Starting /dee2/code/volunteer_pipeline.sh SRR5579242 current disk space = 1523160612864 free memory = 1569814320 SRR5579242 SRAfilesize fc56af76ea5e20062c1c25b18e4cdb42 SRR5579242.sra SRR5579242.sra file validated SRR5579242 is paired end SRR5579242 is conventional basespace SRR5579242 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579242_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.33125 34.0 33.0 34.0 31.0 34.0 2 32.83975 34.0 33.0 34.0 31.0 34.0 3 33.0535 34.0 33.0 34.0 32.0 34.0 4 33.127 34.0 33.0 34.0 32.0 34.0 5 32.98975 34.0 33.0 34.0 32.0 34.0 6 36.888 38.0 37.0 38.0 35.0 38.0 7 37.1965 38.0 38.0 38.0 36.0 38.0 8 37.32525 38.0 38.0 38.0 37.0 38.0 9 37.42825 38.0 38.0 38.0 37.0 38.0 10-14 37.3618 38.0 38.0 38.0 37.0 38.0 15-19 37.376149999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.266549999999995 38.0 38.0 38.0 36.6 38.0 25-29 37.20465 38.0 38.0 38.0 36.8 38.0 30-34 37.09305 38.0 38.0 38.0 36.2 38.0 35-39 36.818799999999996 38.0 38.0 38.0 35.4 38.0 40-44 36.8221 38.0 38.0 38.0 35.2 38.0 45-49 36.729949999999995 38.0 38.0 38.0 34.8 38.0 50-54 37.090700000000005 38.0 38.0 38.0 36.0 38.0 55-59 36.9054 38.0 38.0 38.0 35.4 38.0 60-64 36.94815 38.0 38.0 38.0 35.4 38.0 65-69 36.438100000000006 38.0 38.0 38.0 34.0 38.0 70-74 36.666 38.0 38.0 38.0 34.4 38.0 75-79 36.62525000000001 38.0 38.0 38.0 34.6 38.0 80-84 36.3791 38.0 38.0 38.0 33.8 38.0 85-89 36.533699999999996 38.0 38.0 38.0 34.0 38.0 90-94 36.2923 38.0 38.0 38.0 33.6 38.0 95-99 36.3461 38.0 38.0 38.0 34.0 38.0 100-104 35.878750000000004 38.0 37.2 38.0 32.0 38.0 105-109 35.71135 38.0 36.6 38.0 31.8 38.0 110-114 35.5642 38.0 36.4 38.0 31.4 38.0 115-119 35.26885 38.0 36.0 38.0 29.0 38.0 120-124 35.147149999999996 38.0 35.8 38.0 29.0 38.0 125-129 34.16799999999999 38.0 34.2 38.0 22.6 38.0 130-134 34.69615 38.0 34.8 38.0 26.8 38.0 135-139 34.30915 38.0 34.2 38.0 24.6 38.0 140-144 34.157599999999995 38.0 34.0 38.0 24.4 38.0 145-149 33.129200000000004 38.0 33.0 38.0 18.2 38.0 150-151 28.267625000000002 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 3.0 14 0.0 15 3.0 16 0.0 17 3.0 18 9.0 19 5.0 20 5.0 21 3.0 22 9.0 23 8.0 24 18.0 25 15.0 26 21.0 27 25.0 28 38.0 29 55.0 30 64.0 31 87.0 32 94.0 33 134.0 34 185.0 35 313.0 36 697.0 37 2204.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.496815286624205 13.402335456475583 8.253715498938428 31.84713375796178 2 22.400000000000002 19.175 34.9 23.525 3 22.125 25.374999999999996 24.725 27.775 4 28.9 30.825000000000003 19.325 20.95 5 26.376665828513957 32.159919537339704 22.00150867488056 19.461905959265778 6 21.025 33.35 23.375 22.25 7 17.25 20.724999999999998 39.95 22.075 8 19.975 20.3 28.475 31.25 9 20.925 20.974999999999998 29.875 28.225 10-14 24.125 26.169999999999998 24.26 25.445 15-19 23.91 25.779999999999998 25.155 25.155 20-24 23.44 25.645 25.590000000000003 25.324999999999996 25-29 24.17120856042802 25.411270563528177 25.401270063503173 25.016250812540626 30-34 23.86 25.629999999999995 24.95 25.56 35-39 24.03 25.495 24.975 25.5 40-44 23.62 25.580000000000002 25.085 25.715 45-49 24.115000000000002 26.25 24.560000000000002 25.074999999999996 50-54 24.265 25.619999999999997 24.825 25.290000000000003 55-59 24.235 25.374999999999996 24.990000000000002 25.4 60-64 24.38 25.205 24.755 25.66 65-69 23.89 25.130000000000003 