Starting /dee2/code/volunteer_pipeline.sh SRR5579245 current disk space = 1523072667648 free memory = 1564934968 SRR5579245 SRAfilesize 449835cd8943935194db34d3fdea9038 SRR5579245.sra SRR5579245.sra file validated SRR5579245 is paired end SRR5579245 is conventional basespace SRR5579245 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579245_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.204 34.0 33.0 34.0 32.0 34.0 2 33.25975 34.0 33.0 34.0 32.0 34.0 3 33.3705 34.0 34.0 34.0 32.0 34.0 4 33.43575 34.0 34.0 34.0 33.0 34.0 5 33.51475 34.0 34.0 34.0 33.0 34.0 6 37.27625 38.0 38.0 38.0 36.0 38.0 7 37.453 38.0 38.0 38.0 37.0 38.0 8 37.52325 38.0 38.0 38.0 38.0 38.0 9 37.563 38.0 38.0 38.0 38.0 38.0 10-14 37.5727 38.0 38.0 38.0 38.0 38.0 15-19 37.585750000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.53095 38.0 38.0 38.0 38.0 38.0 25-29 37.4227 38.0 38.0 38.0 37.8 38.0 30-34 37.375550000000004 38.0 38.0 38.0 37.8 38.0 35-39 37.16975 38.0 38.0 38.0 37.0 38.0 40-44 37.04905 38.0 38.0 38.0 36.6 38.0 45-49 37.09015 38.0 38.0 38.0 37.0 38.0 50-54 37.23819999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.09740000000001 38.0 38.0 38.0 36.8 38.0 60-64 37.16080000000001 38.0 38.0 38.0 36.8 38.0 65-69 36.9413 38.0 38.0 38.0 36.0 38.0 70-74 36.81510000000001 38.0 38.0 38.0 36.0 38.0 75-79 36.349599999999995 38.0 38.0 38.0 34.6 38.0 80-84 36.28060000000001 38.0 38.0 38.0 34.4 38.0 85-89 36.33505 38.0 38.0 38.0 35.0 38.0 90-94 36.17975 38.0 38.0 38.0 34.0 38.0 95-99 36.041900000000005 38.0 38.0 38.0 34.0 38.0 100-104 35.707750000000004 38.0 38.0 38.0 32.4 38.0 105-109 35.759299999999996 38.0 38.0 38.0 33.2 38.0 110-114 35.337450000000004 38.0 37.2 38.0 30.8 38.0 115-119 35.2474 38.0 36.6 38.0 30.0 38.0 120-124 35.1757 38.0 36.2 38.0 29.8 38.0 125-129 34.88355 38.0 36.2 38.0 28.6 38.0 130-134 34.627950000000006 38.0 35.4 38.0 27.8 38.0 135-139 34.22045000000001 38.0 34.8 38.0 25.6 38.0 140-144 33.76 38.0 33.4 38.0 22.8 38.0 145-149 32.709700000000005 38.0 33.0 38.0 12.2 38.0 150-151 27.011375 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 3.0 9 0.0 10 4.0 11 1.0 12 2.0 13 5.0 14 1.0 15 2.0 16 6.0 17 10.0 18 15.0 19 32.0 20 9.0 21 11.0 22 5.0 23 11.0 24 10.0 25 20.0 26 21.0 27 22.0 28 20.0 29 35.0 30 30.0 31 46.0 32 70.0 33 90.0 34 136.0 35 243.0 36 652.0 37 2487.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.61768530559168 13.914174252275682 11.001300390117034 29.466840052015602 2 23.825 17.45 31.5 27.224999999999998 3 23.1 23.575 27.150000000000002 26.174999999999997 4 25.474999999999998 29.375 21.575 23.575 5 24.224999999999998 33.025 22.900000000000002 19.85 6 21.0 32.975 25.074999999999996 20.95 7 17.474999999999998 22.475 38.25 21.8 8 19.45 23.75 27.450000000000003 29.349999999999998 9 21.775 21.275 31.0 25.95 10-14 21.94 27.625 24.705 25.729999999999997 15-19 22.509999999999998 26.295 25.22 25.974999999999998 20-24 23.026908072421726 26.552965889766927 24.85745723717115 25.562668800640193 25-29 22.735 26.605 24.735 25.924999999999997 30-34 