 0.0 0.0 0.0 0.0 110-111 3.425 0.0 0.0 0.0 0.0 112-113 3.9124999999999996 0.0 0.0 0.0 0.0 114-115 4.425 0.0 0.0 0.0 0.0 116-117 4.9375 0.0 0.0 0.0 0.0 118-119 5.3625 0.0 0.0 0.0 0.0 120-121 5.775 0.0 0.0 0.0 0.0 122-123 6.1625 0.0 0.0 0.0 0.0 124-125 6.6 0.0 0.0 0.0 0.0 126-127 7.15 0.0 0.0 0.0 0.0 128-129 7.675 0.0 0.0 0.0 0.0 130-131 8.2375 0.0 0.0 0.0 0.0 132-133 8.925 0.0 0.0 0.0 0.0 134-135 9.4 0.0 0.0 0.0 0.0 136-137 10.0875 0.0 0.0 0.0 0.0 138-139 11.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCATTA 10 0.0068396386 144.9375 7 >>END_MODULE SRR5579240 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579240_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.69175 33.0 33.0 34.0 32.0 34.0 2 32.908 34.0 33.0 34.0 32.0 34.0 3 32.8505 34.0 33.0 34.0 32.0 34.0 4 32.77 34.0 33.0 34.0 32.0 34.0 5 32.8365 34.0 33.0 34.0 32.0 34.0 6 36.84325 38.0 38.0 38.0 36.0 38.0 7 37.082 38.0 38.0 38.0 37.0 38.0 8 36.94475 38.0 38.0 38.0 36.0 38.0 9 36.8675 38.0 38.0 38.0 36.0 38.0 10-14 36.94405 38.0 38.0 38.0 36.6 38.0 15-19 36.927550000000004 38.0 38.0 38.0 36.8 38.0 20-24 36.960049999999995 38.0 38.0 38.0 36.8 38.0 25-29 36.8576 38.0 38.0 38.0 36.2 38.0 30-34 36.868900000000004 38.0 38.0 38.0 36.2 38.0 35-39 36.93685 38.0 38.0 38.0 36.8 38.0 40-44 36.9782 38.0 38.0 38.0 37.0 38.0 45-49 36.89975 38.0 38.0 38.0 36.6 38.0 50-54 36.8179 38.0 38.0 38.0 36.0 38.0 55-59 36.70195 38.0 38.0 38.0 35.6 38.0 60-64 36.72345 38.0 38.0 38.0 36.0 38.0 65-69 36.589999999999996 38.0 38.0 38.0 35.2 38.0 70-74 36.354049999999994 38.0 38.0 38.0 34.2 38.0 75-79 36.25455 38.0 38.0 38.0 33.8 38.0 80-84 36.249700000000004 38.0 38.0 38.0 34.0 38.0 85-89 36.23345 38.0 38.0 38.0 34.0 38.0 90-94 36.25905 38.0 38.0 38.0 34.0 38.0 95-99 36.15505 38.0 38.0 38.0 33.8 38.0 100-104 35.927949999999996 38.0 38.0 38.0 33.0 38.0 105-109 35.7189 38.0 37.8 38.0 32.4 38.0 110-114 35.40685 38.0 37.0 38.0 31.4 38.0 115-119 34.995799999999996 38.0 36.0 38.0 28.8 38.0 120-124 34.3501 38.0 35.4 38.0 24.2 38.0 125-129 34.2406 38.0 35.0 38.0 23.2 38.0 130-134 34.25315 38.0 35.0 38.0 23.6 38.0 135-139 33.73415 38.0 33.8 38.0 21.8 38.0 140-144 33.09805 38.0 33.0 38.0 15.0 38.0 145-149 32.292500000000004 38.0 33.0 38.0 10.6 38.0 150-151 27.237875000000003 34.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 6.0 4 2.0 5 3.0 6 2.0 7 2.0 8 4.0 9 0.0 10 2.0 11 4.0 12 2.0 13 0.0 14 6.0 15 6.0 16 4.0 17 6.0 18 11.0 19 10.0 20 6.0 21 10.0 22 14.0 23 14.0 24 24.0 25 12.0 26 21.0 27 24.0 28 33.0 29 42.0 30 57.0 31 67.0 32 76.0 33 132.0 34 155.0 35 249.0 36 609.0 37 2374.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.511534603811434 14.894684052156471 11.058174523570711 28.535606820461386 2 28.875532181317304 21.086902078637614 28.575006260956677 21.462559479088405 3 27.29553437029604 22.854992473657802 24.560963371801304 25.288509784244855 4 28.145363408521302 31.72932330827068 17.894736842105264 22.230576441102755 5 26.546456298522415 35.18657650889056 17.781116954670672 20.485850237916353 6 22.836418209104554 34.21710855427714 18.809404702351177 24.137068534267133 7 21.85 