25.069999999999997 25.91 70-74 24.37 25.705 24.425 25.5 75-79 24.68 24.59 25.009999999999998 25.72 80-84 23.965 25.535000000000004 24.94 25.56 85-89 24.745 24.575 24.759999999999998 25.919999999999998 90-94 24.57 25.369999999999997 24.865000000000002 25.195 95-99 24.7 24.88 24.740000000000002 25.679999999999996 100-104 24.685000000000002 25.41 23.94 25.965 105-109 24.8 25.455 24.785 24.959999999999997 110-114 24.545 25.480000000000004 24.51 25.465 115-119 24.732419725917776 25.27258177453236 24.442332699809942 25.55266579973992 120-124 24.7 25.335 24.310000000000002 25.655 125-129 24.401220061003052 25.531276563828193 24.34621731086554 25.721286064303218 130-134 25.169999999999998 25.974999999999998 23.31 25.545 135-139 24.362436243624362 25.85258525852585 23.737373737373737 26.047604760476045 140-144 24.268640296044406 26.073911086663 23.623543531529727 26.033905085762864 145-149 24.43599619828923 25.806612975839126 24.180881396628486 25.57650942924316 150-151 24.428053506688336 24.94061757719715 24.090511313914238 26.540817602200274 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.5 28 3.0 29 8.5 30 11.0 31 15.0 32 19.5 33 17.5 34 28.0 35 45.0 36 55.5 37 66.0 38 76.5 39 91.0 40 111.0 41 128.5 42 146.5 43 160.5 44 160.5 45 171.0 46 189.5 47 181.5 48 171.0 49 175.0 50 163.0 51 154.5 52 144.0 53 137.0 54 139.5 55 128.5 56 113.5 57 111.5 58 104.5 59 88.5 60 89.0 61 86.5 62 77.5 63 71.0 64 63.5 65 57.0 66 51.0 67 40.0 68 35.0 69 32.0 70 27.5 71 20.0 72 12.0 73 8.0 74 4.5 75 3.5 76 2.0 77 1.0 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.800000000000001 2 0.0 3 0.0 4 0.0 5 0.575 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.03 120-124 0.0 125-129 0.005 130-134 0.0 135-139 0.01 140-144 0.015 145-149 0.045 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.2625 0.0 0.0 0.0 0.0 76-77 0.30000000000000004 0.0 0.0 0.0 0.0 78-79 0.325 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.42500000000000004 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.6499999999999999 0.0 0.0 0.0 0.0 90-91 0.8 0.0 0.0 0.0 0.0 92-93 0.95 0.0 0.0 0.0 0.0 94-95 1.125 0.0 0.0 0.0 0.0 96-97 1.4625 0.0 0.0 0.0 0.0 98-99 1.675 0.0 0.0 0.0 0.0 100-101 1.9625 0.0 0.0 0.0 0.0 102-103 2.2125 0.0 0.0 0.0 0.0 104-105 2.6625 0.0 0.0 0.0 0.0 106-107 3.0625 0.0 0.0 0.0 0.0 108-109 3.425 0.0 0.0 0.0 0.0 110-111 3.8125 0.0 0.0 0.0 0.0 112-113 4.275 0.0 0.0 0.0 0.0 114-115 4.7125 0.0 0.0 0.0 0.0 116-117 5.449999999999999 0.0 0.0 0.0 0.0 118-119 5.862500000000001 0.0 0.0 0.0 0.0 120-121 6.475 0.0 0.0 0.0 0.0 122-123 7.125 0.0 0.0 0.0 0.0 124-125 7.9625 0.0 0.0 0.0 0.0 126-127 8.625 0.0 0.0 0.0 0.0 128-129 9.225 0.0 0.0 0.0 0.0 130-131 10.0125 0.0 0.0 0.0 0.0 132-133 10.875 0.0 0.0 0.0 0.0 134-135 11.8 0.0 0.0 0.0 0.0 136-137 12.45 0.0 0.0 0.0 0.0 138-139 13.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTCGT 10 0.0068378756 144.95 145 TTTTATC 10 0.0068378756 144.95 2 TGTGCTA 10 0.0068378756 144.95 7 GTGCTAC 10 0.0068378756 144.95 8 >>END_MODULE SRR5579242 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579242_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.52625 33.0 33.0 34.0 32.0 34.0 2 32.6285 33.0 33.0 34.0 32.0 34.0 3 32.74725 34.0 33.0 34.0 32.0 34.0 4 32.6525 34.0 33.0 34.0 32.0 34.0 5 32.6235 34.0 33.0 34.0 32.0 34.0 6 36.72675 