22.164974238407282 26.36686508929018 25.391426141763795 26.076734530538744 35-39 21.937193719371937 25.842584258425845 25.987598759875986 26.232623262326232 40-44 23.230099564717065 25.641667083604343 25.24140691449442 25.88682643718417 45-49 23.760444288787713 25.54160204132686 25.041276829939463 25.656676839945963 50-54 22.69429014662463 25.44162538157434 25.04628934594405 26.817795125856982 55-59 23.615072811890105 25.256467997798126 24.806085172396536 26.32237401791523 60-64 23.31865492393915 25.70056044835869 24.85988791032826 26.1208967173739 65-69 23.51851851851852 26.136136136136134 24.334334334334333 26.01101101101101 70-74 23.349847370264726 26.357403793224243 24.495821448231 25.79692738828004 75-79 23.410852713178297 25.721430357589398 24.546136534133534 26.321580395098778 80-84 23.994798959791957 25.40508101620324 24.71494298859772 25.885177035407082 85-89 24.06481296259252 24.989997999599918 24.46489297859572 26.480296059211845 90-94 24.029611844737893 24.854941976790716 25.0 26.11544617847139 95-99 24.106338239711626 25.122659457294482 24.757184339641533 26.01381796335236 100-104 24.68851638729047 25.459094320740554 23.977983487615713 25.874405804353266 105-109 24.46 25.61 23.880000000000003 26.05 110-114 24.073609787895503 25.738354309782878 23.712580855438 26.475455046883617 115-119 24.197419741974198 25.432543254325434 24.09240924092409 26.27762776277628 120-124 24.52 24.855 23.91 26.715 125-129 23.605 25.655 23.815 26.924999999999997 130-134 24.295 25.419999999999998 23.82 26.465 135-139 23.995 24.884999999999998 24.310000000000002 26.810000000000002 140-144 23.794999999999998 25.290000000000003 24.169999999999998 26.745 145-149 23.635 25.52 24.04 26.805 150-151 23.7125 24.975 23.6875 27.625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 1.0 3 1.0 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 2.5 26 4.5 27 4.5 28 4.5 29 8.0 30 12.5 31 20.5 32 26.0 33 32.0 34 38.5 35 42.0 36 71.0 37 96.5 38 105.0 39 128.0 40 137.0 41 132.0 42 153.0 43 162.0 44 168.5 45 185.5 46 170.0 47 155.0 48 154.5 49 150.5 50 146.0 51 147.5 52 142.5 53 126.5 54 111.0 55 89.0 56 82.0 57 91.5 58 86.5 59 80.5 60 82.0 61 76.0 62 64.0 63 53.0 64 47.5 65 50.5 66 45.0 67 42.0 68 40.0 69 32.0 70 34.5 71 31.5 72 25.0 73 22.0 74 18.0 75 14.5 76 11.5 77 12.0 78 11.0 79 6.5 80 3.0 81 2.0 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.03 25-29 0.0 30-34 0.045 35-39 0.01 40-44 0.065 45-49 0.065 50-54 0.08499999999999999 55-59 0.08499999999999999 60-64 0.08 65-69 0.1 70-74 0.08499999999999999 75-79 0.025 80-84 0.02 85-89 0.02 90-94 0.04 95-99 0.13 100-104 0.075 105-109 0.0 110-114 0.28500000000000003 115-119 0.01 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.13905401912639 94.925 2 1.4990953734815198 2.9000000000000004 3 0.31015766347893514 0.8999999999999999 4 0.025846471956577927 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025846471956577927 1.175 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTCCTATCTCGTATGC 47 1.175 TruSeq Adapter, Index 27 (98% over 50bp) >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.025 74-75 0.125 0.0 0.0 0.0 0.025 76-77 0.2 0.0 0.0 0.0 0.025 78-79 0.275 0.0 0.0 0.0 0.025 80-81 0.375 0.0 0.0 0.0 0.025 82-83 0.5 0.0 0.0 0.0 0.025 84-85 0.75 0.0 0.0 0.0 0.025 86-87 0.9624999999999999 0.0 0.0 0.0 0.025 88-89 1.175 0.0 0.0 0.0 0.025 90-91 1.3375 0.0 0.0 0.0 0.025 92-93 1.6375000000000002 0.0 0.0 0.0 0.025 94-95 2.0125 0.0 0.0 0.0 0.025 96-97 2.2625 0.0 0.0 0.0 0.025 98-99 2.55 0.0 0.0 0.0 0.025 100-101 3.0625 0.0 0.0 0.0 0.025 102-103 3.475 0.0 0.0 0.0 0.025 104-105 3.9125 0.0 0.0 0.0 0.025 106-107 4.3125 0.0 0.0 0.0 0.025 108-109 4.775 0.0 0.0 0.0 0.025 110-111 5.25 0.0 0.0 0.0 0.025 112-113 5.7625 0.0 0.0 0.0 0.025 114-115 6.525 0.0 0.0 0.0 0.025 116-117 7.05 0.0 0.0 0.0 0.025 118-119 7.7125 0.0 0.0 0.0 0.025 120-121 8.425 0.0 0.0 0.0 0.025 122-123 9.0625 0.0 0.0 0.0 0.025 124-125 10.0125 0.0 0.0 0.0 0.025 126-127 10.774999999999999 0.0 0.0 0.0 0.025 128-129 11.4125 0.0 0.0 0.0 0.025 130-131 12.3 0.0 0.0 0.0 0.025 132-133 13.0875 0.0 0.0 0.0 0.025 134-135 13.8625 0.0 0.0 0.0 0.025 136-137 14.5375 0.0 0.0 0.0 0.025 138-139 15.5 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5579245 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579245_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.78825 33.0 33.0 34.0 32.0 34.0 2 32.72225 34.0 33.0 34.0 32.0 34.0 3 32.6925 34.0 33.0 34.0 32.0 34.0 4 32.671 34.0 33.0 34.0 32.0 34.0 5 32.562 34.0 33.0 34.0 32.0 34.0 6 36.61875 38.0 38.0 38.0 36.0 38.0 7 36.648 38.0 38.0 38.0 36.0 38.0 8 36.678 38.0 38.0 38.0 36.0 38.0 9 36.56475 38.0 38.0 38.0 36.0 38.0 10-14 36.6071 38.0 38.0 38.0 36.0 38.0 15-19 36.5867 38.0 38.0 38.0 36.4 38.0 20-24 36.59595 38.0 38.0 38.0 36.4 38.0 25-29 36.465650000000004 38.0 38.0 38.0 36.0 38.0 30-34 36.436899999999994 38.0 38.0 38.0 36.2 38.0 35-39 36.4571 38.0 38.0 38.0 36.4 38.0 40-44 36.433299999999996 38.0 38.0 38.0 36.0 38.0 45-49 36.362700000000004 38.0 38.0 38.0 36.2 38.0 50-54 36.299400000000006 38.0 38.0 38.0 36.0 38.0 55-59 36.282799999999995 38.0 38.0 38.0 36.0 38.0 60-64 36.2293 38.0 38.0 38.0 35.6 38.0 65-69 36.044349999999994 38.0 38.0 38.0 35.4 38.0 70-74 35.5629 38.0 38.0 38.0 33.6 38.0 75-79 35.415499999999994 38.0 38.0 38.0 33.0 38.0 80-84 35.4118 38.0 38.0 38.0 33.0 38.0 85-89 35.40875 38.0 38.0 38.0 33.0 38.0 90-94 35.4458 38.0 38.0 38.0 33.4 38.0 95-99 35.33675 38.0 38.0 38.0 33.0 38.0 100-104 35.1355 38.0 38.0 38.0 31.8 38.0 105-109 35.0054 38.0 38.0 38.0 31.0 38.0 110-114 34.6563 38.0 37.6 38.0 27.6 38.0 115-119 34.31105 38.0 36.6 38.0 24.6 38.0 120-124 33.78195 38.0 35.6 38.0 19.0 38.0 125-129 33.520900000000005 38.0 34.8 38.0 17.4 38.0 130-134 33.132 38.0 34.2 38.0 13.4 38.0 135-139 32.62165 38.0 33.2 38.0 12.6 38.0 140-144 32.189 38.0 33.0 38.0 9.4 38.0 145-149 30.7819 38.0 31.0 38.0 2.0 38.0 150-151 24.714375 32.5 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 36.0 3 10.0 4 13.0 5 10.0 6 9.0 7 4.0 8 6.0 9 7.0 10 7.0 11 10.0 12 8.0 13 6.0 14 4.0 15 11.0 16 22.0 17 27.0 18 11.0 19 9.0 20 5.0 21 12.0 22 13.0 23 14.0 24 16.0 25 13.0 26 24.0 27 23.0 28 24.0 29 20.0 30 30.0 31 42.0 32 63.0 33 111.0 34 147.0 35 252.0 36 571.0 37 2410.