Starting /dee2/code/volunteer_pipeline.sh SRR5579247 current disk space = 1523266330624 free memory = 1563102668 SRR5579247 SRAfilesize e1d8f4d68c46870a2735a23f21a301f5 SRR5579247.sra SRR5579247.sra file validated SRR5579247 is paired end SRR5579247 is conventional basespace SRR5579247 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579247_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.733 34.0 33.0 34.0 25.0 34.0 2 32.929 34.0 33.0 34.0 28.0 34.0 3 33.07175 34.0 33.0 34.0 32.0 34.0 4 33.30125 34.0 33.0 34.0 32.0 34.0 5 33.41825 34.0 33.0 34.0 33.0 34.0 6 37.224 38.0 38.0 38.0 36.0 38.0 7 37.5195 38.0 38.0 38.0 37.0 38.0 8 37.561 38.0 38.0 38.0 38.0 38.0 9 37.64825 38.0 38.0 38.0 38.0 38.0 10-14 37.5689 38.0 38.0 38.0 38.0 38.0 15-19 37.52685 38.0 38.0 38.0 38.0 38.0 20-24 37.4831 38.0 38.0 38.0 37.8 38.0 25-29 37.361000000000004 38.0 38.0 38.0 37.2 38.0 30-34 37.3328 38.0 38.0 38.0 37.4 38.0 35-39 37.186400000000006 38.0 38.0 38.0 36.8 38.0 40-44 37.12235 38.0 38.0 38.0 36.6 38.0 45-49 37.14895 38.0 38.0 38.0 36.8 38.0 50-54 37.3049 38.0 38.0 38.0 37.0 38.0 55-59 37.17955 38.0 38.0 38.0 36.4 38.0 60-64 37.190650000000005 38.0 38.0 38.0 36.6 38.0 65-69 36.79925 38.0 38.0 38.0 35.2 38.0 70-74 36.8886 38.0 38.0 38.0 35.6 38.0 75-79 36.906400000000005 38.0 38.0 38.0 35.4 38.0 80-84 36.70225000000001 38.0 38.0 38.0 35.0 38.0 85-89 36.633700000000005 38.0 38.0 38.0 34.6 38.0 90-94 36.53679999999999 38.0 38.0 38.0 34.4 38.0 95-99 36.51145 38.0 38.0 38.0 34.0 38.0 100-104 36.2735 38.0 37.8 38.0 33.8 38.0 105-109 36.1571 38.0 37.8 38.0 33.6 38.0 110-114 36.12495 38.0 37.6 38.0 33.2 38.0 115-119 35.66075 38.0 36.6 38.0 31.0 38.0 120-124 35.75195 38.0 36.8 38.0 32.2 38.0 125-129 35.557249999999996 38.0 36.2 38.0 31.2 38.0 130-134 35.24845 38.0 36.0 38.0 30.2 38.0 135-139 35.0486 38.0 35.6 38.0 29.0 38.0 140-144 34.62935 38.0 35.0 38.0 26.8 38.0 145-149 33.8144 38.0 34.2 38.0 23.8 38.0 150-151 29.6145 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 3.0 12 2.0 13 0.0 14 1.0 15 3.0 16 2.0 17 3.0 18 3.0 19 5.0 20 3.0 21 8.0 22 5.0 23 4.0 24 10.0 25 17.0 26 15.0 27 20.0 28 30.0 29 23.0 30 56.0 31 52.0 32 63.0 33 112.0 34 129.0 35 265.0 36 646.0 37 2519.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.35772801747679 14.5002730748225 9.912616056799562 30.22938285090115 2 23.625 20.1 34.449999999999996 21.825 3 21.4 26.150000000000002 25.474999999999998 26.974999999999998 4 27.400000000000002 30.85 20.45 21.3 5 25.45 34.300000000000004 22.075 18.175 6 21.5 33.525 22.85 22.125 7 17.525 18.875 42.75 20.849999999999998 8 20.625 19.075 28.199999999999996 32.1 9 20.875 19.075 31.474999999999998 28.575 10-14 23.27 26.525 24.785 25.419999999999998 15-19 23.715 25.685000000000002 25.305 25.295 20-24 23.071153557677885 25.281264063203164 25.946297314865742 25.701285064253216 25-29 23.535 25.34 25.435000000000002 25.69 30-34 23.755000000000003 25.97 25.585 24.69 35-39 23.52 25.205 25.525 25.75 40-44 