38.0 38.0 38.0 35.0 38.0 7 36.7815 38.0 38.0 38.0 36.0 38.0 8 36.6435 38.0 38.0 38.0 35.0 38.0 9 36.31425 38.0 38.0 38.0 34.0 38.0 10-14 36.59695000000001 38.0 38.0 38.0 35.2 38.0 15-19 36.69945 38.0 38.0 38.0 35.8 38.0 20-24 36.670649999999995 38.0 38.0 38.0 35.8 38.0 25-29 36.50195 38.0 38.0 38.0 34.6 38.0 30-34 36.534949999999995 38.0 38.0 38.0 35.2 38.0 35-39 36.5776 38.0 38.0 38.0 35.4 38.0 40-44 36.58805 38.0 38.0 38.0 35.8 38.0 45-49 36.5576 38.0 38.0 38.0 35.6 38.0 50-54 36.49245 38.0 38.0 38.0 34.8 38.0 55-59 36.431050000000006 38.0 38.0 38.0 35.0 38.0 60-64 36.38815000000001 38.0 38.0 38.0 34.2 38.0 65-69 36.2119 38.0 38.0 38.0 33.8 38.0 70-74 35.943549999999995 38.0 38.0 38.0 32.8 38.0 75-79 35.68555 38.0 37.4 38.0 31.2 38.0 80-84 35.73375 38.0 38.0 38.0 32.0 38.0 85-89 35.76915 38.0 38.0 38.0 32.6 38.0 90-94 35.7568 38.0 38.0 38.0 32.8 38.0 95-99 35.6253 38.0 37.8 38.0 32.0 38.0 100-104 35.33305 38.0 37.0 38.0 30.6 38.0 105-109 35.226749999999996 38.0 36.8 38.0 29.8 38.0 110-114 34.786300000000004 38.0 36.0 38.0 27.4 38.0 115-119 34.5118 38.0 35.6 38.0 25.6 38.0 120-124 33.75869999999999 38.0 34.6 38.0 19.4 38.0 125-129 33.10815 38.0 33.4 38.0 16.0 38.0 130-134 33.13105 38.0 33.0 38.0 17.0 38.0 135-139 32.44185 38.0 32.8 38.0 13.0 38.0 140-144 31.735200000000003 38.0 31.8 38.0 12.6 38.0 145-149 30.188350000000003 38.0 29.4 38.0 2.0 38.0 150-151 24.6035 32.5 14.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 14.0 4 3.0 5 3.0 6 2.0 7 4.0 8 1.0 9 2.0 10 3.0 11 2.0 12 4.0 13 3.0 14 4.0 15 3.0 16 11.0 17 9.0 18 10.0 19 4.0 20 11.0 21 13.0 22 12.0 23 18.0 24 13.0 25 30.0 26 31.0 27 52.0 28 53.0 29 50.0 30 69.0 31 99.0 32 116.0 33 129.0 34 203.0 35 312.0 36 683.0 37 2007.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.95 14.399999999999999 10.65 28.999999999999996 2 25.6 21.9 30.225 22.275 3 23.799999999999997 22.55 27.700000000000003 25.95 4 28.475 30.75 17.375 23.400000000000002 5 25.85 34.5 19.275000000000002 20.375 6 21.95 33.925 20.474999999999998 23.65 7 19.375 16.55 37.15 26.924999999999997 8 20.599999999999998 21.025 25.75 32.625 9 24.575 21.075 25.1 29.25 10-14 24.555 26.145000000000003 23.27 26.029999999999998 15-19 24.905 24.404999999999998 24.445 26.245 20-24 24.545 25.305 24.834999999999997 25.314999999999998 25-29 25.495 24.63 24.925 24.95 30-34 24.975 24.79 24.235 26.0 35-39 25.324999999999996 24.86 24.82 24.995 40-44 25.564999999999998 24.85 24.404999999999998 25.180000000000003 45-49 25.395 24.169999999999998 25.014999999999997 25.419999999999998 50-54 25.629999999999995 24.255 24.905 25.21 55-59 25.11 25.095 25.064999999999998 24.73 60-64 26.029999999999998 25.03 24.705 24.235 65-69 25.180000000000003 25.224999999999998 24.62 24.975 70-74 25.755 25.135 24.665 24.445 75-79 25.445 24.63 24.965 24.959999999999997 80-84 25.845000000000002 24.765 25.074999999999996 24.315 85-89 25.965 24.465 24.335 25.235000000000003 90-94 25.795 24.495 25.169999999999998 24.54 95-99 25.685000000000002 25.15 24.995 24.169999999999998 100-104 25.94 25.395 24.725 23.94 105-109 26.035000000000004 24.495 25.165 24.305 110-114 26.435 25.290000000000003 24.23 24.044999999999998 115-119 26.185000000000002 26.135 24.205 23.474999999999998 120-124 27.169999999999998 25.28 24.08 23.47 125-129 26.884999999999998 25.47 24.285 23.36 130-134 