Starting /dee2/code/volunteer_pipeline.sh SRR5579243 current disk space = 1523028647936 free memory = 1420414856 SRR5579243 SRAfilesize 623dbd9b4391099afa50e40f41342345 SRR5579243.sra SRR5579243.sra file validated SRR5579243 is paired end SRR5579243 is conventional basespace SRR5579243 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579243_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.13025 34.0 33.0 34.0 28.0 34.0 2 32.789 34.0 33.0 34.0 28.0 34.0 3 32.935 34.0 33.0 34.0 32.0 34.0 4 33.071 34.0 33.0 34.0 32.0 34.0 5 33.018 34.0 33.0 34.0 32.0 34.0 6 36.82725 38.0 37.0 38.0 35.0 38.0 7 37.1525 38.0 38.0 38.0 36.0 38.0 8 37.323 38.0 38.0 38.0 37.0 38.0 9 37.39775 38.0 38.0 38.0 37.0 38.0 10-14 37.2856 38.0 38.0 38.0 36.8 38.0 15-19 37.300250000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.2145 38.0 38.0 38.0 36.6 38.0 25-29 37.0741 38.0 38.0 38.0 36.2 38.0 30-34 36.916 38.0 38.0 38.0 35.6 38.0 35-39 36.6997 38.0 38.0 38.0 34.8 38.0 40-44 36.68895 38.0 38.0 38.0 34.4 38.0 45-49 36.58285 38.0 38.0 38.0 34.0 38.0 50-54 37.0162 38.0 38.0 38.0 36.0 38.0 55-59 36.8371 38.0 38.0 38.0 35.0 38.0 60-64 36.882099999999994 38.0 38.0 38.0 35.4 38.0 65-69 36.2581 38.0 38.0 38.0 32.6 38.0 70-74 36.54615 38.0 38.0 38.0 34.0 38.0 75-79 36.4816 38.0 38.0 38.0 33.8 38.0 80-84 36.24400000000001 38.0 38.0 38.0 33.2 38.0 85-89 36.3526 38.0 38.0 38.0 33.8 38.0 90-94 36.205200000000005 38.0 38.0 38.0 33.6 38.0 95-99 36.16735 38.0 38.0 38.0 33.4 38.0 100-104 35.69395 38.0 36.8 38.0 30.8 38.0 105-109 35.62564999999999 38.0 36.8 38.0 30.8 38.0 110-114 35.31465 38.0 36.0 38.0 29.4 38.0 115-119 35.0535 38.0 35.4 38.0 27.6 38.0 120-124 34.897000000000006 38.0 35.0 38.0 27.2 38.0 125-129 33.94815 38.0 33.8 38.0 22.2 38.0 130-134 34.38145 38.0 34.6 38.0 24.6 38.0 135-139 34.041 38.0 34.0 38.0 22.8 38.0 140-144 33.948350000000005 38.0 33.6 38.0 23.6 38.0 145-149 33.030649999999994 38.0 33.0 38.0 18.2 38.0 150-151 28.161 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 2.0 14 3.0 15 1.0 16 4.0 17 3.0 18 7.0 19 5.0 20 4.0 21 9.0 22 8.0 23 13.0 24 17.0 25 24.0 26 28.0 27 39.0 28 49.0 29 44.0 30 68.0 31 70.0 32 109.0 33 138.0 34 193.0 35 293.0 36 729.0 37 2137.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.99359316604378 13.400961025093434 9.289909236518954 33.31553657234384 2 24.9 19.475 32.824999999999996 22.8 3 22.8 26.325 22.625 28.249999999999996 4 26.85 32.35 19.225 21.575 5 25.70210631895687 33.07422266800401 21.76529588766299 19.45837512537613 6 20.150000000000002 33.575 22.55 23.724999999999998 7 17.65 20.4 41.225 20.724999999999998 8 21.675 19.025 27.875 31.424999999999997 9 21.25 19.85 30.55 28.349999999999998 10-14 23.465 25.605 24.505 26.424999999999997 15-19 23.645 25.019999999999996 25.09 26.245 20-24 23.57 25.35 24.735 26.345000000000002 25-29 24.23984796959392 24.524904980996197 25.0750150030006 26.16023204640928 30-34 24.075 24.515 25.679999999999996 25.729999999999997 35-39 23.71 24.875 25.064999999999998 26.35 40-44 23.895 