Starting /dee2/code/volunteer_pipeline.sh SRR5579241 current disk space = 1523166461952 free memory = 1566651356 SRR5579241 SRAfilesize 246da58055b83bad8cbad2fa764bc222 SRR5579241.sra SRR5579241.sra file validated SRR5579241 is paired end SRR5579241 is conventional basespace SRR5579241 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579241_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.13275 34.0 33.0 34.0 2.0 34.0 2 32.794 34.0 33.0 34.0 28.0 34.0 3 32.98775 34.0 33.0 34.0 32.0 34.0 4 33.25575 34.0 33.0 34.0 32.0 34.0 5 33.3145 34.0 33.0 34.0 33.0 34.0 6 37.20825 38.0 38.0 38.0 36.0 38.0 7 37.46775 38.0 38.0 38.0 37.0 38.0 8 37.55975 38.0 38.0 38.0 38.0 38.0 9 37.58725 38.0 38.0 38.0 38.0 38.0 10-14 37.540800000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.481849999999994 38.0 38.0 38.0 37.6 38.0 20-24 37.43705 38.0 38.0 38.0 37.4 38.0 25-29 37.3039 38.0 38.0 38.0 37.0 38.0 30-34 37.35025 38.0 38.0 38.0 37.2 38.0 35-39 37.1487 38.0 38.0 38.0 36.6 38.0 40-44 37.0793 38.0 38.0 38.0 36.4 38.0 45-49 37.12435000000001 38.0 38.0 38.0 36.2 38.0 50-54 37.2784 38.0 38.0 38.0 37.0 38.0 55-59 37.206250000000004 38.0 38.0 38.0 36.2 38.0 60-64 37.1606 38.0 38.0 38.0 36.4 38.0 65-69 36.801300000000005 38.0 38.0 38.0 35.0 38.0 70-74 36.887550000000005 38.0 38.0 38.0 35.0 38.0 75-79 36.87095000000001 38.0 38.0 38.0 35.4 38.0 80-84 36.71355 38.0 38.0 38.0 34.8 38.0 85-89 36.5938 38.0 38.0 38.0 34.4 38.0 90-94 36.5077 38.0 38.0 38.0 34.0 38.0 95-99 36.4587 38.0 38.0 38.0 34.0 38.0 100-104 36.18885 38.0 37.8 38.0 33.2 38.0 105-109 36.09759999999999 38.0 37.6 38.0 33.0 38.0 110-114 36.0601 38.0 37.4 38.0 33.0 38.0 115-119 35.5216 38.0 36.4 38.0 29.4 38.0 120-124 35.632799999999996 38.0 36.2 38.0 31.2 38.0 125-129 35.48375 38.0 36.0 38.0 31.0 38.0 130-134 35.076049999999995 38.0 35.2 38.0 28.4 38.0 135-139 34.981 38.0 35.0 38.0 28.4 38.0 140-144 34.729150000000004 38.0 34.8 38.0 28.4 38.0 145-149 33.8525 38.0 34.2 38.0 23.6 38.0 150-151 29.552875 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 3.0 13 0.0 14 1.0 15 0.0 16 3.0 17 5.0 18 3.0 19 6.0 20 5.0 21 1.0 22 7.0 23 4.0 24 8.0 25 14.0 26 11.0 27 26.0 28 25.0 29 30.0 30 59.0 31 60.0 32 85.0 33 93.0 34 166.0 35 278.0 36 672.0 37 2433.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.3342610631784 12.552184803785138 10.603952129139994 33.50960200389647 2 23.400000000000002 19.175 34.675 22.75 3 23.674999999999997 23.45 23.5 29.375 4 28.575 30.3 20.325 20.8 5 26.25 32.425 22.175 19.15 6 21.175 33.550000000000004 22.425 22.85 7 17.8 18.925 41.925000000000004 21.349999999999998 8 19.950000000000003 19.0 27.725 33.324999999999996 9 21.725 18.775 30.5 28.999999999999996 10-14 23.41 25.7 25.074999999999996 25.814999999999998 15-19 23.955000000000002 25.055 25.155 25.835 20-24 23.72093023255814 25.41135283820955 25.111277819454862 25.756439109777446 25-29 23.345 25.355 25.590000000000003 25.71 30-34 23.345 25.16 25.44 26.055 35-39 23.39 24.92 25.509999999999998 