Starting /dee2/code/volunteer_pipeline.sh SRR5579244 current disk space = 1523104739328 free memory = 1454119196 SRR5579244 SRAfilesize 0095e487169fcfc00f2b6850bbae2db3 SRR5579244.sra SRR5579244.sra file validated SRR5579244 is paired end SRR5579244 is conventional basespace SRR5579244 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579244_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.50225 34.0 33.0 34.0 32.0 34.0 2 33.16275 34.0 33.0 34.0 32.0 34.0 3 33.2715 34.0 33.0 34.0 32.0 34.0 4 33.3965 34.0 34.0 34.0 33.0 34.0 5 33.48125 34.0 34.0 34.0 33.0 34.0 6 37.2575 38.0 38.0 38.0 36.0 38.0 7 37.47275 38.0 38.0 38.0 37.0 38.0 8 37.48975 38.0 38.0 38.0 38.0 38.0 9 37.53575 38.0 38.0 38.0 38.0 38.0 10-14 37.603449999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.577999999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.54515 38.0 38.0 38.0 38.0 38.0 25-29 37.427949999999996 38.0 38.0 38.0 38.0 38.0 30-34 37.439299999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.1768 38.0 38.0 38.0 37.0 38.0 40-44 37.075649999999996 38.0 38.0 38.0 36.6 38.0 45-49 37.127750000000006 38.0 38.0 38.0 36.8 38.0 50-54 37.24305 38.0 38.0 38.0 37.0 38.0 55-59 37.053200000000004 38.0 38.0 38.0 36.2 38.0 60-64 37.16015 38.0 38.0 38.0 36.6 38.0 65-69 36.977700000000006 38.0 38.0 38.0 36.0 38.0 70-74 37.01565 38.0 38.0 38.0 36.0 38.0 75-79 36.8135 38.0 38.0 38.0 35.6 38.0 80-84 36.686249999999994 38.0 38.0 38.0 34.8 38.0 85-89 36.79045 38.0 38.0 38.0 35.0 38.0 90-94 36.59035 38.0 38.0 38.0 34.4 38.0 95-99 36.45015 38.0 38.0 38.0 34.2 38.0 100-104 36.079750000000004 38.0 38.0 38.0 33.4 38.0 105-109 36.10385000000001 38.0 38.0 38.0 33.2 38.0 110-114 35.56635 38.0 36.6 38.0 30.6 38.0 115-119 35.54175 38.0 36.6 38.0 31.0 38.0 120-124 35.50475 38.0 36.2 38.0 31.0 38.0 125-129 35.19075 38.0 36.0 38.0 29.8 38.0 130-134 34.915 38.0 35.6 38.0 28.8 38.0 135-139 34.36970000000001 38.0 34.2 38.0 26.6 38.0 140-144 33.9353 38.0 33.4 38.0 24.0 38.0 145-149 33.03535000000001 38.0 33.0 38.0 17.0 38.0 150-151 27.396500000000003 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 2.0 9 1.0 10 3.0 11 0.0 12 0.0 13 1.0 14 3.0 15 1.0 16 3.0 17 4.0 18 4.0 19 8.0 20 8.0 21 5.0 22 5.0 23 9.0 24 18.0 25 18.0 26 22.0 27 19.0 28 24.0 29 34.0 30 49.0 31 61.0 32 64.0 33 102.0 34 147.0 35 232.0 36 715.0 37 2437.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.23799359658485 13.046958377801493 8.991462113127001 31.72358591248666 2 23.674999999999997 16.5 36.225 23.599999999999998 3 23.025000000000002 24.775 22.525000000000002 29.675 4 29.599999999999998 29.575000000000003 19.575 21.25 5 26.724999999999998 32.0 22.35 18.925 6 23.225 32.0 21.8 22.975 7 17.95 18.425 41.125 22.5 8 20.549999999999997 18.725 28.15 32.574999999999996 9 23.150000000000002 19.575 28.95 28.325 10-14 24.12 24.875 24.610000000000003 26.395000000000003 15-19 25.685000000000002 24.145 24.16 26.009999999999998 20-24 24.323513229630368 25.008753063572247 24.393537738208373 26.274195968589005 25-29 25.03 23.945 24.785 26.240000000000002 30-34 24.39463678206924 24.589753852311386 24.464678807284372 26.550930558335 35-39 24.582458245824583 24.367436743674368 25.087508750875088 25.962596259625965 40-44 24.45323056904059 24.628396977128272 