25.055 25.135 25.915 45-49 23.765 24.455 25.369999999999997 26.41 50-54 24.47 24.92 24.62 25.990000000000002 55-59 24.32 24.485 25.25 25.945 60-64 24.14 24.490000000000002 24.82 26.55 65-69 24.665 24.47 24.610000000000003 26.255 70-74 24.335 24.785 24.39 26.490000000000002 75-79 24.19 24.8 24.740000000000002 26.27 80-84 24.585 24.585 24.575 26.255 85-89 24.955 24.265 24.265 26.515 90-94 24.84 24.62 24.73 25.81 95-99 24.72 24.295 24.834999999999997 26.150000000000002 100-104 25.03 24.845 24.884999999999998 25.240000000000002 105-109 24.325 24.715 24.295 26.665 110-114 25.135 24.490000000000002 23.89 26.484999999999996 115-119 24.93998799759952 26.22024404880976 23.6747349469894 25.165033006601323 120-124 25.009999999999998 25.055 23.77 26.165 125-129 25.118767815172276 24.90373556033405 23.758563784567684 26.21893283992599 130-134 24.6 25.455 23.544999999999998 26.400000000000002 135-139 24.892467740322097 25.547664299289785 23.196959087726317 26.3629088726618 140-144 24.86497299459892 25.10502100420084 23.854770954190837 26.175235047009405 145-149 24.8224112056028 24.947473736868435 23.866933466733368 26.3631815907954 150-151 24.793698424606152 25.11877969492373 24.031007751937985 26.056514128532132 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.5 27 1.5 28 3.0 29 5.0 30 8.5 31 12.0 32 15.0 33 22.5 34 30.0 35 34.5 36 42.0 37 54.5 38 76.5 39 97.5 40 106.5 41 130.5 42 153.5 43 168.0 44 193.0 45 189.5 46 179.5 47 190.5 48 183.0 49 166.0 50 154.5 51 145.5 52 131.0 53 111.0 54 96.0 55 99.0 56 114.0 57 102.0 58 83.5 59 81.5 60 85.0 61 82.5 62 74.5 63 67.0 64 59.0 65 52.0 66 50.5 67 51.0 68 48.0 69 44.5 70 38.5 71 37.0 72 34.0 73 26.0 74 20.0 75 14.5 76 14.0 77 9.0 78 3.5 79 3.0 80 1.5 81 1.5 82 0.5 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.35 2 0.0 3 0.0 4 0.0 5 0.3 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.02 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.02 120-124 0.0 125-129 0.015 130-134 0.0 135-139 0.03 140-144 0.02 145-149 0.05 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44640161046804 98.8 2 0.4781077000503271 0.95 3 0.050327126321087066 0.15 4 0.025163563160543533 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.025 0.0 0.0 10-11 0.0 0.0 0.025 0.0 0.0 12-13 0.0 0.0 0.025 0.0 0.0 14-15 0.0 0.0 0.025 0.0 0.0 16-17 0.0 0.0 0.025 0.0 0.0 18-19 0.0 0.0 0.025 0.0 0.0 20-21 0.0 0.0 0.025 0.0 0.0 22-23 0.0 0.0 0.025 0.0 0.0 24-25 0.0 0.0 0.025 0.0 0.0 26-27 0.0 0.0 0.025 0.0 0.0 28-29 0.0 0.0 0.025 0.0 0.0 30-31 0.0 0.0 0.025 0.0 0.0 32-33 0.0 0.0 0.025 0.0 0.0 34-35 0.0 0.0 0.025 0.0 0.0 36-37 0.0 0.0 0.025 0.0 0.0 38-39 0.0 0.0 0.025 0.0 0.0 40-41 0.0 0.0 0.025 0.0 0.0 42-43 0.0 0.0 0.025 0.0 0.0 44-45 0.0 0.0 0.025 0.0 0.0 46-47 0.0 0.0 0.025 0.0 0.0 48-49 0.0 0.0 0.025 0.0 0.0 50-51 0.0 0.0 0.025 0.0 0.0 52-53 0.0 0.0 0.025 0.0 0.0 54-55 0.0 0.0 0.025 0.0 0.0 56-57 0.0 0.0 0.025 0.0 0.0 58-59 0.0 0.0 0.025 0.0 0.0 60-61 0.0 0.0 0.025 0.0 0.0 62-63 0.025 0.0 0.025 0.0 0.0 64-65 0.025 0.0 0.025 