26.179999999999996 40-44 23.685000000000002 24.765 24.990000000000002 26.56 45-49 24.104999999999997 24.86 25.540000000000003 25.495 50-54 23.435 24.5 25.95 26.115 55-59 24.05 24.560000000000002 25.25 26.14 60-64 24.43 25.069999999999997 25.005 25.495 65-69 23.74 25.124999999999996 24.95 26.185000000000002 70-74 23.84 25.240000000000002 24.925 25.995 75-79 23.615 24.834999999999997 25.195 26.355 80-84 24.33 24.81 24.709999999999997 26.150000000000002 85-89 24.765 24.565 24.665 26.005 90-94 24.845 25.36 24.585 25.21 95-99 24.505 25.005 24.695 25.795 100-104 24.195 24.85 24.755 26.200000000000003 105-109 24.84 24.635 24.37 26.155 110-114 24.709999999999997 24.42 24.990000000000002 25.88 115-119 24.925 24.48 24.495 26.1 120-124 24.545 24.795 24.565 26.095000000000002 125-129 25.069999999999997 24.654999999999998 24.23 26.045 130-134 25.255 24.915000000000003 23.810000000000002 26.02 135-139 24.83 24.995 23.54 26.634999999999998 140-144 24.785 24.990000000000002 23.635 26.590000000000003 145-149 24.38 24.935 23.93 26.755000000000003 150-151 25.174999999999997 25.137500000000003 23.5125 26.174999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 1.0 25 1.5 26 3.0 27 4.0 28 4.0 29 5.0 30 11.5 31 13.5 32 16.5 33 26.0 34 38.5 35 45.0 36 48.5 37 63.0 38 80.5 39 106.5 40 127.5 41 138.0 42 153.5 43 168.0 44 184.0 45 187.0 46 176.0 47 178.0 48 162.5 49 143.5 50 143.0 51 140.5 52 121.0 53 102.5 54 103.0 55 120.5 56 119.5 57 99.0 58 95.0 59 89.0 60 81.0 61 71.0 62 73.0 63 75.5 64 63.5 65 59.0 66 59.0 67 53.0 68 45.5 69 39.0 70 34.0 71 28.0 72 24.5 73 22.0 74 16.5 75 11.5 76 7.0 77 5.5 78 4.5 79 1.5 80 0.5 81 0.0 82 1.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 10.174999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.025 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 98.88692132557551 97.725 2 1.037186946622818 2.0500000000000003 3 0.07589172780166961 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.7125 0.0 0.0 0.0 0.0 94-95 0.9125 0.0 0.0 0.0 0.0 96-97 1.1125 0.0 0.0 0.0 0.0 98-99 1.375 0.0 0.0 0.0 0.0 100-101 1.6125 0.0 0.0 0.0 0.0 102-103 1.9 0.0 0.0 0.0 0.0 104-105 2.175 0.0 0.0 0.0 0.0 106-107 2.4875 0.0 0.0 0.0 0.0 108-109 2.8125 0.0 0.0 0.0 0.0 110-111 3.125 0.0 0.0 0.0 0.0 112-113 3.425 0.0 0.0 0.0 0.0 114-115 3.75 0.0 0.0 0.0 0.0 116-117 4.2125 0.0 0.0 0.0 0.0 118-119 4.5625 0.0 0.0 0.0 0.0 120-121 5.112500000000001 0.0 0.0 0.0 0.0 122-123 5.7375 0.0 0.0 0.0 0.0 124-125 6.325 0.0 0.0 0.0 0.0 126-127 6.7875 0.0 0.0 0.0 0.0 128-129 7.5 0.0 0.0 0.0 0.0 130-131 8.2 0.0 0.0 0.0 0.0 132-133 8.774999999999999 0.0 0.0 0.0 0.0 134-135 9.6875 0.0 0.0 0.0 0.0 136-137 10.3375 0.0 0.0 0.0 0.0 138-139 11.