Starting /dee2/code/volunteer_pipeline.sh SRR5579246 current disk space = 1523152855040 free memory = 1566487108 SRR5579246 SRAfilesize e458594aa5e81f0f67aca24804469f76 SRR5579246.sra SRR5579246.sra file validated SRR5579246 is paired end SRR5579246 is conventional basespace SRR5579246 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579246_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.09975 34.0 33.0 34.0 30.0 34.0 2 32.9935 34.0 33.0 34.0 31.0 34.0 3 33.16575 34.0 33.0 34.0 32.0 34.0 4 33.31975 34.0 33.0 34.0 33.0 34.0 5 33.3315 34.0 33.0 34.0 33.0 34.0 6 37.23025 38.0 38.0 38.0 36.0 38.0 7 37.435 38.0 38.0 38.0 37.0 38.0 8 37.50525 38.0 38.0 38.0 38.0 38.0 9 37.56925 38.0 38.0 38.0 38.0 38.0 10-14 37.5225 38.0 38.0 38.0 38.0 38.0 15-19 37.478449999999995 38.0 38.0 38.0 37.8 38.0 20-24 37.45505 38.0 38.0 38.0 37.8 38.0 25-29 37.354549999999996 38.0 38.0 38.0 37.0 38.0 30-34 37.35895000000001 38.0 38.0 38.0 37.4 38.0 35-39 37.18695 38.0 38.0 38.0 37.0 38.0 40-44 37.11370000000001 38.0 38.0 38.0 36.6 38.0 45-49 37.0729 38.0 38.0 38.0 36.2 38.0 50-54 37.26145 38.0 38.0 38.0 37.0 38.0 55-59 37.181450000000005 38.0 38.0 38.0 36.8 38.0 60-64 37.1734 38.0 38.0 38.0 36.6 38.0 65-69 36.8723 38.0 38.0 38.0 35.2 38.0 70-74 36.89665 38.0 38.0 38.0 35.8 38.0 75-79 36.9488 38.0 38.0 38.0 35.8 38.0 80-84 36.78435 38.0 38.0 38.0 35.0 38.0 85-89 36.7094 38.0 38.0 38.0 34.8 38.0 90-94 36.5556 38.0 38.0 38.0 34.4 38.0 95-99 36.555600000000005 38.0 38.0 38.0 34.4 38.0 100-104 36.25925 38.0 38.0 38.0 33.8 38.0 105-109 36.1697 38.0 38.0 38.0 33.6 38.0 110-114 36.1481 38.0 37.8 38.0 33.4 38.0 115-119 35.73909999999999 38.0 37.0 38.0 31.4 38.0 120-124 35.80285 38.0 36.8 38.0 32.4 38.0 125-129 35.63345 38.0 36.4 38.0 31.4 38.0 130-134 35.227500000000006 38.0 36.0 38.0 29.2 38.0 135-139 35.1751 38.0 35.8 38.0 29.6 38.0 140-144 34.82555 38.0 35.2 38.0 28.6 38.0 145-149 34.0279 38.0 34.2 38.0 25.4 38.0 150-151 30.067875 35.5 28.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 3.0 14 3.0 15 1.0 16 2.0 17 4.0 18 4.0 19 5.0 20 4.0 21 4.0 22 2.0 23 13.0 24 7.0 25 12.0 26 23.0 27 27.0 28 32.0 29 32.0 30 36.0 31 47.0 32 69.0 33 103.0 34 139.0 35 220.0 36 585.0 37 2621.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.589425411383864 14.75586727812247 9.306717021850552 30.347990288643107 2 23.400000000000002 18.4 35.875 22.325 3 21.349999999999998 25.575 25.974999999999998 27.1 4 25.55 31.7 21.75 21.0 5 24.625 33.525 22.725 19.125 6 19.975 33.650000000000006 23.1 23.275000000000002 7 15.925 19.6 44.175 20.3 8 19.900000000000002 19.25 29.65 31.2 9 20.175 19.725 30.275000000000002 29.825000000000003 10-14 22.835 26.415 25.39 25.36 15-19 22.735 25.95 25.724999999999998 25.590000000000003 20-24 23.087308730873087 25.63256325632563 26.55765576557656 24.722472247224722 25-29 22.945 26.235000000000003 25.36 25.46 30-34 22.745 25.53 26.115 25.61 35-39 22.650000000000002 25.575 26.445 25.330000000000002 40-44 23.735 25.47 25.759999999999998 25.035 45-49 22.96 26.25 25.314999999999998 