27.474999999999998 25.869999999999997 23.785 22.869999999999997 135-139 27.63 25.56 24.22 22.59 140-144 27.810000000000002 25.785000000000004 23.97 22.435 145-149 27.900000000000002 26.055 24.115000000000002 21.93 150-151 28.237499999999997 26.375 23.3375 22.05 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 0.5 25 0.0 26 3.0 27 4.5 28 3.0 29 4.0 30 5.0 31 7.5 32 12.5 33 14.0 34 20.0 35 32.0 36 35.0 37 45.0 38 61.0 39 75.0 40 98.0 41 112.0 42 131.5 43 142.5 44 153.5 45 167.5 46 188.5 47 200.5 48 178.0 49 174.5 50 164.0 51 152.5 52 157.5 53 142.5 54 139.0 55 138.0 56 129.5 57 114.5 58 108.5 59 110.5 60 97.0 61 96.0 62 89.0 63 81.5 64 78.0 65 70.0 66 60.0 67 50.5 68 42.0 69 33.5 70 24.5 71 16.0 72 8.5 73 5.5 74 5.5 75 3.0 76 2.5 77 2.0 78 1.5 79 1.5 80 0.5 81 0.0 82 1.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74924774322969 99.45 2 0.22567703109327986 0.44999999999999996 3 0.0 0.0 4 0.025075225677031094 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.2625 0.0 0.0 0.0 0.0 76-77 0.30000000000000004 0.0 0.0 0.0 0.0 78-79 0.325 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.42500000000000004 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.6499999999999999 0.0 0.0 0.0 0.0 90-91 0.8 0.0 0.0 0.0 0.0 92-93 0.975 0.0 0.0 0.0 0.0 94-95 1.15 0.0 0.0 0.0 0.0 96-97 1.4875 0.0 0.0 0.0 0.0 98-99 1.7 0.0 0.0 0.0 0.0 100-101 1.9625 0.0 0.0 0.0 0.0 102-103 2.2375 0.0 0.0 0.0 0.0 104-105 2.7125 0.0 0.0 0.0 0.0 106-107 3.125 0.0 0.0 0.0 0.0 108-109 3.475 0.0 0.0 0.0 0.0 110-111 3.8625 0.0 0.0 0.0 0.0 112-113 4.2875 0.0 0.0 0.0 0.0 114-115 4.75 0.0 0.0 0.0 0.0 116-117 5.525 0.0 0.0 0.0 0.0 118-119 5.9625 0.0 0.0 0.0 0.0 120-121 6.525 0.0 0.0 0.0 0.0 122-123 7.175 0.0 0.0 0.0 0.0 124-125 8.0 0.0 0.0 0.0 0.0 126-127 8.649999999999999 0.0 0.0 0.0 0.0 128-129 9.2625 0.0 0.0 0.0 0.0 130-131 10.1125 0.0 0.0 0.0 0.0 132-133 11.0125 0.0 0.0 0.0 0.0 134-135 11.95 0.0 0.0 0.0 0.0 136-137 12.6375 0.0 0.0 0.0 0.0 138-139 13.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1287606 spots for SRR5579242.sra Written 1287606 spots for SRR5579242.sra Read 1287606 spots for SRR5579242.sra Written 1287606 spots for SRR5579242.sra Read 1287606 spots for SRR5579242.sra Written 1287606 spots for SRR5579242.sra Read 1287614 spots for SRR5579242.sra Written 1287614 spots for SRR5579242.sra Read 1287606 spots for SRR5579242.sra Written 1287606 spots for SRR5579242.sra Read 1287606 spots for SRR5579242.sra Written 1287606 spots for SRR5579242.sra Read 1287606 spots for SRR5579242.sra Written 1287606 spots for SRR5579242.sra Read 1287606 spots for SRR5579242.sra Written 1287606 spots for SRR5579242.sra Read 1287606 spots for SRR5579242.sra Written 1287606 spots for SRR5579242.sra Read 1287606 spots for SRR5579242.sra Written 1287606 spots for SRR5579242.sra Read 1287606 spots for SRR5579242.sra Written 1287606 spots for SRR5579242.sra Read 1287606 spots for SRR5579242.sra Written 1287606 spots for SRR5579242.sra Read 1287606 spots for SRR5579242.sra Written 1287606 spots for SRR5579242.sra Read 1287606 spots for SRR5579242.sra Written 1287606 spots for SRR5579242.sra Read 1287606 spots for SRR5579242.sra Written 1287606 spots for SRR5579242.sra Read 1287606 spots for SRR5579242.sra Written 1287606 spots for SRR5579242.sra Read 1287606 spots for SRR5579242.sra Written 1287606 spots for SRR5579242.sra Read 1287606 spots for SRR5579242.sra Written 1287606 spots for SRR5579242.sra Read 1287606 spots for SRR5579242.sra Written 1287606 spots for SRR5579242.sra Read 1287606 spots for SRR5579242.sra Written 1287606 spots for SRR5579242.sra SRR ids: ['SRR5579242.