24.548320904859615 26.370051548971524 45-49 25.07133917396746 24.40050062578223 23.78473091364205 26.74342928660826 50-54 25.07259437268449 24.331631120456592 24.251526985080606 26.344247521778314 55-59 24.56693701812356 24.306598578151597 24.64704115349955 26.47942325022529 60-64 25.051324420409593 23.824545591107103 24.640729057132845 26.48340093135046 65-69 24.966200991437585 24.3152571228281 24.59065645185519 26.127885433879122 70-74 25.35789368305136 24.181599759735708 24.171588747622387 26.28891780959055 75-79 25.00125081302847 24.155701205783757 24.50592885375494 26.33711912743283 80-84 24.852455736721016 24.5223567070121 24.08222466740022 26.54296288886666 85-89 25.518931626069126 23.81833641774621 24.4035412394338 26.25919071675086 90-94 25.41016406562625 24.329731892757103 24.314725890356144 25.945378151260506 95-99 25.171636181408168 23.688298672012024 24.40491104986219 26.73515409671762 100-104 25.72830113124437 24.016418059865853 23.97136850535589 26.283912303533885 105-109 25.955000000000002 24.73 23.23 26.085 110-114 25.554218076035713 24.24515999598756 24.300331026181162 25.900290901795564 115-119 24.93874081112167 23.96359453918088 24.10361554233135 26.994049107366102 120-124 25.11 24.595 23.51 26.784999999999997 125-129 25.69 24.27 23.41 26.63 130-134 25.41 24.65 23.185 26.755000000000003 135-139 25.424999999999997 24.279999999999998 23.61 26.685 140-144 25.130000000000003 24.79 23.59 26.490000000000002 145-149 25.465 24.63 23.68 26.224999999999998 150-151 25.2125 24.975 23.2125 26.6 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.5 27 1.5 28 0.5 29 2.5 30 5.5 31 11.0 32 16.5 33 19.5 34 23.5 35 34.5 36 48.0 37 58.5 38 64.0 39 81.0 40 106.5 41 129.5 42 158.5 43 176.0 44 168.5 45 171.0 46 189.5 47 174.5 48 152.5 49 141.0 50 140.5 51 127.5 52 116.0 53 112.5 54 98.5 55 89.5 56 83.0 57 87.0 58 97.0 59 101.5 60 94.0 61 103.5 62 97.0 63 77.5 64 83.5 65 70.0 66 65.0 67 75.0 68 68.0 69 57.0 70 45.0 71 40.0 72 35.5 73 33.5 74 26.0 75 14.5 76 11.5 77 7.5 78 2.5 79 1.5 80 1.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.034999999999999996 25-29 0.0 30-34 0.06 35-39 0.01 40-44 0.095 45-49 0.125 50-54 0.13 55-59 0.13 60-64 0.145 65-69 0.145 70-74 0.11 75-79 0.065 80-84 0.03 85-89 0.034999999999999996 90-94 0.04 95-99 0.22499999999999998 100-104 0.11 105-109 0.0 110-114 0.31 115-119 0.015 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.34225962764602 96.39999999999999 2 1.4282070900280541 2.8000000000000003 3 0.1530221882172915 0.44999999999999996 4 0.0510073960724305 0.2 5 0.0 0.0 6 0.02550369803621525 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCT 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.44999999999999996 0.0 0.0 0.0 0.0 84-85 0.6125 0.0 0.0 0.0 0.0 86-87 0.9375 0.0 0.0 0.0 0.0 88-89 1.1 0.0 0.0 0.0 0.0 90-91 1.25 0.0 0.0 0.0 0.0 92-93 1.45 0.0 0.0 0.0 0.0 94-95 1.65 0.0 0.0 0.0 0.0 96-97 1.9 0.0 0.0 0.0 0.0 98-99 2.1875 0.0 0.0 0.0 0.0 100-101 2.425 0.0 0.0 0.0 0.0 102-103 2.7874999999999996 0.0 0.0 0.0 0.0 104-105 3.0999999999999996 0.0 0.0 0.0 0.0 106-107 3.5625 0.0 0.0 0.0 0.0 108-109 4.1125 0.0 0.0 0.0 0.0 110-111 4.6125 0.0 0.0 0.0 0.0 112-113 5.1875 0.0 0.0 0.0 0.0 114-115 5.762499999999999 0.0 0.0 0.0 0.0 116-117 6.475 0.0 0.0 0.0 0.0 118-119 6.9625 0.0 0.0 0.0 0.0 120-121 7.5375 0.0 0.0 0.0 0.0 122-123 7.949999999999999 0.0 0.0 0.0 0.0 124-125 8.475 0.0 0.0 0.0 0.0 126-127 9.1625 0.0 0.0 0.0 0.0 128-129 9.8875 0.0 0.0 0.0 0.0 130-131 10.5625 0.0 0.0 0.0 0.0 132-133 11.2625 0.0 0.0 0.0 0.0 134-135 11.9875 0.0 0.0 0.0 0.0 136-137 12.725000000000001 0.0 0.0 0.0 0.0 138-139 13.