23.36 25.145 25.335 26.16 45-49 23.69 25.27 25.55 25.490000000000002 50-54 23.41 25.074999999999996 25.695 25.82 55-59 23.645 25.46 24.685000000000002 26.21 60-64 23.69 25.115 25.525 25.669999999999998 65-69 23.585 25.605 24.16 26.650000000000002 70-74 23.48 25.540000000000003 24.77 26.21 75-79 24.005000000000003 25.09 25.03 25.874999999999996 80-84 24.435000000000002 25.255 24.935 25.374999999999996 85-89 24.779999999999998 25.205 24.725 25.290000000000003 90-94 24.865000000000002 25.105 24.67 25.36 95-99 23.805 25.595000000000002 24.915000000000003 25.685000000000002 100-104 24.68 24.855 24.65 25.814999999999998 105-109 24.245 25.240000000000002 24.665 25.85 110-114 24.16 25.405 24.62 25.814999999999998 115-119 24.485 25.44 24.305 25.77 120-124 24.83 25.45 24.15 25.569999999999997 125-129 24.275 25.374999999999996 23.845 26.505000000000003 130-134 24.759999999999998 25.424999999999997 24.065 25.75 135-139 25.145 25.419999999999998 23.48 25.955000000000002 140-144 24.985 24.759999999999998 23.735 26.52 145-149 24.404999999999998 24.975 24.445 26.174999999999997 150-151 24.212500000000002 25.8 23.200000000000003 26.787499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.5 26 2.0 27 2.5 28 2.0 29 2.0 30 7.0 31 10.0 32 12.5 33 19.5 34 30.5 35 42.0 36 57.0 37 73.0 38 98.5 39 123.0 40 131.5 41 148.5 42 173.0 43 177.5 44 176.0 45 186.0 46 191.0 47 189.5 48 176.5 49 161.0 50 143.0 51 134.0 52 124.5 53 115.5 54 98.0 55 84.0 56 101.5 57 106.0 58 93.0 59 77.5 60 76.0 61 75.5 62 81.0 63 70.5 64 61.5 65 65.5 66 51.5 67 48.0 68 42.5 69 36.0 70 32.5 71 24.5 72 16.0 73 12.0 74 10.0 75 7.0 76 5.5 77 3.0 78 3.0 79 3.5 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.450000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24357034795764 98.4 2 0.6555723651033787 1.3 3 0.10085728693898136 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.3625 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.5375000000000001 0.0 0.0 0.0 0.0 84-85 0.7 0.0 0.0 0.0 0.0 86-87 0.8625 0.0 0.0 0.0 0.0 88-89 1.0875 0.0 0.0 0.0 0.0 90-91 1.2125 0.0 0.0 0.0 0.0 92-93 1.425 0.0 0.0 0.0 0.0 94-95 1.5625 0.0 0.0 0.0 0.0 96-97 1.7875 0.0 0.0 0.0 0.0 98-99 2.0625 0.0 0.0 0.0 0.0 100-101 2.4 0.0 0.0 0.0 0.0 102-103 2.875 0.0 0.0 0.0 0.0 104-105 3.325 0.0 0.0 0.0 0.0 106-107 3.6875 0.0 0.0 0.0 0.0 108-109 4.1 0.0 0.0 0.0 0.0 110-111 4.575 0.0 0.0 0.0 0.0 112-113 5.0 0.0 0.0 0.0 0.0 114-115 5.3625 0.0 0.0 0.0 0.0 116-117 5.9875 0.0 0.0 0.0 0.0 118-119 6.5375 0.0 0.0 0.0 0.0 120-121 7.1875 0.0 0.0 0.0 0.0 122-123 7.824999999999999 0.0 0.0 0.0 0.0 124-125 8.575 0.0 0.0 0.0 0.0 126-127 9.350000000000001 0.0 0.0 0.0 0.0 128-129 9.8875 0.0 0.0 0.0 0.0 130-131 10.425 0.0 0.0 0.0 0.0 132-133 10.95 0.0 0.0 0.0 0.0 134-135 11.6375 0.0 0.0 0.0 0.0 136-137 12.3125 0.0 0.0 0.0 0.0 138-139 12.