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a_76rggd SRR5579242.sra spots: 25752128 blocks: [[1, 1287606], [1287607, 2575212], [2575213, 3862818], [3862819, 5150424], [5150425, 6438030], [6438031, 7725636], [7725637, 9013242], [9013243, 10300848], [10300849, 11588454], [11588455, 12876060], [12876061, 14163666], [14163667, 15451272], [15451273, 16738878], [16738879, 18026484], [18026485, 19314090], [19314091, 20601696], [20601697, 21889302], [21889303, 23176908], [23176909, 24464514], [24464515, 25752128]] SRR5579242 file size 8704850 SRR5579242 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579242 SRR5579242_1.fastq SRR5579242_2.fastq Input file: SRR5579242_1.fastq Paired file: SRR5579242_2.fastq trimmed: SRR5579242-trimmed-pair1.fastq, SRR5579242-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 23:17:30 2024 >> started Mon Dec 9 23:19:02 2024 >> done (92.338s) 25752128 read pairs processed; of these: 53858 ( 0.21%) short read pairs filtered out after trimming by size control 75983 ( 0.30%) empty read pairs filtered out after trimming by size control 25622287 (99.50%) read pairs available; of these: 15192048 (59.29%) trimmed read pairs available after processing 10430239 (40.71%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 12 0.00% 20 19 0.00% 21 18 0.00% 22 18 0.00% 23 21 0.00% 24 22 0.00% 25 22 0.00% 26 21 0.00% 27 27 0.00% 28 22 0.00% 29 27 0.00% 30 40 0.00% 31 36 0.00% 32 52 0.00% 33 51 0.00% 34 52 0.00% 35 64 0.00% 36 57 0.00% 37 67 0.00% 38 87 0.00% 39 91 0.00% 40 111 0.00% 41 105 0.00% 42 110 0.00% 43 138 0.00% 44 178 0.00% 45 164 0.00% 46 205 0.00% 47 255 0.00% 48 310 0.00% 49 335 0.00% 50 363 0.00% 51 436 0.00% 52 424 0.00% 53 458 0.00% 54 543 0.00% 55 602 0.00% 56 757 0.00% 57 799 0.00% 58 960 0.00% 59 1117 0.00% 60 1289 0.01% 61 1390 0.01% 62 1695 0.01% 63 1866 0.01% 64 1991 0.01% 65 2156 0.01% 66 2505 0.01% 67 2828 0.01% 68 3313 0.01% 69 4293 0.02% 70 4632 0.02% 71 4976 0.02% 72 5432 0.02% 73 6180 0.02% 74 6794 0.03% 75 7417 0.03% 76 8053 0.03% 77 8908 0.03% 78 10158 0.04% 79 11374 0.04% 80 12755 0.05% 81 14560 0.06% 82 16071 0.06% 83 18153 0.07% 84 21716 0.08% 85 23416 0.09% 86 24864 0.10% 87 26427 0.10% 88 27251 0.11% 89 29113 0.11% 90 31562 0.12% 91 33630 0.13% 92 36156 0.14% 93 39076 0.15% 94 41310 0.16% 95 42911 0.17% 96 43933 0.17% 97 45940 0.18% 98 47387 0.18% 99 50248 0.20% 100 53357 0.21% 101 55198 0.22% 102 58084 0.23% 103 60845 0.24% 104 62799 0.25% 105 65783 0.26% 106 66955 0.26% 107 68199 0.27% 108 70396 0.27% 109 71722 0.28% 110 73960 0.29% 111 77857 0.30% 112 80649 0.31% 113 83753 0.33% 114 86813 0.34% 115 89083 0.35% 116 90138 0.35% 117 92576 0.36% 118 92892 0.36% 119 94339 0.37% 120 97403 0.38% 121 100123 0.39% 122 103758 0.40% 123 108333 0.42% 124 111873 0.44% 125 114417 0.45% 126 117512 0.46% 127 119639 0.47% 128 119852 0.47% 129 123594 0.48% 130 125888 0.49% 131 128524 0.50% 132 135578 0.53% 133 139788 0.55% 134 145394 0.57% 135 153099 0.60% 136 159134 0.62% 137 164025 0.64% 138 