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGACGC 10 0.0071897744 142.5375 5 >>END_MODULE SRR5579244 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579244_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.77075 33.0 33.0 34.0 32.0 34.0 2 32.7995 34.0 33.0 34.0 32.0 34.0 3 32.77525 34.0 33.0 34.0 32.0 34.0 4 32.762 34.0 33.0 34.0 32.0 34.0 5 32.7915 34.0 33.0 34.0 32.0 34.0 6 36.80225 38.0 38.0 38.0 36.0 38.0 7 37.0065 38.0 38.0 38.0 37.0 38.0 8 36.93675 38.0 38.0 38.0 37.0 38.0 9 36.74625 38.0 38.0 38.0 37.0 38.0 10-14 36.837500000000006 38.0 38.0 38.0 36.8 38.0 15-19 36.821400000000004 38.0 38.0 38.0 37.0 38.0 20-24 36.82934999999999 38.0 38.0 38.0 37.0 38.0 25-29 36.73465 38.0 38.0 38.0 36.8 38.0 30-34 36.82285 38.0 38.0 38.0 37.0 38.0 35-39 36.869299999999996 38.0 38.0 38.0 37.0 38.0 40-44 36.82594999999999 38.0 38.0 38.0 37.0 38.0 45-49 36.7737 38.0 38.0 38.0 36.8 38.0 50-54 36.74615 38.0 38.0 38.0 37.0 38.0 55-59 36.58075 38.0 38.0 38.0 36.0 38.0 60-64 36.638 38.0 38.0 38.0 36.0 38.0 65-69 36.464299999999994 38.0 38.0 38.0 35.6 38.0 70-74 36.212900000000005 38.0 38.0 38.0 34.4 38.0 75-79 36.16775 38.0 38.0 38.0 34.2 38.0 80-84 36.17885 38.0 38.0 38.0 34.6 38.0 85-89 36.0438 38.0 38.0 38.0 34.0 38.0 90-94 36.11385 38.0 38.0 38.0 34.2 38.0 95-99 36.0126 38.0 38.0 38.0 34.0 38.0 100-104 35.8039 38.0 38.0 38.0 33.4 38.0 105-109 35.58220000000001 38.0 38.0 38.0 32.4 38.0 110-114 35.383750000000006 38.0 38.0 38.0 31.8 38.0 115-119 35.0255 38.0 36.6 38.0 29.8 38.0 120-124 34.502100000000006 38.0 35.8 38.0 25.2 38.0 125-129 34.16425 38.0 35.0 38.0 24.0 38.0 130-134 33.71005 38.0 34.2 38.0 21.4 38.0 135-139 33.36345 38.0 33.4 38.0 18.2 38.0 140-144 32.8199 38.0 33.0 38.0 13.2 38.0 145-149 31.46595 38.0 32.6 38.0 5.6 38.0 150-151 25.515500000000003 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 28.0 3 10.0 4 11.0 5 1.0 6 1.0 7 1.0 8 2.0 9 3.0 10 3.0 11 3.0 12 6.0 13 5.0 14 1.0 15 5.0 16 6.0 17 11.0 18 7.0 19 13.0 20 8.0 21 8.0 22 10.0 23 21.0 24 12.0 25 12.0 26 22.0 27 16.0 28 34.0 29 34.0 30 41.0 31 57.0 32 69.0 33 113.0 34 151.0 35 266.0 36 599.0 37 2410.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.223337515683816 14.328732747804265 9.98745294855709 29.460476787954832 2 27.151819322459218 21.555834378920956 28.78293601003764 22.50941028858218 3 23.55455002513826 23.705379587732526 23.705379587732526 29.034690799396685 4 27.96886768767261 31.93572683906603 18.12703991965855 21.968365553602812 5 28.306148055207025 32.622333751568384 17.44040150564617 21.63111668757842 6 22.037735849056602 33.257861635220124 19.0188679245283 25.68553459119497 7 21.921244043140206 15.349887133182843 35.96689240030098 26.761976423375973 8 23.952846751943817 21.043391020817655 22.34762979683973 32.6561324303988 9 23.58111501757911 21.64741336012054 23.656454043194376 31.115017579105974 10-14 26.363043587299995 24.662687465516374 