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATGCTC 10 0.006841402 144.925 4 CAACGGC 10 0.006841402 144.925 9 TCCAGTC 45 0.008975616 48.30833 145 >>END_MODULE SRR5579247 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579247_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.72675 33.0 33.0 34.0 32.0 34.0 2 32.87925 34.0 33.0 34.0 32.0 34.0 3 32.81275 34.0 33.0 34.0 32.0 34.0 4 32.6675 34.0 33.0 34.0 32.0 34.0 5 32.81125 34.0 33.0 34.0 32.0 34.0 6 36.7895 38.0 38.0 38.0 36.0 38.0 7 37.0935 38.0 38.0 38.0 37.0 38.0 8 36.933 38.0 38.0 38.0 36.0 38.0 9 36.8555 38.0 38.0 38.0 36.0 38.0 10-14 36.8848 38.0 38.0 38.0 36.4 38.0 15-19 36.855000000000004 38.0 38.0 38.0 36.2 38.0 20-24 36.889700000000005 38.0 38.0 38.0 36.6 38.0 25-29 36.80155 38.0 38.0 38.0 35.8 38.0 30-34 36.812599999999996 38.0 38.0 38.0 36.2 38.0 35-39 36.823249999999994 38.0 38.0 38.0 36.6 38.0 40-44 36.84355 38.0 38.0 38.0 36.2 38.0 45-49 36.7892 38.0 38.0 38.0 36.4 38.0 50-54 36.70485 38.0 38.0 38.0 36.0 38.0 55-59 36.601549999999996 38.0 38.0 38.0 35.8 38.0 60-64 36.6273 38.0 38.0 38.0 35.6 38.0 65-69 36.5009 38.0 38.0 38.0 35.2 38.0 70-74 36.25565 38.0 38.0 38.0 34.2 38.0 75-79 36.12734999999999 38.0 38.0 38.0 33.8 38.0 80-84 36.14985 38.0 38.0 38.0 34.0 38.0 85-89 36.112350000000006 38.0 38.0 38.0 34.0 38.0 90-94 36.146 38.0 38.0 38.0 34.0 38.0 95-99 36.04565 38.0 38.0 38.0 34.0 38.0 100-104 35.8224 38.0 38.0 38.0 32.8 38.0 105-109 35.66935 38.0 37.8 38.0 32.0 38.0 110-114 35.31945 38.0 36.8 38.0 29.8 38.0 115-119 34.92155 38.0 36.0 38.0 27.8 38.0 120-124 34.38555 38.0 35.4 38.0 24.4 38.0 125-129 34.068650000000005 38.0 35.0 38.0 22.0 38.0 130-134 34.276500000000006 38.0 35.0 38.0 24.0 38.0 135-139 33.65939999999999 38.0 33.8 38.0 21.8 38.0 140-144 33.04135 38.0 33.0 38.0 14.6 38.0 145-149 32.0536 38.0 32.8 38.0 8.2 38.0 150-151 26.927875 34.5 17.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 6.0 4 3.0 5 2.0 6 6.0 7 2.0 8 4.0 9 5.0 10 4.0 11 3.0 12 2.0 13 1.0 14 3.0 15 6.0 16 4.0 17 7.0 18 8.0 19 7.0 20 9.0 21 8.0 22 12.0 23 14.0 24 16.0 25 10.0 26 23.0 27 35.0 28 35.0 29 51.0 30 56.0 31 55.0 32 95.0 33 95.0 34 177.0 35 272.0 36 613.0 37 2337.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.88755020080321 14.809236947791165 10.491967871485944 27.81124497991968 2 27.969924812030072 21.528822055137844 29.122807017543863 21.37844611528822 3 24.736313410346558 23.85735811150176 27.574083375188348 23.832245102963334 4 29.191767068273094 30.145582329317268 17.419678714859437 23.2429718875502 5 27.550764602657306 33.11606919027325 20.205565304587616 19.127600902481827 6 21.580395098774694 34.08352088022005 19.879969992498125 24.456114028507127 7 20.7 16.3 38.175 24.825 8 22.75 19.75 22.85 34.65 9 24.91868901676257 21.891418563922944 24.668501376032022 28.521391043282463 10-14 25.37522513508105 25.40024014408645 23.53912347408445 25.685411246748046 15-19 25.735000000000003 24.265 24.14 25.86 20-24 25.721430357589398 25.251312828207052 23.655913978494624 25.371342835708926 25-29 26.290258051610323 24.10982196439288 24.22984596919384 25.370074014802963 30-34 