25.474999999999998 50-54 22.665 24.884999999999998 26.31 26.14 55-59 23.16 25.895000000000003 26.009999999999998 24.935 60-64 23.14 25.91 25.53 25.419999999999998 65-69 23.395 25.885 25.525 25.195 70-74 23.055 26.334999999999997 25.785000000000004 24.825 75-79 23.195 25.490000000000002 25.840000000000003 25.474999999999998 80-84 22.96 25.305 25.895000000000003 25.840000000000003 85-89 23.34 25.11 26.07 25.480000000000004 90-94 23.565 25.305 25.729999999999997 25.4 95-99 23.205000000000002 25.495 26.215 25.085 100-104 23.355 25.83 25.8 25.014999999999997 105-109 23.865 25.085 25.595000000000002 25.455 110-114 23.455000000000002 25.759999999999998 25.490000000000002 25.295 115-119 23.549999999999997 25.885 24.98 25.585 120-124 23.72 25.790000000000003 24.945 25.545 125-129 23.79 25.525 25.09 25.595000000000002 130-134 23.84 25.82 25.05 25.290000000000003 135-139 23.25 25.55 24.775 26.424999999999997 140-144 23.195 26.174999999999997 24.490000000000002 26.14 145-149 23.225 26.115 24.57 26.090000000000003 150-151 23.7875 25.7375 24.3625 26.1125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 1.5 26 2.5 27 2.5 28 3.0 29 3.5 30 7.0 31 11.5 32 17.0 33 24.5 34 31.0 35 47.0 36 63.5 37 76.5 38 97.0 39 118.5 40 131.5 41 146.5 42 175.5 43 200.0 44 214.0 45 218.5 46 221.0 47 201.0 48 182.5 49 172.5 50 155.0 51 144.5 52 123.0 53 103.0 54 97.5 55 101.5 56 99.0 57 87.5 58 79.0 59 79.5 60 72.5 61 58.5 62 53.5 63 46.0 64 47.5 65 49.5 66 41.5 67 35.0 68 27.5 69 25.5 70 26.0 71 21.0 72 13.5 73 12.5 74 10.5 75 5.0 76 3.0 77 3.5 78 2.5 79 0.5 80 0.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.324999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.01 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.345582683111 98.675 2 0.6292474200855777 1.25 3 0.025169896803423106 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.5 0.0 0.0 0.0 0.0 86-87 0.6 0.0 0.0 0.0 0.0 88-89 0.7124999999999999 0.0 0.0 0.0 0.0 90-91 0.825 0.0 0.0 0.0 0.0 92-93 1.0125000000000002 0.0 0.0 0.0 0.0 94-95 1.3250000000000002 0.0 0.0 0.0 0.0 96-97 1.575 0.0 0.0 0.0 0.0 98-99 1.725 0.0 0.0 0.0 0.0 100-101 1.9875 0.0 0.0 0.0 0.0 102-103 2.3875 0.0 0.0 0.0 0.0 104-105 2.7875 0.0 0.0 0.0 0.0 106-107 3.3 0.0 0.0 0.0 0.0 108-109 3.6375 0.0 0.0 0.0 0.0 110-111 4.012499999999999 0.0 0.0 0.0 0.0 112-113 4.375 0.0 0.0 0.0 0.0 114-115 4.875 0.0 0.0 0.0 0.0 116-117 5.2875 0.0 0.0 0.0 0.0 118-119 5.8875 0.0 0.0 0.0 0.0 120-121 6.3375 0.0 0.0 0.0 0.0 122-123 6.7625 0.0 0.0 0.0 0.0 124-125 7.1875 0.0 0.0 0.0 0.0 126-127 7.7375 0.0 0.0 0.0 0.0 128-129 8.375 0.0 0.0 0.0 0.0 130-131 9.0125 0.0 0.0 0.0 0.0 132-133 9.725000000000001 0.0 0.0 0.0 0.0 134-135 10.475000000000001 0.0 0.0 0.0 0.0 136-137 11.2375 0.0 0.0 0.0 0.0 138-139 11.962499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCACTCC 10 0.0068396386 144.9375 3 CAGATCG 60 0.00450478 14.49375 135-139 >>END_MODULE SRR5579246 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579246_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7435 