23.1228369363495 25.85143201083413 15-19 26.23616051300035 24.222233355042334 23.716246681028004 25.825359450929312 20-24 26.34139003109016 24.290442282619598 23.18724300471367 26.180924681576574 25-29 26.1096082556858 23.60484921350566 23.61486824967438 26.670674281134154 30-34 26.045112781954888 24.350877192982455 23.588972431077696 26.015037593984964 35-39 26.941966523002908 23.61932444622632 22.952791420266614 26.48591761050416 40-44 26.876598305169736 23.39668053953768 23.34152334152334 26.38519781376924 45-49 27.046138415245736 23.470411233701103 23.189568706118354 26.293881644934803 50-54 26.667335272289638 23.663624511082137 23.367766522916458 26.301273693711764 55-59 27.06265664160401 23.809523809523807 23.147869674185465 25.979949874686714 60-64 26.700100300902708 23.89669007021063 23.50050150451354 25.90270812437312 65-69 26.601454727865566 23.47629796839729 23.43115124153499 26.491096062202157 70-74 26.491826296259152 23.78397352321733 23.297562932504263 26.426637248019258 75-79 26.794042425154206 23.654781605736925 23.203450178025175 26.347725791083697 80-84 26.09501854264809 24.2507767866092 23.027964317931243 26.626240352811465 85-89 27.32607714300045 23.724732908662286 23.042584140041132 25.906605808296135 90-94 27.00942072559631 24.21828021647625 23.251152535578274 25.52114652234917 95-99 27.372116349047143 23.706118355065193 23.791374122367102 25.13039117352056 100-104 27.180720476977804 24.054311338243398 22.95706197705296 25.80790620772584 105-109 27.243573683419353 24.492659217317232 23.199879741444104 25.063887357819308 110-114 26.81777153745863 25.057667234981444 23.05686490823388 25.067696319326043 115-119 27.43358395989975 24.421052631578945 23.2531328320802 24.8922305764411 120-124 28.12922614575507 24.53794139744553 22.39418983220636 24.938642624593037 125-129 28.274167669474533 24.679101484155634 22.843963096670677 24.20276774969916 130-134 27.936826272248684 24.83830533968413 22.98821759839559 24.236650789671597 135-139 28.083462908160705 25.379946832522442 22.616241159652905 23.92034909966394 140-144 28.669609712049766 25.504163740343134 22.4641316343935 23.362094913213603 145-149 28.384476534296027 25.83233052547132 22.77878058563979 23.00441235459286 150-151 29.187562688064194 26.341524573721166 21.602306920762288 22.868605817452355 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 2.0 3 2.5 4 1.5 5 1.0 6 1.5 7 1.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 1.0 25 0.5 26 1.5 27 1.5 28 2.0 29 3.0 30 5.5 31 7.0 32 9.5 33 14.5 34 20.5 35 23.5 36 26.5 37 44.0 38 57.5 39 69.5 40 85.5 41 101.5 42 119.0 43 136.5 44 140.0 45 149.5 46 155.5 47 161.0 48 158.5 49 145.5 50 140.5 51 130.5 52 131.0 53 115.0 54 105.0 55 110.5 56 97.5 57 92.5 58 101.0 59 102.5 60 113.5 61 112.0 62 107.0 63 97.0 64 85.5 65 89.5 66 83.5 67 84.5 68 83.5 69 72.5 70 65.0 71 64.5 72 51.0 73 31.5 74 24.5 75 19.0 76 13.0 77 7.0 78 5.5 79 4.0 80 1.5 81 1.0 82 1.0 83 1.5 84 1.