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.05802562170309 16.302436573725196 12.81085154483798 21.828686259733736 2 29.01281085154484 21.225822657623713 25.04395880432052 24.717407686510928 3 24.61035696329814 25.666163901458017 26.646556058320765 23.076923076923077 4 29.590555136900278 30.36925395629239 16.578749058025622 23.461441848781714 5 28.284350665661893 33.43381060035167 17.608641044963576 20.67319768902286 6 24.547283702213278 32.04225352112676 20.598591549295776 22.811871227364186 7 23.300727363932783 18.459994983697015 33.43365939302734 24.805618259342864 8 23.551542513167796 22.598444946074743 23.85252069224981 29.99749184850765 9 25.376884422110553 23.517587939698494 23.14070351758794 27.964824120603016 10-14 27.130888476395924 25.1592836000602 22.038830080770584 25.67099784277329 15-19 27.357403976163052 24.437878712003606 23.08578296359357 25.118934348239776 20-24 27.054931836407377 24.894747393744986 23.050320769847634 25.0 25-29 27.46570541704215 24.77721037348553 22.69450285370982 25.062581355762493 30-34 26.815950305580603 23.880372708145476 24.32621981765354 24.97745716862038 35-39 26.517427884615387 24.178685897435898 23.45753205128205 25.846354166666668 40-44 27.5164086377073 24.249711909414298 23.573325316899645 24.660554135978757 45-49 27.337444227202084 24.239233970020553 23.45716147791648 24.96616032486088 50-54 26.569079606978143 24.333266492881492 24.147784239021455 24.94986966111891 55-59 26.69973445563405 24.43509193847387 24.184578385690667 24.68059522020141 60-64 26.445079460570515 25.1566651626811 24.02867599137715 24.369579385371235 65-69 25.978326309452136 25.401364639775238 23.575155528797914 25.04515352197472 70-74 26.72314401724397 25.344628803448792 23.3495413303925 24.582685848914732 75-79 26.648282777638503 24.938581098019554 23.865630483830532 24.547505640511407 80-84 26.63926208141167 25.195508321636257 23.85702827351113 24.308201323440947 85-89 26.784012837871725 25.169249285391903 24.04092071611253 24.00581716062384 90-94 26.405451448040886 25.38831546247119 24.311053211744664 23.89517987774326 95-99 27.12187296335288 25.292023863237578 24.22419411440317 23.361909059006365 100-104 27.1407110665999 25.082623935903857 23.83074611917877 23.945918878317478 105-109 27.40610916374562 25.363044566850274 24.066099148723087 23.16474712068102 110-114 27.41765679049481 25.89863137313882 23.72787887902943 22.955832957336945 115-119 27.73214464589803 25.423219473104275 23.88059701492537 22.964038866072322 120-124 27.708792309232926 25.270378529941915 23.968555978369718 23.052273182455437 125-129 27.731808836066396 25.369841031041574 24.111127827089916 22.787222305802114 130-134 28.34937825912555 25.987765744083436 23.97212194143602 21.690734055354994 135-139 28.36936349500928 26.13231679791343 23.499021919044992 21.9992977880323 140-144 28.516957656030506 