33.0 33.0 34.0 32.0 34.0 2 32.94375 34.0 33.0 34.0 32.0 34.0 3 32.84275 34.0 33.0 34.0 32.0 34.0 4 32.68 34.0 33.0 34.0 32.0 34.0 5 32.83675 34.0 33.0 34.0 32.0 34.0 6 36.84575 38.0 38.0 38.0 36.0 38.0 7 36.99625 38.0 38.0 38.0 37.0 38.0 8 36.94575 38.0 38.0 38.0 37.0 38.0 9 36.90225 38.0 38.0 38.0 37.0 38.0 10-14 36.90560000000001 38.0 38.0 38.0 36.8 38.0 15-19 36.907000000000004 38.0 38.0 38.0 36.8 38.0 20-24 36.9219 38.0 38.0 38.0 36.8 38.0 25-29 36.8178 38.0 38.0 38.0 36.4 38.0 30-34 36.8627 38.0 38.0 38.0 36.6 38.0 35-39 36.95695 38.0 38.0 38.0 37.0 38.0 40-44 36.980399999999996 38.0 38.0 38.0 37.0 38.0 45-49 36.88844999999999 38.0 38.0 38.0 37.0 38.0 50-54 36.83515 38.0 38.0 38.0 36.6 38.0 55-59 36.695350000000005 38.0 38.0 38.0 36.0 38.0 60-64 36.76429999999999 38.0 38.0 38.0 36.0 38.0 65-69 36.59665 38.0 38.0 38.0 35.8 38.0 70-74 36.391949999999994 38.0 38.0 38.0 35.0 38.0 75-79 36.31425 38.0 38.0 38.0 34.2 38.0 80-84 36.342099999999995 38.0 38.0 38.0 34.6 38.0 85-89 36.290949999999995 38.0 38.0 38.0 34.0 38.0 90-94 36.32195 38.0 38.0 38.0 34.2 38.0 95-99 36.26465 38.0 38.0 38.0 34.0 38.0 100-104 36.03574999999999 38.0 38.0 38.0 33.8 38.0 105-109 35.90615 38.0 38.0 38.0 33.4 38.0 110-114 35.5488 38.0 37.4 38.0 31.6 38.0 115-119 35.23545 38.0 37.0 38.0 29.8 38.0 120-124 34.7567 38.0 36.0 38.0 27.0 38.0 125-129 34.48049999999999 38.0 35.4 38.0 25.0 38.0 130-134 34.5932 38.0 36.0 38.0 27.0 38.0 135-139 34.107150000000004 38.0 34.4 38.0 23.8 38.0 140-144 33.53935 38.0 33.2 38.0 21.4 38.0 145-149 32.677800000000005 38.0 33.0 38.0 10.8 38.0 150-151 27.796125 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 9.0 4 2.0 5 1.0 6 2.0 7 1.0 8 1.0 9 2.0 10 5.0 11 3.0 12 2.0 13 3.0 14 6.0 15 6.0 16 7.0 17 14.0 18 4.0 19 11.0 20 4.0 21 5.0 22 5.0 23 14.0 24 13.0 25 16.0 26 14.0 27 25.0 28 33.0 29 39.0 30 59.0 31 54.0 32 79.0 33 83.0 34 144.0 35 248.0 36 536.0 37 2535.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.7535723238907 16.16946603158686 11.331160691902733 25.745800952619703 2 27.766649974962444 21.907861792689033 28.96845267901853 21.357035553329993 3 23.362609786700126 24.416562107904642 28.306148055207025 23.914680050188206 4 28.170426065162907 32.45614035087719 18.24561403508772 21.127819548872182 5 26.790185277916873 35.202804206309466 19.404106159238857 18.602904356534804 6 22.291718789091817 34.10057543157368 20.390292719539655 23.217413059794847 7 22.075 15.75 37.95 24.224999999999998 8 21.525 20.150000000000002 26.1 32.225 9 23.84884884884885 22.12212212212212 25.5005005005005 28.52852852852853 10-14 25.27516509905944 26.505903542125274 23.85431258755253 24.36461877126276 15-19 25.99129956497825 24.91624581229061 24.64123206160308 24.451222561128056 20-24 25.14380033011554 25.48892112239284 25.10378632521382 24.263492222277797 25-29 26.100220044008804 25.96019203840768 23.83476695339068 24.10482096419284 30-34 25.606522935320896 25.721574708618878 24.451002951328096 24.22089940473213 35-39 25.486663664114495 26.02712305459641 