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.375 2 0.375 3 0.5499999999999999 4 0.42500000000000004 5 0.375 6 0.625 7 0.325 8 0.325 9 0.44999999999999996 10-14 0.315 15-19 0.19499999999999998 20-24 0.29 25-29 0.19 30-34 0.25 35-39 0.22999999999999998 40-44 0.28500000000000003 45-49 0.3 50-54 0.29 55-59 0.25 60-64 0.3 65-69 0.325 70-74 0.29 75-79 0.295 80-84 0.22999999999999998 85-89 0.315 90-94 0.22 95-99 0.3 100-104 0.20500000000000002 105-109 0.215 110-114 0.29 115-119 0.25 120-124 0.17500000000000002 125-129 0.27999999999999997 130-134 0.27499999999999997 135-139 0.315 140-144 0.33 145-149 0.27999999999999997 150-151 0.3 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.32499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.94502954020035 95.325 2 1.6953506293347034 3.3000000000000003 3 0.20549704597996404 0.6 4 0.10274852298998202 0.4 5 0.0 0.0 6 0.0 0.0 7 0.025687130747495505 0.17500000000000002 8 0.025687130747495505 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 8 0.2 No Hit GCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAATGGCG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.42500000000000004 0.0 0.0 0.0 0.0 84-85 0.5625 0.0 0.0 0.0 0.0 86-87 0.9125 0.0 0.0 0.0 0.0 88-89 1.0750000000000002 0.0 0.0 0.0 0.0 90-91 1.225 0.0 0.0 0.0 0.0 92-93 1.425 0.0 0.0 0.0 0.0 94-95 1.6375 0.0 0.0 0.0 0.0 96-97 1.9 0.0 0.0 0.0 0.0 98-99 2.1875 0.0 0.0 0.0 0.0 100-101 2.425 0.0 0.0 0.0 0.0 102-103 2.7874999999999996 0.0 0.0 0.0 0.0 104-105 3.075 0.0 0.0 0.0 0.0 106-107 3.5 0.0 0.0 0.0 0.0 108-109 4.0875 0.0 0.0 0.0 0.0 110-111 4.6125 0.0 0.0 0.0 0.0 112-113 5.1875 0.0 0.0 0.0 0.0 114-115 5.725 0.0 0.0 0.0 0.0 116-117 6.45 0.0 0.0 0.0 0.0 118-119 6.9625 0.0 0.0 0.0 0.0 120-121 7.525 0.0 0.0 0.0 0.0 122-123 7.9375 0.0 0.0 0.0 0.0 124-125 8.45 0.0 0.0 0.0 0.0 126-127 9.175 0.0 0.0 0.0 0.0 128-129 9.875 0.0 0.0 0.0 0.0 130-131 10.524999999999999 0.0 0.0 0.0 0.0 132-133 11.2375 0.0 0.0 0.0 0.0 134-135 12.025 0.0 0.0 0.0 0.0 136-137 12.7375 0.0 0.0 0.0 0.0 138-139 13.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGGACG 10 0.006824188 145.0 3 >>END_MODULE Read 931819 spots for SRR5579244.sra Written 931819 spots for SRR5579244.sra Read 931819 spots for SRR5579244.sra Written 931819 spots for SRR5579244.sra Read 931819 spots for SRR5579244.sra Written 931819 spots for SRR5579244.sra Read 931819 spots for SRR5579244.sra Written 931819 spots for SRR5579244.sra Read 931819 spots for SRR5579244.sra Written 931819 spots for SRR5579244.sra Read 931819 spots for SRR5579244.sra Written 931819 spots for SRR5579244.sra Read 931819 spots for SRR5579244.sra Written 931819 spots for SRR5579244.sra Read 931819 spots for SRR5579244.sra Written 931819 spots for SRR5579244.sra Read 931819 spots for SRR5579244.sra Written 931819 spots for SRR5579244.sra Read 931819 spots for SRR5579244.sra Written 931819 spots for SRR5579244.sra Read 931819 spots for SRR5579244.sra Written 931819 spots for SRR5579244.sra Read 931819 spots for SRR5579244.sra Written 931819 spots for SRR5579244.sra Read 931819 spots for SRR5579244.sra Written 931819 spots for SRR5579244.sra Read 931819 spots for SRR5579244.sra Written 931819 spots for SRR5579244.sra Read 931819 spots for SRR5579244.sra Written 931819 spots for SRR5579244.sra Read 931822 spots for SRR5579244.sra Written 931822 spots for SRR5579244.sra Read 931819 spots for SRR5579244.sra Written 931819 spots for SRR5579244.sra Read 931819 spots for SRR5579244.sra Written 931819 spots for SRR5579244.sra Read 931819 spots for SRR5579244.sra Written 931819 spots for SRR5579244.sra Read 931819 spots for SRR5579244.sra Written 931819 spots for SRR5579244.sra SRR ids: ['SRR5579244.