0.0 0.0 66-67 0.05 0.0 0.025 0.0 0.0 68-69 0.1 0.0 0.025 0.0 0.0 70-71 0.1 0.0 0.025 0.0 0.0 72-73 0.1625 0.0 0.025 0.0 0.0 74-75 0.21250000000000002 0.0 0.025 0.0 0.0 76-77 0.2375 0.0 0.025 0.0 0.0 78-79 0.2875 0.0 0.025 0.0 0.0 80-81 0.35 0.0 0.025 0.0 0.0 82-83 0.4625 0.0 0.025 0.0 0.0 84-85 0.625 0.0 0.025 0.0 0.0 86-87 0.7625 0.0 0.025 0.0 0.0 88-89 0.925 0.0 0.025 0.0 0.0 90-91 1.1 0.0 0.025 0.0 0.0 92-93 1.325 0.0 0.025 0.0 0.0 94-95 1.575 0.0 0.025 0.0 0.0 96-97 1.8375 0.0 0.025 0.0 0.0 98-99 2.25 0.0 0.025 0.0 0.0 100-101 2.5 0.0 0.025 0.0 0.0 102-103 2.8875 0.0 0.025 0.0 0.0 104-105 3.325 0.0 0.025 0.0 0.0 106-107 3.7625 0.0 0.025 0.0 0.0 108-109 4.4625 0.0 0.025 0.0 0.0 110-111 5.2375 0.0 0.025 0.0 0.0 112-113 5.75 0.0 0.025 0.0 0.0 114-115 6.275 0.0 0.025 0.0 0.0 116-117 6.925 0.0 0.025 0.0 0.0 118-119 7.5375 0.0 0.025 0.0 0.0 120-121 8.075 0.0 0.025 0.0 0.0 122-123 8.649999999999999 0.0 0.025 0.0 0.0 124-125 9.2 0.0 0.025 0.0 0.0 126-127 9.9375 0.0 0.025 0.0 0.0 128-129 10.6375 0.0 0.025 0.0 0.0 130-131 11.337499999999999 0.0 0.025 0.0 0.0 132-133 12.025 0.0 0.025 0.0 0.0 134-135 12.787500000000001 0.0 0.025 0.0 0.0 136-137 13.375 0.0 0.025 0.0 0.0 138-139 13.975000000000001 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5579243 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579243_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.48925 33.0 33.0 34.0 32.0 34.0 2 32.605 33.0 33.0 34.0 32.0 34.0 3 32.711 34.0 33.0 34.0 32.0 34.0 4 32.60575 34.0 33.0 34.0 32.0 34.0 5 32.7135 34.0 33.0 34.0 32.0 34.0 6 36.7015 38.0 38.0 38.0 35.0 38.0 7 36.75275 38.0 38.0 38.0 35.0 38.0 8 36.639 38.0 38.0 38.0 35.0 38.0 9 36.23675 38.0 38.0 38.0 33.0 38.0 10-14 36.57875 38.0 38.0 38.0 34.6 38.0 15-19 36.72995 38.0 38.0 38.0 35.4 38.0 20-24 36.641949999999994 38.0 38.0 38.0 35.2 38.0 25-29 36.46785 38.0 38.0 38.0 34.6 38.0 30-34 36.5627 38.0 38.0 38.0 34.6 38.0 35-39 36.66225 38.0 38.0 38.0 35.2 38.0 40-44 36.6466 38.0 38.0 38.0 35.2 38.0 45-49 36.631099999999996 38.0 38.0 38.0 35.4 38.0 50-54 36.5154 38.0 38.0 38.0 35.0 38.0 55-59 36.47095 38.0 38.0 38.0 34.8 38.0 60-64 36.450450000000004 38.0 38.0 38.0 34.4 38.0 65-69 36.209500000000006 38.0 38.0 38.0 33.6 38.0 70-74 35.7868 38.0 38.0 38.0 31.8 38.0 75-79 35.59535 38.0 37.4 38.0 30.2 38.0 80-84 35.7216 38.0 38.0 38.0 31.6 38.0 85-89 35.75805 38.0 38.0 38.0 32.2 38.0 90-94 35.77545 38.0 38.0 38.0 32.8 38.0 95-99 35.7279 38.0 37.8 38.0 32.4 38.0 100-104 35.3565 38.0 37.0 38.0 29.8 38.0 105-109 35.1383 38.0 36.4 38.0 29.0 38.0 110-114 34.587399999999995 38.0 35.2 38.0 25.2 38.0 115-119 34.32365 38.0 35.0 38.0 23.6 38.0 120-124 33.5303 38.0 34.6 38.0 18.6 38.0 125-129 32.9171 38.0 33.2 38.0 15.8 38.0 130-134 32.8005 38.0 32.8 38.0 14.2 38.0 135-139 32.1557 38.0 32.2 38.0 13.0 38.0 140-144 31.2548 38.0 30.8 38.0 8.6 38.0 145-149 29.746099999999995 37.6 28.0 38.0 2.0 38.0 150-151 24.3205 32.5 13.