23.90031526797778 24.585898013311315 40-44 25.915 25.7 24.55 23.835 45-49 25.019999999999996 25.490000000000002 24.255 25.235000000000003 50-54 25.68513702740548 25.20504100820164 24.749949989998 24.359871974394878 55-59 25.76757675767577 25.92759275927593 24.207420742074206 24.097409740974097 60-64 25.75916754214818 25.939266596628148 24.70358697283506 23.597978888388614 65-69 25.677974582207547 25.407785449814867 24.587211047733412 24.32702892024417 70-74 25.54916187140355 25.66925193895422 24.96872654490868 23.81285964473355 75-79 26.214660995746808 25.494120590442833 24.7935951963973 23.49762321741306 80-84 25.237618809404704 25.6328164082041 24.537268634317158 24.592296148074038 85-89 26.098268788151707 25.307715400780545 24.627239067347144 23.966776743720605 90-94 25.33006601320264 25.83016603320664 24.65993198639728 24.179835967193437 95-99 25.272527252725276 25.542554255425543 24.892489248924893 24.292429242924293 100-104 25.433815072260842 25.41381207181077 25.633845076761514 23.518527779166874 105-109 25.681284064203208 25.821291064553225 24.941247062353117 23.556177808890443 110-114 26.325 25.735000000000003 24.8 23.14 115-119 26.475590236094437 26.300520208083235 24.539815926370547 22.68407362945178 120-124 27.095000000000002 25.555 24.605 22.745 125-129 26.677004652093444 26.576959631834324 24.586063728677903 22.15997198739433 130-134 27.16679169792448 26.076519129782444 24.426106526631656 22.330582645661416 135-139 26.60564225690276 26.87074829931973 24.559823929571827 21.963785514205682 140-144 27.300920368147256 26.15046018407363 24.449779911964786 22.098839535814328 145-149 27.316365818290915 26.596329816490826 24.036201810090503 22.051102555127756 150-151 27.147680380142553 26.73502563461298 24.159059647367762 21.958234337876704 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.0 23 0.5 24 0.0 25 2.0 26 2.0 27 0.5 28 3.0 29 5.0 30 10.0 31 16.0 32 18.5 33 16.5 34 23.0 35 36.0 36 44.0 37 66.0 38 81.0 39 99.5 40 117.0 41 130.5 42 157.0 43 155.0 44 162.0 45 202.5 46 200.5 47 181.5 48 178.0 49 162.5 50 149.0 51 159.5 52 142.0 53 111.5 54 113.5 55 103.5 56 105.0 57 105.5 58 98.0 59 96.5 60 86.0 61 77.5 62 72.0 63 68.0 64 64.0 65 61.0 66 53.0 67 43.0 68 47.0 69 40.0 70 27.5 71 30.5 72 29.0 73 17.0 74 7.5 75 5.5 76 5.0 77 3.0 78 2.5 79 1.5 80 0.0 81 0.0 82 1.0 83 1.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.15 3 0.375 4 0.25 5 0.15 6 0.075 7 0.0 8 0.0 9 0.1 10-14 0.06 15-19 0.005 20-24 0.034999999999999996 25-29 0.02 30-34 0.045 35-39 0.08499999999999999 40-44 0.0 45-49 0.0 50-54 0.02 55-59 0.01 60-64 0.055 65-69 0.06999999999999999 70-74 0.075 75-79 0.075 80-84 0.05 85-89 0.06999999999999999 90-94 0.02 95-99 0.01 100-104 0.015 105-109 0.005 110-114 0.0 115-119 0.04 120-124 0.0 125-129 0.045 130-134 0.025 135-139 0.04 140-144 0.04 145-149 0.005 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29399899142713 98.45 2 0.5799293998991427 1.15 3 0.10085728693898136 0.3 4 0.02521432173474534 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.5875 