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3x8yrm1g SRR5579244.sra spots: 18636383 blocks: [[1, 931819], [931820, 1863638], [1863639, 2795457], [2795458, 3727276], [3727277, 4659095], [4659096, 5590914], [5590915, 6522733], [6522734, 7454552], [7454553, 8386371], [8386372, 9318190], [9318191, 10250009], [10250010, 11181828], [11181829, 12113647], [12113648, 13045466], [13045467, 13977285], [13977286, 14909104], [14909105, 15840923], [15840924, 16772742], [16772743, 17704561], [17704562, 18636383]] SRR5579244 file size 6293558 SRR5579244 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579244 SRR5579244_1.fastq SRR5579244_2.fastq Input file: SRR5579244_1.fastq Paired file: SRR5579244_2.fastq trimmed: SRR5579244-trimmed-pair1.fastq, SRR5579244-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 23:18:41 2024 >> started Mon Dec 9 23:19:10 2024 >> done (28.509s) 18636383 read pairs processed; of these: 27762 ( 0.15%) short read pairs filtered out after trimming by size control 82922 ( 0.44%) empty read pairs filtered out after trimming by size control 18525699 (99.41%) read pairs available; of these: 11174856 (60.32%) trimmed read pairs available after processing 7350843 (39.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 13 0.00% 20 13 0.00% 21 16 0.00% 22 12 0.00% 23 23 0.00% 24 24 0.00% 25 17 0.00% 26 24 0.00% 27 31 0.00% 28 21 0.00% 29 29 0.00% 30 42 0.00% 31 34 0.00% 32 36 0.00% 33 32 0.00% 34 49 0.00% 35 38 0.00% 36 54 0.00% 37 63 0.00% 38 68 0.00% 39 73 0.00% 40 89 0.00% 41 99 0.00% 42 130 0.00% 43 122 0.00% 44 120 0.00% 45 168 0.00% 46 188 0.00% 47 211 0.00% 48 238 0.00% 49 294 0.00% 50 305 0.00% 51 350 0.00% 52 385 0.00% 53 402 0.00% 54 466 0.00% 55 552 0.00% 56 616 0.00% 57 656 0.00% 58 777 0.00% 59 868 0.00% 60 1082 0.01% 61 1125 0.01% 62 1296 0.01% 63 1401 0.01% 64 1567 0.01% 65 1791 0.01% 66 2032 0.01% 67 2289 0.01% 68 2771 0.01% 69 3865 0.02% 70 4390 0.02% 71 4024 0.02% 72 4432 0.02% 73 4685 0.03% 74 5366 0.03% 75 5826 0.03% 76 6233 0.03% 77 6936 0.04% 78 7850 0.04% 79 8826 0.05% 80 9687 0.05% 81 10842 0.06% 82 12091 0.07% 83 13456 0.07% 84 15703 0.08% 85 17272 0.09% 86 18093 0.10% 87 19642 0.11% 88 20723 0.11% 89 21900 0.12% 90 24962 0.13% 91 25049 0.14% 92 26456 0.14% 93 28782 0.16% 94 30740 0.17% 95 31072 0.17% 96 32421 0.18% 97 34304 0.19% 98 34886 0.19% 99 37023 0.20% 100 38802 0.21% 101 40876 0.22% 102 43538 0.24% 103 45247 0.24% 104 46989 0.25% 105 48152 0.26% 106 49575 0.27% 107 49956 0.27% 108 51707 0.28% 109 53390 0.29% 110 54310 0.29% 111 56808 0.31% 112 59433 0.32% 113 61374 0.33% 114 63918 0.35% 115 65528 0.35% 116 65376 0.35% 117 67113 0.36% 118 67686 0.37% 119 68509 0.37% 120 70612 0.38% 121 72440 0.39% 122 74797 0.40% 123 77958 0.42% 124 80973 0.44% 125 81732 0.44% 126 84276 0.45% 127 85017 0.46% 128 86346 0.47% 129 88256 0.48% 130 89267 0.48% 131 92240 0.50% 132 96126 0.52% 133 99767 0.54% 134 103137 0.56% 135 109133 0.59% 136 112768 0.61% 137 116280 0.63% 138 122062 0.66% 139 126430 0.68% 140 131335 0.71% 141 140513 0.76% 142 151849 0.82% 143 163441 0.88% 144 184555 1.00% 145 214845 