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 4.0 4 4.0 5 2.0 6 5.0 7 5.0 8 3.0 9 2.0 10 3.0 11 3.0 12 9.0 13 3.0 14 4.0 15 2.0 16 6.0 17 12.0 18 4.0 19 11.0 20 10.0 21 15.0 22 12.0 23 20.0 24 26.0 25 33.0 26 36.0 27 51.0 28 38.0 29 55.0 30 78.0 31 108.0 32 123.0 33 162.0 34 230.0 35 332.0 36 656.0 37 1921.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.55 14.774999999999999 10.9 30.775000000000002 2 27.975 22.175 28.4 21.45 3 25.2 24.5 24.9 25.4 4 28.9 30.85 17.825 22.425 5 28.9 32.225 17.599999999999998 21.275 6 21.875 34.050000000000004 20.05 24.025 7 21.75 14.399999999999999 38.0 25.85 8 22.575 20.375 22.45 34.599999999999994 9 24.224999999999998 19.775000000000002 26.85 29.15 10-14 25.595000000000002 24.91 23.369999999999997 26.125 15-19 26.55 24.035 23.79 25.624999999999996 20-24 26.064999999999998 24.69 23.61 25.635 25-29 26.115 24.725 23.595 25.564999999999998 30-34 26.490000000000002 24.395 23.18 25.935000000000002 35-39 25.715 25.335 23.615 25.335 40-44 26.200000000000003 24.825 23.580000000000002 25.395 45-49 26.674999999999997 23.849999999999998 23.635 25.840000000000003 50-54 26.369999999999997 25.019999999999996 23.549999999999997 25.06 55-59 26.355 24.490000000000002 23.849999999999998 25.305 60-64 25.88 24.555 23.935000000000002 25.629999999999995 65-69 26.86 24.93 23.5 24.709999999999997 70-74 26.235000000000003 23.919999999999998 23.73 26.115 75-79 25.865 24.535 23.669999999999998 25.929999999999996 80-84 26.305 24.6 23.97 25.124999999999996 85-89 26.525 24.535 23.599999999999998 25.34 90-94 26.150000000000002 25.080000000000002 23.59 25.180000000000003 95-99 26.995 24.51 23.94 24.555 100-104 26.56 24.759999999999998 23.98 24.7 105-109 26.855 24.94 23.98 24.224999999999998 110-114 26.650000000000002 25.374999999999996 23.26 24.715 115-119 27.284999999999997 25.674999999999997 23.055 23.985 120-124 28.244999999999997 25.135 22.98 23.64 125-129 27.834999999999997 25.535000000000004 23.62 23.01 130-134 27.925 25.314999999999998 23.41 23.35 135-139 28.255000000000003 25.635 23.515 22.595000000000002 140-144 28.08 26.08 23.395 22.445 145-149 28.645 25.695 23.34 22.32 150-151 28.9125 25.5625 23.5375 21.987499999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 1.5 22 1.5 23 0.0 24 0.5 25 0.5 26 0.0 27 1.5 28 3.0 29 2.5 30 4.0 31 9.5 32 11.5 33 16.0 34 22.5 35 24.5 36 37.5 37 50.0 38 62.0 39 82.0 40 98.5 41 119.5 42 140.0 43 149.0 44 160.0 45 173.0 46 163.5 47 159.5 48 177.5 49 168.5 50 147.5 51 149.0 52 126.5 53 100.0 54 104.0 55 99.5 56 98.5 57 96.0 58 81.0 59 82.5 60 88.5 61 88.0 62 94.0 63 96.5 64 94.5 65 76.0 66 68.0 67 70.0 68 56.0 69 59.5 70 58.0 71 49.5 72 45.5 73 36.0 74 30.5 75 23.0 76 14.0 77 11.5 78 8.0 79 3.5 80 1.