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTTGTA 10 0.006841402 144.925 8 >>END_MODULE SRR5579241 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579241_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.787 33.0 33.0 34.0 32.0 34.0 2 32.8645 34.0 33.0 34.0 32.0 34.0 3 32.79975 34.0 33.0 34.0 32.0 34.0 4 32.712 34.0 33.0 34.0 32.0 34.0 5 32.74425 34.0 33.0 34.0 32.0 34.0 6 36.81175 38.0 38.0 38.0 36.0 38.0 7 37.02375 38.0 38.0 38.0 37.0 38.0 8 36.85425 38.0 38.0 38.0 36.0 38.0 9 36.783 38.0 38.0 38.0 36.0 38.0 10-14 36.865050000000004 38.0 38.0 38.0 36.2 38.0 15-19 36.8353 38.0 38.0 38.0 36.2 38.0 20-24 36.83365 38.0 38.0 38.0 36.6 38.0 25-29 36.74135 38.0 38.0 38.0 36.2 38.0 30-34 36.7282 38.0 38.0 38.0 36.0 38.0 35-39 36.74435 38.0 38.0 38.0 36.0 38.0 40-44 36.81635 38.0 38.0 38.0 36.4 38.0 45-49 36.73635 38.0 38.0 38.0 36.2 38.0 50-54 36.675149999999995 38.0 38.0 38.0 36.0 38.0 55-59 36.56295 38.0 38.0 38.0 35.6 38.0 60-64 36.613150000000005 38.0 38.0 38.0 36.0 38.0 65-69 36.513099999999994 38.0 38.0 38.0 35.4 38.0 70-74 36.1733 38.0 38.0 38.0 34.2 38.0 75-79 36.0814 38.0 38.0 38.0 33.6 38.0 80-84 36.13615 38.0 38.0 38.0 34.0 38.0 85-89 36.09765 38.0 38.0 38.0 34.0 38.0 90-94 36.0763 38.0 38.0 38.0 34.0 38.0 95-99 35.97279999999999 38.0 38.0 38.0 33.6 38.0 100-104 35.799 38.0 38.0 38.0 33.0 38.0 105-109 35.62765 38.0 38.0 38.0 32.6 38.0 110-114 35.1476 38.0 36.6 38.0 29.0 38.0 115-119 34.8932 38.0 36.2 38.0 28.2 38.0 120-124 34.265699999999995 38.0 35.4 38.0 23.8 38.0 125-129 34.179050000000004 38.0 35.0 38.0 22.8 38.0 130-134 34.3055 38.0 35.0 38.0 24.6 38.0 135-139 33.75895 38.0 33.8 38.0 22.0 38.0 140-144 33.23675000000001 38.0 33.0 38.0 17.0 38.0 145-149 32.452799999999996 38.0 33.0 38.0 10.6 38.0 150-151 27.269375 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 6.0 4 4.0 5 4.0 6 3.0 7 6.0 8 4.0 9 0.0 10 4.0 11 1.0 12 5.0 13 2.0 14 1.0 15 7.0 16 7.0 17 6.0 18 9.0 19 4.0 20 10.0 21 14.0 22 7.0 23 14.0 24 14.0 25 25.0 26 15.0 27 29.0 28 28.0 29 41.0 30 50.0 31 64.0 32 96.0 33 112.0 34 149.0 35 250.0 36 605.0 37 2384.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.76761093005766 14.840812233642517 13.111055402356481 29.280521433943345 2 28.57142857142857 22.030075187969924 28.1203007518797 21.278195488721803 3 23.970883534136547 25.426706827309236 25.12550200803213 25.47690763052209 4 28.145363408521302 30.576441102756892 17.969924812030076 23.308270676691727 5 27.368421052631582 33.308270676691734 18.270676691729324 21.052631578947366 6 21.19238476953908 34.4939879759519 20.541082164328657 23.772545090180362 7 20.5 16.125 37.075 26.3 8 21.925 20.849999999999998 23.849999999999998 33.375 9 25.225450901803608 21.017034068136272 25.60120240480962 28.1563126252505 10-14 25.805967160592715 25.23528233880657 23.30796956347617 25.65078093712455 15-19 25.94129706485324 23.851192559627982 24.401220061003052 25.806290314515728 20-24 26.37241655407096 24.295651303608068 23.5600260221188 25.77190612020217 25-29 26.176779550797857 25.051273072882797 23.51558201190536 25.256365364413984 30-34 26.123736109720692 25.13264591050155 23.796175793372708 24.947442186405045 35-39 25.959130521887207 25.533406791545627 23.179404988480417 25.32805769808675 40-44 26.215 24.75 23.59 