25.661547696463412 24.911210044520036 24.17087689460257 25.256365364413984 35-39 25.915732586068856 24.8548839071257 23.914131305044034 25.315252201761407 40-44 26.450000000000003 24.44 23.875 25.235000000000003 45-49 26.215 24.759999999999998 23.674999999999997 25.35 50-54 26.221311065553277 24.901245062253114 24.0062003100155 24.87124356217811 55-59 26.31 24.59 23.815 25.285000000000004 60-64 25.86017203440688 24.56491298259652 24.584916983396678 24.989997999599918 65-69 26.129597197898423 25.16387290467851 24.103077307980985 24.60345258944208 70-74 25.827913956978488 25.01750875437719 24.18209104552276 24.972486243121562 75-79 26.458072590738425 24.135168961201504 24.615769712140175 24.7909887359199 80-84 26.621979890950925 24.876194287429342 23.77569906457906 24.726126757040667 85-89 26.54561824729892 24.23969587835134 24.65986394557823 24.55482192877151 90-94 26.63165791447862 25.486371592898227 23.815953988497125 24.066016504126033 95-99 26.495 24.884999999999998 24.495 24.125 100-104 26.575 24.91 24.11 24.404999999999998 105-109 26.97 25.145 23.880000000000003 24.005000000000003 110-114 27.150000000000002 25.380000000000003 23.369999999999997 24.099999999999998 115-119 26.817681768176815 25.532553255325535 23.762376237623762 23.887388738873888 120-124 27.155 25.135 23.875 23.835 125-129 27.401850462615652 25.776444111027757 23.74593648412103 23.07576894223556 130-134 27.966398319915996 25.231261563078156 23.991199559978 22.81114055702785 135-139 27.437743774377438 25.637563756375638 23.737373737373737 23.187318731873187 140-144 27.73693423355839 25.90147536884221 24.171042760690174 22.190547636909226 145-149 27.779999999999998 26.009999999999998 23.875 22.335 150-151 27.928491061382672 26.62832854106763 23.377922240280036 22.06525815726966 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 1.0 21 1.0 22 0.5 23 0.5 24 1.0 25 0.5 26 0.5 27 0.5 28 2.5 29 3.5 30 5.0 31 7.0 32 13.5 33 19.0 34 17.5 35 25.0 36 36.5 37 40.0 38 59.0 39 85.0 40 100.5 41 121.0 42 143.0 43 157.0 44 167.5 45 177.5 46 183.5 47 186.5 48 181.5 49 167.0 50 144.5 51 132.5 52 120.0 53 111.0 54 107.0 55 102.0 56 95.5 57 99.0 58 110.0 59 98.0 60 99.0 61 103.5 62 98.0 63 96.5 64 85.5 65 73.0 66 66.5 67 64.5 68 61.0 69 48.5 70 43.5 71 41.5 72 31.0 73 22.5 74 15.0 75 9.0 76 5.5 77 4.0 78 3.0 79 1.5 80 0.5 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.25 3 0.44999999999999996 4 0.4 5 0.27499999999999997 6 0.025 7 0.0 8 0.0 9 0.075 10-14 0.06 15-19 0.0 20-24 0.025 25-29 0.02 30-34 0.045 35-39 0.08 40-44 0.0 45-49 0.0 50-54 0.005 55-59 0.0 60-64 0.02 65-69 0.075 70-74 0.05 75-79 0.125 80-84 0.045 85-89 0.04 90-94 0.025 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.01 120-124 0.0 125-129 0.025 130-134 0.005 135-139 0.01 140-144 0.025 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16771752837327 98.3 2 0.7818411097099622 1.55 3 0.05044136191677175 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.1875 