25.78266104756171 24.07184427051977 21.62853702588802 145-149 28.991828345114552 25.97383065122575 23.677746026971473 21.35659497668822 150-151 29.860849943587812 26.074965525886924 23.429860849943587 20.634323680581673 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 1.0 2 1.0 3 0.0 4 0.5 5 0.5 6 1.0 7 1.0 8 0.0 9 0.5 10 1.0 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.5 22 0.5 23 1.0 24 1.0 25 0.5 26 3.5 27 4.0 28 3.5 29 6.5 30 11.5 31 13.5 32 10.0 33 15.0 34 25.5 35 29.0 36 33.5 37 44.5 38 67.5 39 80.5 40 97.0 41 123.0 42 139.5 43 152.0 44 143.0 45 134.5 46 142.5 47 156.5 48 167.0 49 166.0 50 154.0 51 139.5 52 137.5 53 135.0 54 128.0 55 122.5 56 118.5 57 113.5 58 103.5 59 104.0 60 92.5 61 81.5 62 80.0 63 78.5 64 77.5 65 64.0 66 63.0 67 64.0 68 62.5 69 53.0 70 45.5 71 41.5 72 30.0 73 28.0 74 27.0 75 21.5 76 15.0 77 13.5 78 10.5 79 5.5 80 2.5 81 1.5 82 1.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.475 3 0.5499999999999999 4 0.475 5 0.475 6 0.6 7 0.325 8 0.325 9 0.5 10-14 0.335 15-19 0.155 20-24 0.24 25-29 0.13 30-34 0.19 35-39 0.16 40-44 0.20500000000000002 45-49 0.265 50-54 0.26 55-59 0.20500000000000002 60-64 0.265 65-69 0.33999999999999997 70-74 0.255 75-79 0.27499999999999997 80-84 0.26 85-89 0.295 90-94 0.21 95-99 0.265 100-104 0.15 105-109 0.15 110-114 0.265 115-119 0.16999999999999998 120-124 0.13999999999999999 125-129 0.295 130-134 0.27999999999999997 135-139 0.315 140-144 0.33999999999999997 145-149 0.265 150-151 0.2875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.2 #Duplication Level Percentage of deduplicated Percentage of total 1 98.05093555093555 94.325 2 1.5332640332640333 2.9499999999999997 3 0.2858627858627859 0.8250000000000001 4 0.0 0.0 5 0.02598752598752599 0.125 6 0.02598752598752599 0.15 7 0.0 0.0 8 0.02598752598752599 0.2 9 0.0 0.0 >10 0.05197505197505198 1.425 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 43 1.075 Illumina Single End PCR Primer 1 (100% over 50bp) GCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCC 14 0.35000000000000003 No Hit GCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGG 8 0.2 No Hit GAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCC 6 0.15 No Hit GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.3625 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.8625 0.0 0.0 0.0 0.0 88-89 1.075 0.0 0.0 0.0 0.0 90-91 1.25 0.0 0.0 0.0 0.0 92-93 1.525 0.0 0.0 0.0 0.0 94-95 1.9 0.0 0.0 0.0 0.0 96-97 2.1500000000000004 0.0 0.0 0.0 0.0 98-99 2.5 0.0 0.0 0.0 0.0 100-101 3.0374999999999996 0.0 0.0 0.0 0.0 102-103 3.55 0.0 0.0 0.0 0.0 104-105 3.9875 0.0 0.0 0.0 0.0 106-107 4.375 0.0 0.0 0.0 0.0 108-109 4.800000000000001 0.0 0.0 0.0 0.0 110-111 5.2625 0.0 0.0 0.0 0.0 112-113 5.800000000000001 0.0 0.0 0.0 0.0 114-115 6.525 0.0 0.0 0.0 0.0 116-117 7.075 0.0 0.0 0.0 0.0 118-119 7.775 0.0 0.0 0.0 0.0 120-121 8.5375 0.0 0.0 0.0 0.0 122-123 9.1875 0.0 0.0 0.0 0.0 124-125 10.1 0.0 0.0 0.0 0.0 126-127 10.850000000000001 0.0 0.0 0.0 0.0 128-129 11.524999999999999 0.0 0.0 0.0 0.0 130-131 12.425 0.0 0.0 0.0 0.0 132-133 13.2625 0.0 0.0 0.0 0.0 134-135 14.087499999999999 0.0 0.0 0.0 0.0 136-137 14.8125 0.0 0.0 0.0 0.0 138-139 15.