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19151086407277 98.15 2 0.631632137443153 1.25 3 0.12632642748863063 0.375 4 0.025265285497726126 0.1 5 0.025265285497726126 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2375 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.425 0.0 0.0 0.0 0.0 82-83 0.5375 0.0 0.0 0.0 0.0 84-85 0.7 0.0 0.0 0.0 0.0 86-87 0.8125 0.0 0.0 0.0 0.0 88-89 0.975 0.0 0.0 0.0 0.0 90-91 1.15 0.0 0.0 0.0 0.0 92-93 1.4 0.0 0.0 0.0 0.0 94-95 1.65 0.0 0.0 0.0 0.0 96-97 1.9 0.0 0.0 0.0 0.0 98-99 2.3125 0.0 0.0 0.0 0.0 100-101 2.575 0.0 0.0 0.0 0.0 102-103 2.9375 0.0 0.0 0.0 0.0 104-105 3.3125 0.0 0.0 0.0 0.0 106-107 3.7375 0.0 0.0 0.0 0.0 108-109 4.45 0.0 0.0 0.0 0.0 110-111 5.1625 0.0 0.0 0.0 0.0 112-113 5.6875 0.0 0.0 0.0 0.0 114-115 6.25 0.0 0.0 0.0 0.0 116-117 6.9 0.0 0.0 0.0 0.0 118-119 7.525 0.0 0.0 0.0 0.0 120-121 8.0625 0.0 0.0 0.0 0.0 122-123 8.6375 0.0 0.0 0.0 0.0 124-125 9.162500000000001 0.0 0.0 0.0 0.0 126-127 9.975000000000001 0.0 0.0 0.0 0.0 128-129 10.6875 0.0 0.0 0.0 0.0 130-131 11.3875 0.0 0.0 0.0 0.0 132-133 12.05 0.0 0.0 0.0 0.0 134-135 12.8125 0.0 0.0 0.0 0.0 136-137 13.412500000000001 0.0 0.0 0.0 0.0 138-139 14.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATCCAC 10 0.006830828 145.0 5 >>END_MODULE Read 1518789 spots for SRR5579243.sra Written 1518789 spots for SRR5579243.sra Read 1518789 spots for SRR5579243.sra Written 1518789 spots for SRR5579243.sra Read 1518789 spots for SRR5579243.sra Written 1518789 spots for SRR5579243.sra Read 1518789 spots for SRR5579243.sra Written 1518789 spots for SRR5579243.sra Read 1518789 spots for SRR5579243.sra Written 1518789 spots for SRR5579243.sra Read 1518789 spots for SRR5579243.sra Written 1518789 spots for SRR5579243.sra Read 1518789 spots for SRR5579243.sra Written 1518789 spots for SRR5579243.sra Read 1518789 spots for SRR5579243.sra Written 1518789 spots for SRR5579243.sra Read 1518789 spots for SRR5579243.sra Written 1518789 spots for SRR5579243.sra Read 1518789 spots for SRR5579243.sra Written 1518789 spots for SRR5579243.sra Read 1518789 spots for SRR5579243.sra Written 1518789 spots for SRR5579243.sra Read 1518789 spots for SRR5579243.sra Written 1518789 spots for SRR5579243.sra Read 1518789 spots for SRR5579243.sra Written 1518789 spots for SRR5579243.sra Read 1518789 spots for SRR5579243.sra Written 1518789 spots for SRR5579243.sra Read 1518789 spots for SRR5579243.sra Written 1518789 spots for SRR5579243.sra Read 1518789 spots for SRR5579243.sra Written 1518789 spots for SRR5579243.sra Read 1518795 spots for SRR5579243.sra Written 1518795 spots for SRR5579243.sra Read 1518789 spots for SRR5579243.sra Written 1518789 spots for SRR5579243.sra Read 1518789 spots for SRR5579243.sra Written 1518789 spots for SRR5579243.sra Read 1518789 spots for SRR5579243.sra Written 1518789 spots for SRR5579243.sra SRR ids: ['SRR5579243.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_120sdb9v SRR5579243.sra spots: 30375786 blocks: [[1, 1518789], [1518790, 3037578], [3037579, 4556367], [4556368, 6075156], [6075157, 7593945], [7593946, 9112734], [9112735, 10631523], [10631524, 12150312], [12150313, 13669101], [13669102, 15187890], [15187891, 16706679], [16706680, 18225468], [18225469, 19744257], [19744258, 21263046], [21263047, 22781835], [22781836, 24300624], [24300625, 25819413], [25819414, 27338202], [27338203, 