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.3625 0.0 0.0 0.0 0.0 80-81 0.3875 0.0 0.0 0.0 0.0 82-83 0.5125 0.0 0.0 0.0 0.0 84-85 0.675 0.0 0.0 0.0 0.0 86-87 0.8125 0.0 0.0 0.0 0.0 88-89 1.0375 0.0 0.0 0.0 0.0 90-91 1.1625 0.0 0.0 0.0 0.0 92-93 1.4125 0.0 0.0 0.0 0.0 94-95 1.5875 0.0 0.0 0.0 0.0 96-97 1.8125 0.0 0.0 0.0 0.0 98-99 2.0875000000000004 0.0 0.0 0.0 0.0 100-101 2.425 0.0 0.0 0.0 0.0 102-103 2.9124999999999996 0.0 0.0 0.0 0.0 104-105 3.3625 0.0 0.0 0.0 0.0 106-107 3.7375 0.0 0.0 0.0 0.0 108-109 4.1625 0.0 0.0 0.0 0.0 110-111 4.6 0.0 0.0 0.0 0.0 112-113 5.0125 0.0 0.0 0.0 0.0 114-115 5.4125 0.0 0.0 0.0 0.0 116-117 6.025 0.0 0.0 0.0 0.0 118-119 6.5875 0.0 0.0 0.0 0.0 120-121 7.175 0.0 0.0 0.0 0.0 122-123 7.7875 0.0 0.0 0.0 0.0 124-125 8.4875 0.0 0.0 0.0 0.0 126-127 9.2875 0.0 0.0 0.0 0.0 128-129 9.85 0.0 0.0 0.0 0.0 130-131 10.4125 0.0 0.0 0.0 0.0 132-133 10.975 0.0 0.0 0.0 0.0 134-135 11.7 0.0 0.0 0.0 0.0 136-137 12.375 0.0 0.0 0.0 0.0 138-139 12.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTGTC 10 0.0068590776 144.79999 6 AAGAGTG 40 5.926149E-5 72.399994 145 >>END_MODULE Read 1184889 spots for SRR5579247.sra Written 1184889 spots for SRR5579247.sra Read 1184889 spots for SRR5579247.sra Written 1184889 spots for SRR5579247.sra Read 1184889 spots for SRR5579247.sra Written 1184889 spots for SRR5579247.sra Read 1184889 spots for SRR5579247.sra Written 1184889 spots for SRR5579247.sra Read 1184889 spots for SRR5579247.sra Written 1184889 spots for SRR5579247.sra Read 1184889 spots for SRR5579247.sra Written 1184889 spots for SRR5579247.sra Read 1184889 spots for SRR5579247.sra Written 1184889 spots for SRR5579247.sra Read 1184889 spots for SRR5579247.sra Written 1184889 spots for SRR5579247.sra Read 1184889 spots for SRR5579247.sra Written 1184889 spots for SRR5579247.sra Read 1184889 spots for SRR5579247.sra Written 1184889 spots for SRR5579247.sra Read 1184898 spots for SRR5579247.sra Written 1184898 spots for SRR5579247.sra Read 1184889 spots for SRR5579247.sra Written 1184889 spots for SRR5579247.sra Read 1184889 spots for SRR5579247.sra Written 1184889 spots for SRR5579247.sra Read 1184889 spots for SRR5579247.sra Written 1184889 spots for SRR5579247.sra Read 1184889 spots for SRR5579247.sra Written 1184889 spots for SRR5579247.sra Read 1184889 spots for SRR5579247.sra Written 1184889 spots for SRR5579247.sra Read 1184889 spots for SRR5579247.sra Written 1184889 spots for SRR5579247.sra Read 1184889 spots for SRR5579247.sra Written 1184889 spots for SRR5579247.sra Read 1184889 spots for SRR5579247.sra Written 1184889 spots for SRR5579247.sra Read 1184889 spots for SRR5579247.sra Written 1184889 spots for SRR5579247.sra SRR ids: ['SRR5579247.