14.799999999999999 37.375 25.974999999999998 8 22.400000000000002 20.8 23.425 33.375 9 23.517638228671505 20.765574180635475 25.11883912934701 30.597948461346007 10-14 25.81661747786504 24.971237056675506 23.220449202140962 25.99169626331849 15-19 26.08130406520326 24.14620731036552 24.196209810490522 25.576278813940696 20-24 25.591397849462368 24.356089022255563 23.77094273568392 26.281570392598148 25-29 25.845169033806766 24.26485297059412 24.00980196039208 25.880176035207043 30-34 25.99169626331849 24.62608173678155 23.59561802811265 25.786603971787304 35-39 26.01060636381829 24.474684810886533 23.454072443466078 26.0606363818291 40-44 26.26 24.485 23.599999999999998 25.655 45-49 26.665 24.21 23.805 25.319999999999997 50-54 26.732673267326735 24.74247424742474 23.577357735773578 24.947494749474945 55-59 26.43764376437644 24.552455245524552 23.397339733973396 25.61256125612561 60-64 26.662998899669898 25.03250975292588 23.60708212463739 24.69740922276683 65-69 26.07564538723234 24.00940564338603 24.204522713628176 25.710426255753454 70-74 26.52826413206603 24.062031015507753 24.18209104552276 25.227613806903452 75-79 26.067157083520993 24.831106440474404 23.845268478206474 25.256467997798126 80-84 26.71969583270799 24.18830356696183 23.76306968832858 25.328930912001603 85-89 26.30683807713471 24.521034465509477 24.01580711320094 25.15632034415487 90-94 26.44528905781156 25.1000200040008 23.509701940388076 24.944988997799562 95-99 26.74901235185278 24.36365454818223 24.268640296044406 24.618692803920588 100-104 26.914037105565836 24.993749062359356 23.488523278491773 24.60369055358304 105-109 26.48132406620331 24.891244562228113 23.84119205960298 24.7862393119656 110-114 26.810000000000002 25.19 23.330000000000002 24.67 115-119 27.320464092818565 25.63512702540508 23.6997399479896 23.344668933786757 120-124 27.185 25.25 23.61 23.955000000000002 125-129 27.58327498249475 25.207562268680604 24.007202160648195 23.201960588176455 130-134 27.630526105221044 25.33506701340268 23.78475695139028 23.249649929985996 135-139 27.125425085017003 25.8501700340068 24.23984796959392 22.784556911382275 140-144 27.671917979494875 25.641410352588146 23.220805201300326 23.465866466616657 145-149 27.431371568578427 26.356317815890794 23.761188059402972 22.451122556127807 150-151 29.15728932233058 25.818954738684667 23.13078269567392 21.892973243310827 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 1.5 26 1.0 27 1.0 28 4.0 29 4.0 30 3.5 31 8.5 32 11.5 33 16.0 34 26.0 35 29.0 36 34.5 37 46.0 38 56.5 39 64.5 40 95.5 41 118.5 42 126.5 43 154.5 44 152.5 45 165.0 46 176.0 47 166.0 48 162.0 49 159.5 50 152.0 51 136.5 52 132.5 53 119.5 54 108.5 55 110.5 56 102.5 57 91.0 58 103.0 59 105.0 60 98.0 61 98.5 62 104.5 63 102.5 64 90.5 65 79.0 66 75.5 67 72.5 68 60.5 69 59.0 70 50.0 71 37.0 72 34.5 73 30.0 74 20.5 75 15.0 76 10.0 77 6.0 78 5.0 79 1.5 80 0.