0.0 0.0 0.0 0.0 88-89 0.7375 0.0 0.0 0.0 0.0 90-91 0.85 0.0 0.0 0.0 0.0 92-93 1.025 0.0 0.0 0.0 0.0 94-95 1.3250000000000002 0.0 0.0 0.0 0.0 96-97 1.625 0.0 0.0 0.0 0.0 98-99 1.8125 0.0 0.0 0.0 0.0 100-101 2.0625 0.0 0.0 0.0 0.0 102-103 2.4625 0.0 0.0 0.0 0.0 104-105 2.8375 0.0 0.0 0.0 0.0 106-107 3.3375 0.0 0.0 0.0 0.0 108-109 3.6500000000000004 0.0 0.0 0.0 0.0 110-111 4.0375 0.0 0.0 0.0 0.0 112-113 4.425 0.0 0.0 0.0 0.0 114-115 4.9 0.0 0.0 0.0 0.0 116-117 5.3 0.0 0.0 0.0 0.0 118-119 5.8875 0.0 0.0 0.0 0.0 120-121 6.3375 0.0 0.0 0.0 0.0 122-123 6.7625 0.0 0.0 0.0 0.0 124-125 7.1875 0.0 0.0 0.0 0.0 126-127 7.7375 0.0 0.0 0.0 0.0 128-129 8.412500000000001 0.0 0.0 0.0 0.0 130-131 9.0625 0.0 0.0 0.0 0.0 132-133 9.774999999999999 0.0 0.0 0.0 0.0 134-135 10.45 0.0 0.0 0.0 0.0 136-137 11.149999999999999 0.0 0.0 0.0 0.0 138-139 11.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATGGGA 10 0.0067725983 145.39241 145 >>END_MODULE Read 1039837 spots for SRR5579246.sra Written 1039837 spots for SRR5579246.sra Read 1039837 spots for SRR5579246.sra Written 1039837 spots for SRR5579246.sra Read 1039837 spots for SRR5579246.sra Written 1039837 spots for SRR5579246.sra Read 1039837 spots for SRR5579246.sra Written 1039837 spots for SRR5579246.sra Read 1039837 spots for SRR5579246.sra Written 1039837 spots for SRR5579246.sra Read 1039837 spots for SRR5579246.sra Written 1039837 spots for SRR5579246.sra Read 1039837 spots for SRR5579246.sra Written 1039837 spots for SRR5579246.sra Read 1039837 spots for SRR5579246.sra Written 1039837 spots for SRR5579246.sra Read 1039837 spots for SRR5579246.sra Written 1039837 spots for SRR5579246.sra Read 1039837 spots for SRR5579246.sra Written 1039837 spots for SRR5579246.sra Read 1039837 spots for SRR5579246.sra Written 1039837 spots for SRR5579246.sra Read 1039837 spots for SRR5579246.sra Written 1039837 spots for SRR5579246.sra Read 1039837 spots for SRR5579246.sra Written 1039837 spots for SRR5579246.sra Read 1039837 spots for SRR5579246.sra Written 1039837 spots for SRR5579246.sra Read 1039837 spots for SRR5579246.sra Written 1039837 spots for SRR5579246.sra Read 1039844 spots for SRR5579246.sra Written 1039844 spots for SRR5579246.sra Read 1039837 spots for SRR5579246.sra Written 1039837 spots for SRR5579246.sra Read 1039837 spots for SRR5579246.sra Written 1039837 spots for SRR5579246.sra Read 1039837 spots for SRR5579246.sra Written 1039837 spots for SRR5579246.sra Read 1039837 spots for SRR5579246.sra Written 1039837 spots for SRR5579246.sra SRR ids: ['SRR5579246.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l9hl59vn SRR5579246.sra spots: 20796747 blocks: [[1, 1039837], [1039838, 2079674], [2079675, 3119511], [3119512, 4159348], [4159349, 5199185], [5199186, 6239022], [6239023, 7278859], [7278860, 8318696], [8318697, 9358533], [9358534, 10398370], [10398371, 11438207], [11438208, 12478044], [12478045, 13517881], [13517882, 14557718], [14557719, 15597555], [15597556, 16637392], [16637393, 17677229], [17677230, 