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2ljkd_sg SRR5579247.sra spots: 23697789 blocks: [[1, 1184889], [1184890, 2369778], [2369779, 3554667], [3554668, 4739556], [4739557, 5924445], [5924446, 7109334], [7109335, 8294223], [8294224, 9479112], [9479113, 10664001], [10664002, 11848890], [11848891, 13033779], [13033780, 14218668], [14218669, 15403557], [15403558, 16588446], [16588447, 17773335], [17773336, 18958224], [18958225, 20143113], [20143114, 21328002], [21328003, 22512891], [22512892, 23697789]] SRR5579247 file size 8008702 SRR5579247 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579247 SRR5579247_1.fastq SRR5579247_2.fastq Input file: SRR5579247_1.fastq Paired file: SRR5579247_2.fastq trimmed: SRR5579247-trimmed-pair1.fastq, SRR5579247-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 23:29:31 2024 >> started Mon Dec 9 23:29:58 2024 >> done (27.612s) 23697789 read pairs processed; of these: 41240 ( 0.17%) short read pairs filtered out after trimming by size control 91112 ( 0.38%) empty read pairs filtered out after trimming by size control 23565437 (99.44%) read pairs available; of these: 13220845 (56.10%) trimmed read pairs available after processing 10344592 (43.90%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 19 0.00% 20 19 0.00% 21 17 0.00% 22 25 0.00% 23 24 0.00% 24 30 0.00% 25 32 0.00% 26 30 0.00% 27 34 0.00% 28 27 0.00% 29 30 0.00% 30 37 0.00% 31 41 0.00% 32 45 0.00% 33 39 0.00% 34 53 0.00% 35 60 0.00% 36 72 0.00% 37 73 0.00% 38 68 0.00% 39 85 0.00% 40 123 0.00% 41 120 0.00% 42 135 0.00% 43 139 0.00% 44 172 0.00% 45 171 0.00% 46 195 0.00% 47 259 0.00% 48 302 0.00% 49 321 0.00% 50 383 0.00% 51 439 0.00% 52 492 0.00% 53 527 0.00% 54 575 0.00% 55 659 0.00% 56 747 0.00% 57 978 0.00% 58 1026 0.00% 59 1167 0.00% 60 1379 0.01% 61 1567 0.01% 62 1673 0.01% 63 1879 0.01% 64 2108 0.01% 65 2384 0.01% 66 2586 0.01% 67 3018 0.01% 68 3578 0.02% 69 4597 0.02% 70 4984 0.02% 71 5155 0.02% 72 5955 0.03% 73 6531 0.03% 74 6969 0.03% 75 7607 0.03% 76 8260 0.04% 77 8941 0.04% 78 9851 0.04% 79 11275 0.05% 80 12553 0.05% 81 14242 0.06% 82 15834 0.07% 83 17275 0.07% 84 19976 0.08% 85 21795 0.09% 86 22661 0.10% 87 24272 0.10% 88 25601 0.11% 89 26693 0.11% 90 29618 0.13% 91 31184 0.13% 92 33057 0.14% 93 35629 0.15% 94 36909 0.16% 95 38340 0.16% 96 39938 0.17% 97 40857 0.17% 98 41475 0.18% 99 43967 0.19% 100 46260 0.20% 101 49378 0.21% 102 51665 0.22% 103 54488 0.23% 104 56216 0.24% 105 57156 0.24% 106 58210 0.25% 107 58133 0.25% 108 59734 0.25% 109 61144 0.26% 110 63037 0.27% 111 65947 0.28% 112 68751 0.29% 113 70786 0.30% 114 73960 0.31% 115 75865 0.32% 116 76057 0.32% 117 78592 0.33% 118 77085 0.33% 119 78840 0.33% 120 81628 0.35% 121 83894 0.36% 122 85789 0.36% 123 90352 0.38% 124 93605 0.40% 125 95397 0.40% 126 98304 0.42% 127 98479 0.42% 128 99742 0.42% 129 101219 0.43% 130 102479 0.43% 131 105283 0.45% 132 111509 0.47% 133 115232 0.49% 134 118803 0.50% 135 124958 0.53% 136 128398 0.54% 137 133230 0.57% 138 138518 0.59% 139 144411 0.61% 140 150823 0.64% 141 161534 0.69% 142 174945 0.74% 143 193399 0.82% 144 217985 0.93% 145 253342 1.08% 146 310127 1.32% 147 402091 1.71% 148 587890 2.49% 149 1148494 4.87% 150 5505702 