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.17500000000000002 3 0.35000000000000003 4 0.25 5 0.17500000000000002 6 0.05 7 0.0 8 0.0 9 0.075 10-14 0.045 15-19 0.005 20-24 0.025 25-29 0.02 30-34 0.045 35-39 0.06 40-44 0.0 45-49 0.0 50-54 0.01 55-59 0.01 60-64 0.03 65-69 0.06 70-74 0.05 75-79 0.08499999999999999 80-84 0.055 85-89 0.045 90-94 0.02 95-99 0.015 100-104 0.015 105-109 0.005 110-114 0.0 115-119 0.02 120-124 0.0 125-129 0.03 130-134 0.02 135-139 0.02 140-144 0.025 145-149 0.005 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21677614957048 98.175 2 0.6063668519454269 1.2 3 0.15159171298635674 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025265285497726126 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAATGGCG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.3625 0.0 0.0 0.0 0.0 80-81 0.3875 0.0 0.0 0.0 0.0 82-83 0.5125 0.0 0.0 0.0 0.0 84-85 0.6125 0.0 0.0 0.0 0.0 86-87 0.7125 0.0 0.0 0.0 0.0 88-89 0.8 0.0 0.0 0.0 0.0 90-91 1.0499999999999998 0.0 0.0 0.0 0.0 92-93 1.1875 0.0 0.0 0.0 0.0 94-95 1.3375 0.0 0.0 0.0 0.0 96-97 1.5750000000000002 0.0 0.0 0.0 0.0 98-99 1.7125 0.0 0.0 0.0 0.0 100-101 1.9625 0.0 0.0 0.0 0.0 102-103 2.2375 0.0 0.0 0.0 0.0 104-105 2.6125 0.0 0.0 0.0 0.0 106-107 2.9375 0.0 0.0 0.0 0.0 108-109 3.2375 0.0 0.0 0.0 0.0 110-111 3.575 0.0 0.0 0.0 0.0 112-113 4.0875 0.0 0.0 0.0 0.0 114-115 4.5875 0.0 0.0 0.0 0.0 116-117 5.1 0.0 0.0 0.0 0.0 118-119 5.5375 0.0 0.0 0.0 0.0 120-121 6.0375 0.0 0.0 0.0 0.0 122-123 6.4375 0.0 0.0 0.0 0.0 124-125 6.8875 0.0 0.0 0.0 0.0 126-127 7.4375 0.0 0.0 0.0 0.0 128-129 7.95 0.0 0.0 0.0 0.0 130-131 8.5125 0.0 0.0 0.0 0.0 132-133 9.1625 0.0 0.0 0.0 0.0 134-135 9.675 0.0 0.0 0.0 0.0 136-137 10.425 0.0 0.0 0.0 0.0 138-139 11.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTCTGA 10 0.006830828 145.0 6 CTTCTCG 10 0.006830828 145.0 5 >>END_MODULE Read 1120238 spots for SRR5579240.sra Written 1120238 spots for SRR5579240.sra Read 1120238 spots for SRR5579240.sra Written 1120238 spots for SRR5579240.sra Read 1120238 spots for SRR5579240.sra Written 1120238 spots for SRR5579240.sra Read 1120238 spots for SRR5579240.sra Written 1120238 spots for SRR5579240.sra Read 1120238 spots for SRR5579240.sra Written 1120238 spots for SRR5579240.sra Read 1120238 spots for SRR5579240.sra Written 1120238 spots for SRR5579240.sra Read 1120238 spots for SRR5579240.sra Written 1120238 spots for SRR5579240.sra Read 1120254 spots for SRR5579240.sra Written 1120254 spots for SRR5579240.sra Read 1120238 spots for SRR5579240.sra Written 1120238 spots for SRR5579240.sra Read 1120238 spots for SRR5579240.sra Written 1120238 spots for SRR5579240.sra Read 1120238 spots for SRR5579240.sra Written 1120238 spots for SRR5579240.sra Read 1120238 spots for SRR5579240.sra Written 1120238 spots for SRR5579240.sra Read 1120238 spots for SRR5579240.sra Written 1120238 spots for SRR5579240.sra Read 1120238 spots for SRR5579240.sra Written 1120238 spots for SRR5579240.sra Read 1120238 spots for SRR5579240.sra Written 1120238 spots for SRR5579240.sra Read 1120238 spots for SRR5579240.sra Written 1120238 spots for SRR5579240.sra Read 1120238 spots for SRR5579240.sra Written 1120238 spots for SRR5579240.sra Read 1120238 spots for SRR5579240.sra Written 1120238 spots for SRR5579240.sra Read 1120238 spots for SRR5579240.sra Written 1120238 spots for SRR5579240.sra Read 1120238 spots for SRR5579240.sra Written 1120238 spots for SRR5579240.sra SRR ids: ['SRR5579240.