1.16% 146 257371 1.39% 147 336246 1.82% 148 498303 2.69% 149 969705 5.23% 150 4608135 24.87% 151 7350843 39.68% 18525699 reads passed initial QC criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=33 prefix-density=0.85 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGC criterion=fanout-score sequence-density=0.31 sequence-density-rank=20 fanout-score=16.51 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=7.5 sequence=CCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCTTGCCGCCGCTGCAGACGACGGCGAAGTTGGAGCCCCGCCGCGACAGCGACGGCAGGCTCGTCGGCGCCACCAGAGGCGACGTGATCATGGACGCTGCCATCTCGATCTCTCTCTC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=25 prefix-density=0.75 prefix-fanout=2.7 sequence=CCGCATCACCATGCGCAAGACCGTTGCCAAGGCCAAGCCGGTCTCCTCAGGCAGCCCGTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=73.25 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=6.1 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR5579244 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 23:20:15 Started mapping on | Dec 09 23:20:15 Finished on | Dec 09 23:22:25 Mapping speed, Million of reads per hour | 513.02 Number of input reads | 18525699 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 17770828 Uniquely mapped reads % | 95.93% Average mapped length | 287.19 Number of splices: Total | 17862024 Number of splices: Annotated (sjdb) | 16872661 Number of splices: GT/AG | 17627595 Number of splices: GC/AG | 216923 Number of splices: AT/AC | 5601 Number of splices: Non-canonical | 11905 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.37 Insertion rate per base | 0.00% Insertion average length | 1.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 150617 % of reads mapped to multiple loci | 0.81% Number of reads mapped to too many loci | 13758 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.81% % of reads unmapped: other | 0.38% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 630109 630109 630109 N_multimapping 150617 150617 150617 N_noFeature 554150 17194908 742855 N_ambiguous 460329 2157 74686 UnstrandedReadsAssigned:16756349 PositiveStrandReadsAssigned:573763 NegativeStrandReadsAssigned:16953287 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=143 echo kmer=139 SRR5579244 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579244-trimmed-pair1.fastq SRR5579244-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,525,699 reads, 16,951,497 reads pseudoaligned [quant] estimated average fragment length: 239.534 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52973 SRR5579244.ke.tsv 35125 SRR5579244.se.tsv 88098 total ==> SRR5579244.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 698.017 0 0 PNS24247 1044 805.466 30.0894 3.08541 PNS24249 1928 1689.47 66.1989 3.23629 PNS24246 1044 805.466 30.0894 3.08541 PNS24248 1044 805.466 30.0894 3.08541 PNS24244 1471 1232.47 43.5329 2.91736 PNS24243 293 110.336 0 0 KQK14069 1603 1364.47 3238.24 196.017 KQK14071 474 256.402 137.583 44.319 ==> SRR5579244.se.tsv <== BRADI_1g14170v3 3905 BRADI_1g53295v3 82 BRADI_1g59795v3 446 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 151 BRADI_1g74790v3 55 BRADI_1g09890v3 0 BRADI_1g77505v3 159 BRADI_1g48960v3 0 SRR5579244 completed mapping pipeline successfully