25.445 45-49 26.700000000000003 24.275 24.205 24.82 50-54 26.57062825130052 24.95998399359744 23.519407763105242 24.9499799919968 55-59 26.220488195278115 24.58983593437375 24.069627851140456 25.120048019207687 60-64 25.957638575935103 24.490511241299885 24.155024785939613 25.396825396825395 65-69 26.151842948717945 24.258814102564102 24.21374198717949 25.375600961538463 70-74 26.12942001402384 24.110988680757288 24.03085244916358 25.728738856055294 75-79 25.948733353359366 24.71212576349254 23.981175528186643 25.357965354961447 80-84 26.423028785982478 24.570713391739673 24.010012515644554 24.99624530663329 85-89 26.185587660874354 25.18904301667585 23.651660073113327 24.97370924933647 90-94 26.565626250500202 24.654861944777913 23.934573829531814 24.844937975190078 95-99 26.79401910286543 25.408811321698256 23.298494774216135 24.498674801220183 100-104 26.253938090713607 24.823723558533782 24.123618542781415 24.798719807971196 105-109 26.256312815640783 24.87624381219061 23.67618380919046 25.191259562978146 110-114 27.245 25.230000000000004 23.375 24.15 115-119 26.90055552775136 25.168910464941696 24.087883489314848 23.84265051799209 120-124 26.490000000000002 24.955 24.14 24.415 125-129 27.014716187806588 25.397937731504655 23.51586745419962 24.07147862648914 130-134 27.548774387193596 25.372686343171587 23.5967983991996 23.481740870435218 135-139 27.787229783827062 25.04503602882306 23.78402722177742 23.383706965572458 140-144 27.847277822257805 25.61048839071257 23.468775020016015 23.073458767013612 145-149 28.135627125425085 26.100220044008804 23.39467893578716 22.369473894778956 150-151 28.003003003003002 26.413913913913913 23.073073073073072 22.51001001001001 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.0 24 2.0 25 2.5 26 2.5 27 2.0 28 3.5 29 4.0 30 6.5 31 14.0 32 16.0 33 13.5 34 20.5 35 33.0 36 44.0 37 53.0 38 69.5 39 84.0 40 105.0 41 128.0 42 137.0 43 150.5 44 150.0 45 153.5 46 173.0 47 165.5 48 144.0 49 149.0 50 153.5 51 146.0 52 135.0 53 119.0 54 106.5 55 101.0 56 102.0 57 97.5 58 90.5 59 89.5 60 93.0 61 91.5 62 91.5 63 91.0 64 88.0 65 88.0 66 80.0 67 66.5 68 64.0 69 59.5 70 40.5 71 40.0 72 41.5 73 29.0 74 20.5 75 15.0 76 11.0 77 6.5 78 6.0 79 5.0 80 2.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.25 3 0.4 4 0.25 5 0.25 6 0.2 7 0.0 8 0.0 9 0.2 10-14 0.12 15-19 0.005 20-24 0.08499999999999999 25-29 0.045 30-34 0.11 35-39 0.16999999999999998 40-44 0.0 45-49 0.0 50-54 0.04 55-59 0.04 60-64 0.145 65-69 0.16 70-74 0.16999999999999998 75-79 0.13 80-84 0.125 85-89 0.155 90-94 0.04 95-99 0.015 100-104 0.015 105-109 0.005 110-114 0.0 115-119 0.095 120-124 0.0 125-129 0.11 130-134 0.05 135-139 0.08 140-144 0.08 145-149 0.02 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.575 #Duplication Level Percentage of deduplicated Percentage of total 1 98.73193000253615 97.32499999999999 2 1.1666243976667512 2.3 3 0.050722799898554397 0.15 4 0.025361399949277198 0.1 5 0.025361399949277198 