18717066], [18717067, 19756903], [19756904, 20796747]] SRR5579246 file size 7025634 SRR5579246 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579246 SRR5579246_1.fastq SRR5579246_2.fastq Input file: SRR5579246_1.fastq Paired file: SRR5579246_2.fastq trimmed: SRR5579246-trimmed-pair1.fastq, SRR5579246-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 23:22:45 2024 >> started Mon Dec 9 23:23:07 2024 >> done (22.163s) 20796747 read pairs processed; of these: 33812 ( 0.16%) short read pairs filtered out after trimming by size control 79713 ( 0.38%) empty read pairs filtered out after trimming by size control 20683222 (99.45%) read pairs available; of these: 10894705 (52.67%) trimmed read pairs available after processing 9788517 (47.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 17 0.00% 20 16 0.00% 21 15 0.00% 22 19 0.00% 23 21 0.00% 24 21 0.00% 25 24 0.00% 26 19 0.00% 27 21 0.00% 28 20 0.00% 29 25 0.00% 30 34 0.00% 31 16 0.00% 32 27 0.00% 33 24 0.00% 34 34 0.00% 35 43 0.00% 36 29 0.00% 37 42 0.00% 38 36 0.00% 39 48 0.00% 40 58 0.00% 41 76 0.00% 42 69 0.00% 43 98 0.00% 44 100 0.00% 45 96 0.00% 46 124 0.00% 47 146 0.00% 48 151 0.00% 49 188 0.00% 50 217 0.00% 51 230 0.00% 52 272 0.00% 53 281 0.00% 54 332 0.00% 55 351 0.00% 56 405 0.00% 57 463 0.00% 58 585 0.00% 59 630 0.00% 60 731 0.00% 61 805 0.00% 62 1027 0.00% 63 1113 0.01% 64 1183 0.01% 65 1357 0.01% 66 1595 0.01% 67 1724 0.01% 68 2081 0.01% 69 2737 0.01% 70 3010 0.01% 71 3067 0.01% 72 3478 0.02% 73 3772 0.02% 74 4278 0.02% 75 4870 0.02% 76 5193 0.03% 77 5893 0.03% 78 6534 0.03% 79 7358 0.04% 80 8386 0.04% 81 9334 0.05% 82 10408 0.05% 83 11737 0.06% 84 13841 0.07% 85 15468 0.07% 86 16238 0.08% 87 17254 0.08% 88 18294 0.09% 89 19163 0.09% 90 21035 0.10% 91 22277 0.11% 92 24188 0.12% 93 25885 0.13% 94 27462 0.13% 95 28574 0.14% 96 29999 0.15% 97 30665 0.15% 98 31334 0.15% 99 33815 0.16% 100 35278 0.17% 101 37868 0.18% 102 40016 0.19% 103 41766 0.20% 104 44632 0.22% 105 45750 0.22% 106 45682 0.22% 107 45866 0.22% 108 47725 0.23% 109 48888 0.24% 110 50084 0.24% 111 52674 0.25% 112 55241 0.27% 113 57156 0.28% 114 59320 0.29% 115 61571 0.30% 116 62102 0.30% 117 63526 0.31% 118 63780 0.31% 119 64762 0.31% 120 67179 0.32% 121 68773 0.33% 122 71111 0.34% 123 74528 0.36% 124 77619 0.38% 125 79298 0.38% 126 81514 0.39% 127 81733 0.40% 128 82658 0.40% 129 84918 0.41% 130 85907 0.42% 131 88583 0.43% 132 92322 0.45% 133 96114 0.46% 134 99875 0.48% 135 103861 0.50% 136 108062 0.52% 137 111364 0.54% 138 115819 0.56% 139 120342 0.58% 140 124978 0.60% 141 134612 0.65% 142 144394 0.70% 143 158346 0.77% 144 178242 0.86% 145 205267 0.99% 146 247901 1.20% 147 320169 1.55% 148 464402 2.25% 149 907891 4.39% 150 4710641 22.78% 151 9788517 47.33% 20683222 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=24 prefix-density=0.60 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=18.63 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=1.7 