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGTGCT 10 0.006671361 146.12659 9 CTGCACA 10 0.006671361 146.12659 8 CCCCCCC 35 0.0036372216 20.614285 25-29 >>END_MODULE Read 708923 spots for SRR5579245.sra Written 708923 spots for SRR5579245.sra Read 708923 spots for SRR5579245.sra Written 708923 spots for SRR5579245.sra Read 708923 spots for SRR5579245.sra Written 708923 spots for SRR5579245.sra Read 708923 spots for SRR5579245.sra Written 708923 spots for SRR5579245.sra Read 708923 spots for SRR5579245.sra Written 708923 spots for SRR5579245.sra Read 708923 spots for SRR5579245.sra Written 708923 spots for SRR5579245.sra Read 708923 spots for SRR5579245.sra Written 708923 spots for SRR5579245.sra Read 708923 spots for SRR5579245.sra Written 708923 spots for SRR5579245.sra Read 708923 spots for SRR5579245.sra Written 708923 spots for SRR5579245.sra Read 708923 spots for SRR5579245.sra Written 708923 spots for SRR5579245.sra Read 708923 spots for SRR5579245.sra Written 708923 spots for SRR5579245.sra Read 708923 spots for SRR5579245.sra Written 708923 spots for SRR5579245.sra Read 708923 spots for SRR5579245.sra Written 708923 spots for SRR5579245.sra Read 708923 spots for SRR5579245.sra Written 708923 spots for SRR5579245.sra Read 708923 spots for SRR5579245.sra Written 708923 spots for SRR5579245.sra Read 708923 spots for SRR5579245.sra Written 708923 spots for SRR5579245.sra Read 708923 spots for SRR5579245.sra Written 708923 spots for SRR5579245.sra Read 708923 spots for SRR5579245.sra Written 708923 spots for SRR5579245.sra Read 708937 spots for SRR5579245.sra Written 708937 spots for SRR5579245.sra Read 708923 spots for SRR5579245.sra Written 708923 spots for SRR5579245.sra SRR ids: ['SRR5579245.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8np8x656 SRR5579245.sra spots: 14178474 blocks: [[1, 708923], [708924, 1417846], [1417847, 2126769], [2126770, 2835692], [2835693, 3544615], [3544616, 4253538], [4253539, 4962461], [4962462, 5671384], [5671385, 6380307], [6380308, 7089230], [7089231, 7798153], [7798154, 8507076], [8507077, 9215999], [9216000, 9924922], [9924923, 10633845], [10633846, 11342768], [11342769, 12051691], [12051692, 12760614], [12760615, 13469537], [13469538, 14178474]] SRR5579245 file size 4782919 SRR5579245 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579245 SRR5579245_1.fastq SRR5579245_2.fastq Input file: SRR5579245_1.fastq Paired file: SRR5579245_2.fastq trimmed: SRR5579245-trimmed-pair1.fastq, SRR5579245-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 23:20:15 2024 >> started Mon Dec 9 23:20:30 2024 >> done (15.926s) 14178474 read pairs processed; of these: 57109 ( 0.40%) short read pairs filtered out after trimming by size control 247209 ( 1.74%) empty read pairs filtered out after trimming by size control 13874156 (97.85%) read pairs available; of these: 8500234 (61.27%) trimmed read pairs available after processing 5373922 (38.