171361 0.67% 139 179657 0.70% 140 190779 0.74% 141 206129 0.80% 142 230088 0.90% 143 240349 0.94% 144 275282 1.07% 145 316908 1.24% 146 378586 1.48% 147 508832 1.99% 148 697824 2.72% 149 1318247 5.14% 150 5981739 23.35% 151 10430239 40.71% 25622287 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=5.15 fanout-score-rank=24 prefix-density=0.17 prefix-fanout=4.2 sequence=GTGATGGTCTTGCC criterion=fanout-score sequence-density=0.03 sequence-density-rank=30 fanout-score=910.72 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=31.5 sequence=CAGCAGCAGTCGGACATGGGTTCACGAAACTAAACGATGAGACGACGAAACGGAGGGCATTGACGCCGGCCGAACGAACTCGGAAGCAGAAGCAGCTTGCATCGATCTGCTTAGTAGTCGGTGGTGGGGAGCTGCTCATGG criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=30 prefix-density=0.29 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=687.56 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=20.9 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR5579242 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 23:20:30 Started mapping on | Dec 09 23:20:30 Finished on | Dec 09 23:47:52 Mapping speed, Million of reads per hour | 56.18 Number of input reads | 25622287 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 18630930 Uniquely mapped reads % | 72.71% Average mapped length | 287.26 Number of splices: Total | 19261471 Number of splices: Annotated (sjdb) | 18204981 Number of splices: GT/AG | 19004957 Number of splices: GC/AG | 227087 Number of splices: AT/AC | 13544 Number of splices: Non-canonical | 15883 Mismatch rate per base, % | 0.14% Deletion rate per base | 0.01% Deletion average length | 1.33 Insertion rate per base | 0.00% Insertion average length | 1.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 198164 % of reads mapped to multiple loci | 0.77% Number of reads mapped to too many loci | 10441 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 26.14% % of reads unmapped: other | 0.33% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 6821950 6821950 6821950 N_multimapping 198164 198164 198164 N_noFeature 562952 18047669 797055 N_ambiguous 390318 2309 42938 UnstrandedReadsAssigned:17677660 PositiveStrandReadsAssigned:580952 NegativeStrandReadsAssigned:17790937 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=145 echo kmer=141 SRR5579242 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579242-trimmed-pair1.fastq SRR5579242-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,622,287 reads, 18,056,408 reads pseudoaligned [quant] estimated average fragment length: 234.266 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,077 rounds 52973 SRR5579242.ke.tsv 35125 SRR5579242.se.tsv 88098 total ==> SRR5579242.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 703.227 17.5284 2.03389 PNS24247 1044 810.734 58.9599 5.93416 PNS24249 1928 1694.73 87.73 4.22403 PNS24246 1044 810.734 58.9599 5.93416 PNS24248 1044 810.734 58.9599 5.93416 PNS24244 1471 1237.73 215.862 14.2308 PNS24243 293 109.161 0 0 KQK14069 1603 1369.73 7052.26 420.119 KQK14071 474 257.903 99.6363 31.524 ==> SRR5579242.se.tsv <== BRADI_1g14170v3 7780 BRADI_1g53295v3 79 BRADI_1g59795v3 361 BRADI_1g07683v3 0 BRADI_1g00485v3 59 BRADI_1g20270v3 906 BRADI_1g74790v3 54 BRADI_1g09890v3 1 BRADI_1g77505v3 163 BRADI_1g48960v3 0 SRR5579242 completed mapping pipeline successfully