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATTAATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.7125 0.0 0.0 0.0 0.0 94-95 0.9125 0.0 0.0 0.0 0.0 96-97 1.125 0.0 0.0 0.0 0.0 98-99 1.4 0.0 0.0 0.0 0.0 100-101 1.6625 0.0 0.0 0.0 0.0 102-103 1.9249999999999998 0.0 0.0 0.0 0.0 104-105 2.1625 0.0 0.0 0.0 0.0 106-107 2.4625 0.0 0.0 0.0 0.0 108-109 2.8375 0.0 0.0 0.0 0.0 110-111 3.15 0.0 0.0 0.0 0.0 112-113 3.4375 0.0 0.0 0.0 0.0 114-115 3.8 0.0 0.0 0.0 0.0 116-117 4.2625 0.0 0.0 0.0 0.0 118-119 4.6 0.0 0.0 0.0 0.0 120-121 5.15 0.0 0.0 0.0 0.0 122-123 5.8125 0.0 0.0 0.0 0.0 124-125 6.3625 0.0 0.0 0.0 0.0 126-127 6.9 0.0 0.0 0.0 0.0 128-129 7.6875 0.0 0.0 0.0 0.0 130-131 8.3875 0.0 0.0 0.0 0.0 132-133 9.0 0.0 0.0 0.0 0.0 134-135 9.875 0.0 0.0 0.0 0.0 136-137 10.524999999999999 0.0 0.0 0.0 0.0 138-139 11.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1243967 spots for SRR5579241.sra Written 1243967 spots for SRR5579241.sra Read 1243967 spots for SRR5579241.sra Written 1243967 spots for SRR5579241.sra Read 1243967 spots for SRR5579241.sra Written 1243967 spots for SRR5579241.sra Read 1243967 spots for SRR5579241.sra Written 1243967 spots for SRR5579241.sra Read 1243967 spots for SRR5579241.sra Written 1243967 spots for SRR5579241.sra Read 1243967 spots for SRR5579241.sra Written 1243967 spots for SRR5579241.sra Read 1243967 spots for SRR5579241.sra Written 1243967 spots for SRR5579241.sra Read 1243967 spots for SRR5579241.sra Written 1243967 spots for SRR5579241.sra Read 1243967 spots for SRR5579241.sra Written 1243967 spots for SRR5579241.sra Read 1243967 spots for SRR5579241.sra Written 1243967 spots for SRR5579241.sra Read 1243967 spots for SRR5579241.sra Written 1243967 spots for SRR5579241.sra Read 1243967 spots for SRR5579241.sra Written 1243967 spots for SRR5579241.sra Read 1243970 spots for SRR5579241.sra Written 1243970 spots for SRR5579241.sra Read 1243967 spots for SRR5579241.sra Written 1243967 spots for SRR5579241.sra Read 1243967 spots for SRR5579241.sra Written 1243967 spots for SRR5579241.sra Read 1243967 spots for SRR5579241.sra Written 1243967 spots for SRR5579241.sra Read 1243967 spots for SRR5579241.sra Written 1243967 spots for SRR5579241.sra Read 1243967 spots for SRR5579241.sra Written 1243967 spots for SRR5579241.sra Read 1243967 spots for SRR5579241.sra Written 1243967 spots for SRR5579241.sra Read 1243967 spots for SRR5579241.sra Written 1243967 spots for SRR5579241.sra SRR ids: ['SRR5579241.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_81kc77hj SRR5579241.sra spots: 24879343 blocks: [[1, 1243967], [1243968, 2487934], [2487935, 3731901], [3731902, 4975868], [4975869, 6219835], [6219836, 7463802], [7463803, 8707769], [8707770, 9951736], [9951737, 11195703], [11195704, 12439670], [12439671, 13683637], [13683638, 14927604], [14927605, 16171571], [16171572, 17415538], [17415539, 18659505], [18659506, 19903472], [19903473, 21147439], [21147440, 22391406], [22391407, 