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 16 0.00% 20 21 0.00% 21 29 0.00% 22 21 0.00% 23 30 0.00% 24 31 0.00% 25 30 0.00% 26 32 0.00% 27 36 0.00% 28 46 0.00% 29 49 0.00% 30 43 0.00% 31 65 0.00% 32 48 0.00% 33 30 0.00% 34 53 0.00% 35 85 0.00% 36 60 0.00% 37 63 0.00% 38 61 0.00% 39 50 0.00% 40 73 0.00% 41 107 0.00% 42 91 0.00% 43 106 0.00% 44 149 0.00% 45 193 0.00% 46 206 0.00% 47 225 0.00% 48 223 0.00% 49 265 0.00% 50 298 0.00% 51 337 0.00% 52 392 0.00% 53 408 0.00% 54 427 0.00% 55 507 0.00% 56 526 0.00% 57 649 0.00% 58 739 0.01% 59 746 0.01% 60 961 0.01% 61 975 0.01% 62 1140 0.01% 63 1232 0.01% 64 1477 0.01% 65 1821 0.01% 66 2327 0.02% 67 3439 0.02% 68 6663 0.05% 69 19838 0.14% 70 14797 0.11% 71 6156 0.04% 72 5207 0.04% 73 4928 0.04% 74 5044 0.04% 75 5466 0.04% 76 5737 0.04% 77 6167 0.04% 78 6803 0.05% 79 7813 0.06% 80 8508 0.06% 81 9882 0.07% 82 10953 0.08% 83 12233 0.09% 84 14869 0.11% 85 17067 0.12% 86 18422 0.13% 87 19264 0.14% 88 20258 0.15% 89 21316 0.15% 90 23333 0.17% 91 23586 0.17% 92 25092 0.18% 93 26186 0.19% 94 28058 0.20% 95 28580 0.21% 96 29534 0.21% 97 30130 0.22% 98 31222 0.23% 99 32087 0.23% 100 34086 0.25% 101 36057 0.26% 102 38573 0.28% 103 40698 0.29% 104 42043 0.30% 105 43408 0.31% 106 44166 0.32% 107 44366 0.32% 108 45413 0.33% 109 46074 0.33% 110 47368 0.34% 111 50072 0.36% 112 52368 0.38% 113 54463 0.39% 114 56400 0.41% 115 58104 0.42% 116 58291 0.42% 117 58426 0.42% 118 57810 0.42% 119 58923 0.42% 120 60770 0.44% 121 61071 0.44% 122 64230 0.46% 123 67851 0.49% 124 69662 0.50% 125 71246 0.51% 126 72580 0.52% 127 71715 0.52% 128 72191 0.52% 129 73509 0.53% 130 74639 0.54% 131 75838 0.55% 132 79923 0.58% 133 83106 0.60% 134 85676 0.62% 135 88455 0.64% 136 92769 0.67% 137 94313 0.68% 138 96752 0.70% 139 98649 0.71% 140 101178 0.73% 141 107590 0.78% 142 115185 0.83% 143 122308 0.88% 144 135798 0.98% 145 154695 1.11% 146 182246 1.31% 147 235102 1.69% 148 339917 2.45% 149 656534 4.73% 150 3281476 23.65% 151 5373922 38.73% 13874156 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=31 prefix-density=0.63 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=29.47 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.2 sequence=TTTTTTTTTCGCATATAACCACATTCAAATTGACCTCCCTCAGGAAGCTAAGAAATACTATCTCGGCAATAGGATTGTAGCCCAGGATGAGTCCCTCAGCGTGACGCAGTAAACTAGTAGCATCCCGATCTTTTCCCTATCTAATTCACCTCCTATTAGGAGCCGATCGTGCTTGTGCGCCGGCAAAACTTTTCAGGCGAATTTCCGCCCCTGGCGCTCTAGGCTACTACGTGCGCGATATGACAAGTTAACAAGACGGCGCAGGTTGATGCTTCCAATAAACATGATCTTTCTGCTCCGCTGAGAAGTACACCTTTTTGCTAGCATCTCGCACGGCAAGAGCGATTGCCGAGCTTAGAGCGTATCTTCCGGGATCGGGCAAAGGGGCAACTCGAGCTAATCTCCCCAGCGGCTAGCATGTGTAGTGCGCCATATCATATCCAAGATAGTGTAGGACTCGTCGCATTGGATGACGATGCCTAGTACTGTGCGCCAATTAGGTCGTCATTGC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=25 prefix-density=0.75 prefix-fanout=2.0 