23.36% 151 10344592 43.90% 23565437 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=3.23 fanout-score-rank=13 prefix-density=0.75 prefix-fanout=3.1 sequence=AGGCAAGGAACCCACTTGGAGCGGATCAGGTACTCGATCTGCTTCAGGAGAGACTCCACGGAGAGAGGGGGCAGGTACGAGAGGGTCTCGAACTTCTTGATGCCCTCGATCGGCCACACCTGCATGCACCTGATCCTTCCACCGTTG criterion=fanout-score sequence-density=0.22 sequence-density-rank=26 fanout-score=12.37 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=4.1 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=3.81 fanout-score-rank=12 prefix-density=0.87 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=111.13 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=9.1 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR5579247 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 23:30:48 Started mapping on | Dec 09 23:30:48 Finished on | Dec 09 23:33:15 Mapping speed, Million of reads per hour | 577.11 Number of input reads | 23565437 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 22528815 Uniquely mapped reads % | 95.60% Average mapped length | 288.02 Number of splices: Total | 23406271 Number of splices: Annotated (sjdb) | 22175055 Number of splices: GT/AG | 23106325 Number of splices: GC/AG | 272737 Number of splices: AT/AC | 10925 Number of splices: Non-canonical | 16284 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.30 Insertion rate per base | 0.00% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 222728 % of reads mapped to multiple loci | 0.95% Number of reads mapped to too many loci | 11371 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.13% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 846783 846783 846783 N_multimapping 222728 222728 222728 N_noFeature 697068 21844911 941624 N_ambiguous 513914 3035 75395 UnstrandedReadsAssigned:21317833 PositiveStrandReadsAssigned:680869 NegativeStrandReadsAssigned:21511796 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR5579247 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579247-trimmed-pair1.fastq SRR5579247-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,565,437 reads, 21,599,420 reads pseudoaligned [quant] estimated average fragment length: 248.374 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,127 rounds 52973 SRR5579247.ke.tsv 35125 SRR5579247.se.tsv 88098 total ==> SRR5579247.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 689.367 0 0 PNS24247 1044 796.626 59.3234 4.88857 PNS24249 1928 1680.63 64.2242 2.50864 PNS24246 1044 796.626 59.3234 4.88857 PNS24248 1044 796.626 59.3234 4.88857 PNS24244 1471 1223.63 109.806 5.89097 PNS24243 293 107.622 0 0 KQK14069 1603 1355.63 2777.45 134.498 KQK14071 474 249.639 144.215 37.9235 ==> SRR5579247.se.tsv <== BRADI_1g14170v3 3511 BRADI_1g53295v3 73 BRADI_1g59795v3 657 BRADI_1g07683v3 0 BRADI_1g00485v3 55 BRADI_1g20270v3 2805 BRADI_1g74790v3 73 BRADI_1g09890v3 2 BRADI_1g77505v3 276 BRADI_1g48960v3 0 SRR5579247 completed mapping pipeline successfully