28856991], [28856992, 30375786]] SRR5579243 file size 10271656 SRR5579243 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579243 SRR5579243_1.fastq SRR5579243_2.fastq Input file: SRR5579243_1.fastq Paired file: SRR5579243_2.fastq trimmed: SRR5579243-trimmed-pair1.fastq, SRR5579243-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 23:19:29 2024 >> started Mon Dec 9 23:20:17 2024 >> done (47.548s) 30375786 read pairs processed; of these: 51754 ( 0.17%) short read pairs filtered out after trimming by size control 87555 ( 0.29%) empty read pairs filtered out after trimming by size control 30236477 (99.54%) read pairs available; of these: 18260573 (60.39%) trimmed read pairs available after processing 11975904 (39.61%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 19 0.00% 19 22 0.00% 20 17 0.00% 21 25 0.00% 22 31 0.00% 23 18 0.00% 24 28 0.00% 25 36 0.00% 26 32 0.00% 27 47 0.00% 28 33 0.00% 29 33 0.00% 30 57 0.00% 31 41 0.00% 32 64 0.00% 33 64 0.00% 34 61 0.00% 35 63 0.00% 36 83 0.00% 37 78 0.00% 38 119 0.00% 39 127 0.00% 40 140 0.00% 41 166 0.00% 42 158 0.00% 43 192 0.00% 44 226 0.00% 45 275 0.00% 46 322 0.00% 47 345 0.00% 48 445 0.00% 49 471 0.00% 50 547 0.00% 51 620 0.00% 52 669 0.00% 53 722 0.00% 54 818 0.00% 55 914 0.00% 56 1088 0.00% 57 1205 0.00% 58 1401 0.00% 59 1617 0.01% 60 1903 0.01% 61 2108 0.01% 62 2414 0.01% 63 2675 0.01% 64 2864 0.01% 65 3171 0.01% 66 3578 0.01% 67 4209 0.01% 68 4843 0.02% 69 6002 0.02% 70 6649 0.02% 71 7157 0.02% 72 8244 0.03% 73 8978 0.03% 74 9765 0.03% 75 10748 0.04% 76 11584 0.04% 77 12922 0.04% 78 14160 0.05% 79 16100 0.05% 80 18314 0.06% 81 20407 0.07% 82 22916 0.08% 83 25334 0.08% 84 29084 0.10% 85 31550 0.10% 86 33249 0.11% 87 34844 0.12% 88 36759 0.12% 89 38918 0.13% 90 42129 0.14% 91 45460 0.15% 92 49080 0.16% 93 51397 0.17% 94 54965 0.18% 95 56099 0.19% 96 58296 0.19% 97 59829 0.20% 98 62311 0.21% 99 65835 0.22% 100 69416 0.23% 101 72635 0.24% 102 75017 0.25% 103 78284 0.26% 104 81162 0.27% 105 83385 0.28% 106 86101 0.28% 107 87213 0.29% 108 89341 0.30% 109 91016 0.30% 110 93643 0.31% 111 98026 0.32% 112 101554 0.34% 113 104419 0.35% 114 109143 0.36% 115 112118 0.37% 116 111990 0.37% 117 113402 0.38% 118 114288 0.38% 119 116931 0.39% 120 120440 0.40% 121 122254 0.40% 122 126524 0.42% 123 131811 0.44% 124 134988 0.45% 125 139146 0.46% 126 142969 0.47% 127 143454 0.47% 128 144896 0.48% 129 147608 0.49% 130 150556 0.50% 131 154881 0.51% 132 161533 0.53% 133 167744 0.55% 134 174603 0.58% 135 182362 0.60% 136 189933 0.63% 137 195584 0.65% 138 204815 0.68% 139 215343 0.71% 140 229044 0.76% 141 247828 0.82% 142 276534 0.91% 143 287862 0.95% 144 329128 1.09% 145 380382 1.26% 146 454717 1.50% 147 610761 2.02% 148 838490 2.77% 149 1576392 5.21% 150 6998618 23.15% 151 11975904 39.61% 30236477 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=26 prefix-density=0.58 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=28 fanout-score=12.00 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=2.9 