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_64rw5a6s SRR5579240.sra spots: 22404776 blocks: [[1, 1120238], [1120239, 2240476], [2240477, 3360714], [3360715, 4480952], [4480953, 5601190], [5601191, 6721428], [6721429, 7841666], [7841667, 8961904], [8961905, 10082142], [10082143, 11202380], [11202381, 12322618], [12322619, 13442856], [13442857, 14563094], [14563095, 15683332], [15683333, 16803570], [16803571, 17923808], [17923809, 19044046], [19044047, 20164284], [20164285, 21284522], [21284523, 22404776]] SRR5579240 file size 7570543 SRR5579240 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579240 SRR5579240_1.fastq SRR5579240_2.fastq Input file: SRR5579240_1.fastq Paired file: SRR5579240_2.fastq trimmed: SRR5579240-trimmed-pair1.fastq, SRR5579240-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 23:13:22 2024 >> started Mon Dec 9 23:13:48 2024 >> done (26.486s) 22404776 read pairs processed; of these: 36786 ( 0.16%) short read pairs filtered out after trimming by size control 85580 ( 0.38%) empty read pairs filtered out after trimming by size control 22282410 (99.45%) read pairs available; of these: 11902090 (53.41%) trimmed read pairs available after processing 10380320 (46.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 23 0.00% 19 18 0.00% 20 21 0.00% 21 18 0.00% 22 28 0.00% 23 29 0.00% 24 21 0.00% 25 27 0.00% 26 26 0.00% 27 29 0.00% 28 32 0.00% 29 37 0.00% 30 33 0.00% 31 30 0.00% 32 42 0.00% 33 37 0.00% 34 43 0.00% 35 49 0.00% 36 39 0.00% 37 43 0.00% 38 55 0.00% 39 60 0.00% 40 83 0.00% 41 70 0.00% 42 105 0.00% 43 87 0.00% 44 83 0.00% 45 123 0.00% 46 150 0.00% 47 152 0.00% 48 170 0.00% 49 171 0.00% 50 207 0.00% 51 257 0.00% 52 307 0.00% 53 344 0.00% 54 348 0.00% 55 376 0.00% 56 433 0.00% 57 501 0.00% 58 571 0.00% 59 667 0.00% 60 796 0.00% 61 879 0.00% 62 990 0.00% 63 1091 0.00% 64 1172 0.01% 65 1316 0.01% 66 1537 0.01% 67 1770 0.01% 68 2029 0.01% 69 2520 0.01% 70 2885 0.01% 71 2975 0.01% 72 3319 0.01% 73 3816 0.02% 74 4134 0.02% 75 4630 0.02% 76 5117 0.02% 77 5600 0.03% 78 6245 0.03% 79 7081 0.03% 80 7862 0.04% 81 9237 0.04% 82 10199 0.05% 83 11464 0.05% 84 13943 0.06% 85 15601 0.07% 86 16184 0.07% 87 17365 0.08% 88 18624 0.08% 89 19513 0.09% 90 21787 0.10% 91 22788 0.10% 92 24391 0.11% 93 26335 0.12% 94 28064 0.13% 95 29156 0.13% 96 30563 0.14% 97 31722 0.14% 98 32919 0.15% 99 34629 0.16% 100 36390 0.16% 101 39237 0.18% 102 41524 0.19% 103 44525 0.20% 104 46420 0.21% 105 47495 0.21% 106 48731 0.22% 107 48983 0.22% 108 51065 0.23% 109 52701 0.24% 110 54196 0.24% 111 56937 0.26% 112 59380 0.27% 113 61086 0.27% 114 64487 0.29% 115 66703 0.30% 116 66727 0.30% 117 68731 0.31% 118 69015 0.31% 119 70291 0.32% 120 72761 0.33% 121 74846 0.34% 122 77090 0.35% 123 81590 0.37% 124 84230 0.38% 125 85850 0.39% 126 89384 0.40% 127 89616 0.40% 128 91017 0.41% 129 93652 0.42% 130 94051 0.42% 131 97468 0.44% 132 102069 0.46% 133 105529 