sequence=GTCCGCATCATCGGCTTCGACAACACCCGGCAGGTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGCTGCGAGGAATCCGGCAAGGCATAAACAACCAAGGACAGCTCCGTATTAAGATGGACCATATATAAAGTGTCAGCTCAGTTTTGTCAACTCTGACATTGCTTTGAGTTTTCTATTTTTCATCCCCAAGATTGTTGTTGTGTGTAGCAACCTGGCTCTCGATCGAGGAGCTAGCTTGCATATGTGAATTCCTAAAAGTTTGAAAGAGTTGAGAAAATCACTTTCTTTCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=34.50 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.2 sequence=GGAGATTGTCTCGTACGGTTAAGAGCCTCCGCCCGTCTCTGGGACTATGGACGGGCACGCTCATATCAGGCTATATTTGGTCCGGGTTATTATCGTCGCGGTTACCGTAATACTTCAGATCAGTTAAGTAGGGCCATATGCCTCGGGAATAAGCTGACGGTGACAAGGTTTCCCCCTAATCGAGACGCTGCAATAACACAGGGGCATACAGTAACCAGGCAAGAGTTCAATCGCTTAGTTTCGTGGCGGGATTTGAGGAAAACTGCGACTGTTCTTTAACCAAACATCCGTGCGATTCGTGCCACTCGTAGACGGCATCTCACAGTCACTGAAGGCTATTAAAGAGTTAGCACCCACCATTGGATGAA SRR5579245 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 23:21:31 Started mapping on | Dec 09 23:21:31 Finished on | Dec 09 23:27:51 Mapping speed, Million of reads per hour | 131.44 Number of input reads | 13874156 Average input read length | 284 UNIQUE READS: Uniquely mapped reads number | 11751075 Uniquely mapped reads % | 84.70% Average mapped length | 284.79 Number of splices: Total | 10608303 Number of splices: Annotated (sjdb) | 9839829 Number of splices: GT/AG | 10465540 Number of splices: GC/AG | 128946 Number of splices: AT/AC | 5636 Number of splices: Non-canonical | 8181 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.34 Insertion rate per base | 0.00% Insertion average length | 1.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 169845 % of reads mapped to multiple loci | 1.22% Number of reads mapped to too many loci | 23026 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.10% % of reads unmapped: other | 0.81% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1986606 1986606 1986606 N_multimapping 169845 169845 169845 N_noFeature 345023 11338623 465516 N_ambiguous 360568 1920 68911 UnstrandedReadsAssigned:11045484 PositiveStrandReadsAssigned:410532 NegativeStrandReadsAssigned:11216648 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=138 echo kmer=133 SRR5579245 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579245-trimmed-pair1.fastq SRR5579245-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,874,156 reads, 11,324,287 reads pseudoaligned [quant] estimated average fragment length: 214.664 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,119 rounds 52973 SRR5579245.ke.tsv 35125 SRR5579245.se.tsv 88098 total ==> SRR5579245.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 722.595 2.94825 0.415076 PNS24247 1044 830.336 12.8444 1.57368 PNS24249 1928 1714.34 31.2625 1.85518 PNS24246 1044 830.336 12.8444 1.57368 PNS24248 1044 830.336 12.8444 1.57368 PNS24244 1471 1257.34 103.256 8.35453 PNS24243 293 113.388 0 0 KQK14069 1603 1389.34 5381.05 394.02 KQK14071 474 268.728 81.0529 30.6841 ==> SRR5579245.se.tsv <== BRADI_1g14170v3 5627 BRADI_1g53295v3 53 BRADI_1g59795v3 230 BRADI_1g07683v3 0 BRADI_1g00485v3 34 BRADI_1g20270v3 1318 BRADI_1g74790v3 186 BRADI_1g09890v3 11 BRADI_1g77505v3 484 BRADI_1g48960v3 0 SRR5579245 completed mapping pipeline successfully