23635373], [23635374, 24879343]] SRR5579241 file size 8409092 SRR5579241 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579241 SRR5579241_1.fastq SRR5579241_2.fastq Input file: SRR5579241_1.fastq Paired file: SRR5579241_2.fastq trimmed: SRR5579241-trimmed-pair1.fastq, SRR5579241-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 23:14:27 2024 >> started Mon Dec 9 23:15:03 2024 >> done (35.687s) 24879343 read pairs processed; of these: 39052 ( 0.16%) short read pairs filtered out after trimming by size control 97850 ( 0.39%) empty read pairs filtered out after trimming by size control 24742441 (99.45%) read pairs available; of these: 13286889 (53.70%) trimmed read pairs available after processing 11455552 (46.30%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 20 0.00% 20 25 0.00% 21 15 0.00% 22 16 0.00% 23 19 0.00% 24 31 0.00% 25 17 0.00% 26 23 0.00% 27 30 0.00% 28 31 0.00% 29 26 0.00% 30 44 0.00% 31 30 0.00% 32 29 0.00% 33 35 0.00% 34 58 0.00% 35 60 0.00% 36 53 0.00% 37 58 0.00% 38 79 0.00% 39 70 0.00% 40 77 0.00% 41 97 0.00% 42 77 0.00% 43 84 0.00% 44 104 0.00% 45 135 0.00% 46 149 0.00% 47 166 0.00% 48 205 0.00% 49 236 0.00% 50 257 0.00% 51 287 0.00% 52 334 0.00% 53 344 0.00% 54 414 0.00% 55 424 0.00% 56 511 0.00% 57 510 0.00% 58 704 0.00% 59 739 0.00% 60 876 0.00% 61 953 0.00% 62 1093 0.00% 63 1145 0.00% 64 1269 0.01% 65 1460 0.01% 66 1693 0.01% 67 1991 0.01% 68 2414 0.01% 69 3380 0.01% 70 3704 0.01% 71 3590 0.01% 72 3822 0.02% 73 4183 0.02% 74 4607 0.02% 75 5173 0.02% 76 5647 0.02% 77 5967 0.02% 78 7189 0.03% 79 8037 0.03% 80 8812 0.04% 81 9935 0.04% 82 11349 0.05% 83 12866 0.05% 84 15285 0.06% 85 16941 0.07% 86 17829 0.07% 87 19277 0.08% 88 20897 0.08% 89 22003 0.09% 90 24259 0.10% 91 26048 0.11% 92 27511 0.11% 93 29579 0.12% 94 31556 0.13% 95 33008 0.13% 96 34744 0.14% 97 35718 0.14% 98 37321 0.15% 99 39312 0.16% 100 41777 0.17% 101 44570 0.18% 102 46812 0.19% 103 50215 0.20% 104 51981 0.21% 105 53433 0.22% 106 54634 0.22% 107 55136 0.22% 108 57546 0.23% 109 59435 0.24% 110 61172 0.25% 111 64406 0.26% 112 67384 0.27% 113 69689 0.28% 114 72738 0.29% 115 75002 0.30% 116 75981 0.31% 117 77392 0.31% 118 78404 0.32% 119 80117 0.32% 120 83193 0.34% 121 85153 0.34% 122 88538 0.36% 123 92037 0.37% 124 95735 0.39% 125 98080 0.40% 126 100207 0.41% 127 101467 0.41% 128 103231 0.42% 129 105456 0.43% 130 106829 0.43% 131 109736 0.44% 132 115640 0.47% 133 119560 0.48% 134 123413 0.50% 135 128432 0.52% 136 132614 0.54% 137 136717 0.55% 138 142665 0.58% 139 148696 0.60% 140 154643 0.63% 141 165606 0.67% 142 178286 0.72% 143 194782 0.79% 144 218485 0.88% 145 251590 1.02% 146 304161 1.23% 147 391227 1.58% 148 570522 2.31% 149 1117682 4.52% 150 5735604 23.18% 151 11455552 46.30% 24742441 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=3.68 fanout-score-rank=13 prefix-density=0.74 prefix-fanout=3.