sequence=AAAATGGTATTATAATTATATAGTTGATGTCTTTTGGTCACAAGATGACCAAATTACGCATCACAAGTACAACCCCACGTCAGAAAATGGTAGAAACTTCTATTGCTTATTACAAATTCACATCGAGCCATCCGGCATGCAGTACTGGAAAATAGCGAGTACATATACTCCATGGCATCGCATCCACATCAATGGATCGATCTGTAGGGTCATCTCCATATCTGTATGTATAAGTATACGTTGTATGTATAGGAGTTAACCGGATGAGAGGACTTAGAGCTCCCATGTGTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGGTTCCGTTGGCGACGCCTTCCTTGACGAACGGGTAGGTCTTGAGGTTCTCGAGGGACACGTTCACGGCCTCCTTTTCCAAGACGGCGCATTGGTCATCGAAAGGCATGGAGGCGCACTCGGTCTGCACCTTCTTCTTGGCCGGGAACCCGATCCTGACCCAGTCCTCGACGAAG criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=3.59 fanout-score-rank=19 prefix-density=0.70 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=109.22 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=7.2 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR5579246 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 23:23:51 Started mapping on | Dec 09 23:23:51 Finished on | Dec 09 23:26:50 Mapping speed, Million of reads per hour | 415.98 Number of input reads | 20683222 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 19284853 Uniquely mapped reads % | 93.24% Average mapped length | 289.55 Number of splices: Total | 21439437 Number of splices: Annotated (sjdb) | 20195380 Number of splices: GT/AG | 21153628 Number of splices: GC/AG | 261208 Number of splices: AT/AC | 10991 Number of splices: Non-canonical | 13610 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.36 Insertion rate per base | 0.00% Insertion average length | 1.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 308692 % of reads mapped to multiple loci | 1.49% Number of reads mapped to too many loci | 34551 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.10% % of reads unmapped: other | 1.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1115775 1115775 1115775 N_multimapping 308692 308692 308692 N_noFeature 803237 18711011 1013105 N_ambiguous 437342 3070 73783 UnstrandedReadsAssigned:18044274 PositiveStrandReadsAssigned:570772 NegativeStrandReadsAssigned:18197965 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR5579246 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579246-trimmed-pair1.fastq SRR5579246-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,683,222 reads, 18,384,121 reads pseudoaligned [quant] estimated average fragment length: 254.405 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52973 SRR5579246.ke.tsv 35125 SRR5579246.se.tsv 88098 total ==> SRR5579246.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 683.284 0 0 PNS24247 1044 790.595 66.6412 6.74922 PNS24249 1928 1674.6 41.5364 1.98602 PNS24246 1044 790.595 66.6412 6.74922 PNS24248 1044 790.595 66.6412 6.74922 PNS24244 1471 1217.6 116.54 7.66368 PNS24243 293 105.371 0 0 KQK14069 1603 1349.6 5548.3 329.171 KQK14071 474 245.837 128.39 41.8166 ==> SRR5579246.se.tsv <== BRADI_1g14170v3 6404 BRADI_1g53295v3 141 BRADI_1g59795v3 443 BRADI_1g07683v3 0 BRADI_1g00485v3 39 BRADI_1g20270v3 2516 BRADI_1g74790v3 158 BRADI_1g09890v3 0 BRADI_1g77505v3 323 BRADI_1g48960v3 0 SRR5579246 completed mapping pipeline successfully