sequence=AGCTTGAGGGTGTAGCTGGCGACTTGCTCAGGGGTGGCCCGCTCCTTGCACTCGGCGCCGGGTGTCACCATGCTGGGCTTGAGGAGGATGCCCTCGAACAAGACGTTGTTCTGGGCCATGTAGTAGAAAGTCTCCGCCCACACCTTCTGCGCCACCTCGAAGGTCCTGTCGATGCCGTGCTCGCCGTCCAGCAGGATCTCCGGCTCCACAATCGGCACCAGACCGTTGTCCTGAGAGATGGCAGCGTAACGGGCAAGACCCCATGCAGCTTCCTTGACAGCAAGCTCAGATGGGCCGTTGGGGATGCTGACGACAGTGCGCCACTTGGCGAAGCGGGCGCCTTGCTGGTAGTAGGCTGCCTCACGGGAGGCAAGGCCATCAAGACCTTGGCACCATGACTCGTCGTTGGAACCAACGAGTGGCACAAGACCCTTGTCAACCTTGATGCCGGGAACGATTCCCTGCTCGACAAGGATGTCAACAATCTTCTTGCCATCAACAGTCGATTGGT criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=3.88 fanout-score-rank=17 prefix-density=0.61 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=89.73 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=6.1 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR5579243 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 23:21:22 Started mapping on | Dec 09 23:21:22 Finished on | Dec 09 23:26:13 Mapping speed, Million of reads per hour | 374.06 Number of input reads | 30236477 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 28411849 Uniquely mapped reads % | 93.97% Average mapped length | 286.18 Number of splices: Total | 29452247 Number of splices: Annotated (sjdb) | 27658720 Number of splices: GT/AG | 29056434 Number of splices: GC/AG | 359417 Number of splices: AT/AC | 14534 Number of splices: Non-canonical | 21862 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 431827 % of reads mapped to multiple loci | 1.43% Number of reads mapped to too many loci | 56396 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.38% % of reads unmapped: other | 1.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1429898 1429898 1429898 N_multimapping 431827 431827 431827 N_noFeature 1189558 27507273 1578249 N_ambiguous 629065 4770 113303 UnstrandedReadsAssigned:26593226 PositiveStrandReadsAssigned:899806 NegativeStrandReadsAssigned:26720297 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=143 echo kmer=139 SRR5579243 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579243-trimmed-pair1.fastq SRR5579243-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,236,477 reads, 26,940,886 reads pseudoaligned [quant] estimated average fragment length: 239.607 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,202 rounds 52973 SRR5579243.ke.tsv 35125 SRR5579243.se.tsv 88098 total ==> SRR5579243.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 697.907 0 0 PNS24247 1044 805.393 97.0279 6.48287 PNS24249 1928 1689.39 186.654 5.94545 PNS24246 1044 805.393 97.0279 6.48287 PNS24248 1044 805.393 97.0279 6.48287 PNS24244 1471 1232.39 89.2627 3.89762 PNS24243 293 109.963 2 0.978731 KQK14069 1603 1364.39 7562.7 298.275 KQK14071 474 254.379 225.455 47.6932 ==> SRR5579243.se.tsv <== BRADI_1g14170v3 8598 BRADI_1g53295v3 288 BRADI_1g59795v3 521 BRADI_1g07683v3 0 BRADI_1g00485v3 60 BRADI_1g20270v3 3130 BRADI_1g74790v3 269 BRADI_1g09890v3 6 BRADI_1g77505v3 509 BRADI_1g48960v3 0 SRR5579243 completed mapping pipeline successfully