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=32 fanout-score=10.43 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=3.0 sequence=GCCGGGAACGATTCCCTGCTCGACAAGGATGTCAACAATCTTCTTGCCATCAACAGTCGATTGGTAGAGGGTCTCCTCGAAGAGGATAGCACCAGAGATGTAATTTCCCAGGCCTGGTGGAGTGACAAGGAGGGTACGGTAAGCCTGGCGGTTAGCCTCAGTGTTCTCAAGGCCAATCGAGTCAAGTCTCTTTCCACAGGTAGCATTGGACTCATCCATGGCTAGGATGCCCCTTCCTGGTGATGCGATGGTATTCGCGGTCTTGACAAGTTCATCAGCGTATGCGCTGGCACGGACAACCATGGAGACGGTCATCTGCTTGGGAGTGGCAGCCTGGCGGGTGGCGCCCCATTCGGACTTCTTGGGAAGGAAAGACGATTTGAGGATAGTAGCCGAGGCCATTGTTTCTGGCTCCAAAGGCAAGAGGATCAGGTGCTACCCTCTTCTTTGACACAAGCTTGCAATTGCAG criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=4.23 fanout-score-rank=20 prefix-density=0.48 prefix-fanout=3.7 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=83.54 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=5.7 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR5579241 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 23:15:51 Started mapping on | Dec 09 23:15:51 Finished on | Dec 09 23:20:02 Mapping speed, Million of reads per hour | 354.87 Number of input reads | 24742441 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 22822309 Uniquely mapped reads % | 92.24% Average mapped length | 289.63 Number of splices: Total | 23206179 Number of splices: Annotated (sjdb) | 21819538 Number of splices: GT/AG | 22893613 Number of splices: GC/AG | 288322 Number of splices: AT/AC | 8317 Number of splices: Non-canonical | 15927 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 391861 % of reads mapped to multiple loci | 1.58% Number of reads mapped to too many loci | 64001 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.45% % of reads unmapped: other | 1.47% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1556766 1556766 1556766 N_multimapping 391861 391861 391861 N_noFeature 1030284 22083387 1273777 N_ambiguous 595896 3354 100316 UnstrandedReadsAssigned:21196129 PositiveStrandReadsAssigned:735568 NegativeStrandReadsAssigned:21448216 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR5579241 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579241-trimmed-pair1.fastq SRR5579241-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,742,441 reads, 21,566,660 reads pseudoaligned [quant] estimated average fragment length: 246.778 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,247 rounds 52973 SRR5579241.ke.tsv 35125 SRR5579241.se.tsv 88098 total ==> SRR5579241.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 690.819 0 0 PNS24247 1044 798.222 60.0148 4.82938 PNS24249 1928 1682.22 86.4857 3.30231 PNS24246 1044 798.222 60.0148 4.82938 PNS24248 1044 798.222 60.0148 4.82938 PNS24244 1471 1225.22 81.47 4.2711 PNS24243 293 105.919 0 0 KQK14069 1603 1357.22 5880.79 278.318 KQK14071 474 249.506 276.758 71.2486 ==> SRR5579241.se.tsv <== BRADI_1g14170v3 7033 BRADI_1g53295v3 114 BRADI_1g59795v3 1362 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 177 BRADI_1g74790v3 99 BRADI_1g09890v3 0 BRADI_1g77505v3 424 BRADI_1g48960v3 0 SRR5579241 completed mapping pipeline successfully