0.47% 134 109561 0.49% 135 114291 0.51% 136 117274 0.53% 137 121701 0.55% 138 127354 0.57% 139 132365 0.59% 140 138098 0.62% 141 147974 0.66% 142 159595 0.72% 143 175737 0.79% 144 198027 0.89% 145 226497 1.02% 146 274913 1.23% 147 356650 1.60% 148 517437 2.32% 149 1012961 4.55% 150 5149685 23.11% 151 10380320 46.59% 22282410 reads passed initial QC criterion=sequence-density sequence-density=0.89 sequence-density-rank=1 fanout-score=2.77 fanout-score-rank=19 prefix-density=0.95 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.22 sequence-density-rank=31 fanout-score=12.10 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=4.1 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=3.93 fanout-score-rank=11 prefix-density=0.77 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=91.82 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=8.4 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR5579240 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 23:14:37 Started mapping on | Dec 09 23:14:38 Finished on | Dec 09 23:16:32 Mapping speed, Million of reads per hour | 703.66 Number of input reads | 22282410 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 21108271 Uniquely mapped reads % | 94.73% Average mapped length | 289.63 Number of splices: Total | 21979727 Number of splices: Annotated (sjdb) | 20808040 Number of splices: GT/AG | 21692108 Number of splices: GC/AG | 262252 Number of splices: AT/AC | 10429 Number of splices: Non-canonical | 14938 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 312236 % of reads mapped to multiple loci | 1.40% Number of reads mapped to too many loci | 43700 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.53% % of reads unmapped: other | 1.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 890605 890605 890605 N_multimapping 312236 312236 312236 N_noFeature 751635 20491935 949104 N_ambiguous 492081 2785 73830 UnstrandedReadsAssigned:19864555 PositiveStrandReadsAssigned:613551 NegativeStrandReadsAssigned:20085337 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR5579240 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579240-trimmed-pair1.fastq SRR5579240-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,282,410 reads, 20,203,017 reads pseudoaligned [quant] estimated average fragment length: 246.834 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,219 rounds 52973 SRR5579240.ke.tsv 35125 SRR5579240.se.tsv 88098 total ==> SRR5579240.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 690.645 0 0 PNS24247 1044 798.166 62.3231 5.43488 PNS24249 1928 1682.17 89.7604 3.71407 PNS24246 1044 798.166 62.3231 5.43488 PNS24248 1044 798.166 62.3231 5.43488 PNS24244 1471 1225.17 77.2704 4.38988 PNS24243 293 105.163 0 0 KQK14069 1603 1357.17 2637.52 135.269 KQK14071 474 248.773 95.0988 26.6077 ==> SRR5579240.se.tsv <== BRADI_1g14170v3 3084 BRADI_1g53295v3 68 BRADI_1g59795v3 729 BRADI_1g07683v3 0 BRADI_1g00485v3 31 BRADI_1g20270v3 3009 BRADI_1g74790v3 67 BRADI_1g09890v3 2 BRADI_1g77505v3 296 BRADI_1g48960v3 0 SRR5579240 completed mapping pipeline successfully