Starting /dee2/code/volunteer_pipeline.sh SRR5579249 current disk space = 1523268042752 free memory = 1428469392 SRR5579249 SRAfilesize 2e9f41875f02f982bd14891e15747065 SRR5579249.sra SRR5579249.sra file validated SRR5579249 is paired end SRR5579249 is conventional basespace SRR5579249 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579249_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.2545 34.0 33.0 34.0 2.0 34.0 2 32.551 34.0 33.0 34.0 28.0 34.0 3 32.848 34.0 33.0 34.0 30.0 34.0 4 33.14925 34.0 33.0 34.0 32.0 34.0 5 33.1815 34.0 33.0 34.0 33.0 34.0 6 37.02125 38.0 37.0 38.0 36.0 38.0 7 37.325 38.0 38.0 38.0 37.0 38.0 8 37.451 38.0 38.0 38.0 37.0 38.0 9 37.5015 38.0 38.0 38.0 37.0 38.0 10-14 37.4907 38.0 38.0 38.0 37.2 38.0 15-19 37.4042 38.0 38.0 38.0 37.0 38.0 20-24 37.4292 38.0 38.0 38.0 37.0 38.0 25-29 37.43675 38.0 38.0 38.0 37.0 38.0 30-34 37.336149999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.2795 38.0 38.0 38.0 37.0 38.0 40-44 37.163799999999995 38.0 38.0 38.0 36.2 38.0 45-49 37.073 38.0 38.0 38.0 36.0 38.0 50-54 37.010099999999994 38.0 38.0 38.0 35.8 38.0 55-59 36.96105 38.0 38.0 38.0 35.4 38.0 60-64 36.9239 38.0 38.0 38.0 35.2 38.0 65-69 36.8081 38.0 38.0 38.0 35.0 38.0 70-74 36.788 38.0 38.0 38.0 34.8 38.0 75-79 36.7944 38.0 38.0 38.0 34.8 38.0 80-84 36.6896 38.0 38.0 38.0 34.4 38.0 85-89 36.548550000000006 38.0 38.0 38.0 34.0 38.0 90-94 36.4837 38.0 38.0 38.0 34.0 38.0 95-99 36.33485 38.0 37.8 38.0 33.8 38.0 100-104 36.22330000000001 38.0 38.0 38.0 33.6 38.0 105-109 36.03574999999999 38.0 37.2 38.0 32.8 38.0 110-114 35.922450000000005 38.0 37.0 38.0 32.4 38.0 115-119 35.676500000000004 38.0 36.6 38.0 31.0 38.0 120-124 35.459050000000005 38.0 36.0 38.0 30.8 38.0 125-129 35.365300000000005 38.0 36.0 38.0 31.0 38.0 130-134 35.1974 38.0 35.8 38.0 29.8 38.0 135-139 34.746249999999996 38.0 35.0 38.0 27.8 38.0 140-144 34.5868 38.0 35.0 38.0 27.6 38.0 145-149 33.7099 38.0 35.0 38.0 21.6 38.0 150-151 30.156625 36.5 28.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 1.0 14 0.0 15 1.0 16 3.0 17 2.0 18 7.0 19 3.0 20 3.0 21 9.0 22 7.0 23 9.0 24 13.0 25 12.0 26 19.0 27 13.0 28 39.0 29 32.0 30 48.0 31 74.0 32 79.0 33 116.0 34 155.0 35 260.0 36 684.0 37 2408.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.836488812392425 13.884107860011474 9.122203098106713 32.15720022948938 2 23.35 19.2 34.575 22.875 3 22.125 25.575 23.875 28.425 4 26.174999999999997 33.0 19.575 21.25 5 24.75 33.925 22.1 19.225 6 20.674999999999997 34.4 22.5 22.425 7 16.950000000000003 19.475 41.375 22.2 8 19.55 21.0 27.55 31.900000000000002 9 21.7 18.7 30.425 29.175 10-14 23.044999999999998 26.474999999999998 24.445 26.035000000000004 15-19 23.25 25.405 25.580000000000002 25.765 20-24 23.075000000000003 25.745 25.75 25.430000000000003 25-29 23.674999999999997 25.055 25.86 25.41 30-34 23.195 25.275 25.7 25.83 35-39 22.98 25.455 25.895000000000003 25.669999999999998 40-44 22.7 25.790000000000003 25.865 25.645 45-49 22.865 25.330000000000002 25.535000000000004 26.27 50-54 23.1 25.66 25.569999999999997 25.669999999999998 55-59 23.68 25.6 25.669999999999998 25.05 60-64 23.39 25.27 25.885 25.455 65-69 23.665 25.509999999999998 24.87 25.955000000000002 70-74 23.485 25.235000000000003 25.424999999999997 25.855 75-79 23.724999999999998 24.795 25.585 25.895000000000003 80-84 22.955000000000002 25.275 25.215 26.555 85-89 24.145 24.725 25.535000000000004 25.595000000000002 90-94 23.445 25.47 25.44 25.645 95-99 24.185000000000002 24.87 25.6 25.345000000000002 100-104 23.635 24.905 25.72 25.740000000000002 105-109 23.935000000000002 25.44 25.330000000000002 25.295 110-114 24.19 24.83 25.185000000000002 25.795 115-119 24.68 25.21 24.615000000000002 25.495 120-124 24.095 24.89 25.035 25.979999999999997 125-129 23.925 25.385 25.005 25.685000000000002 130-134 24.29 25.790000000000003 24.365000000000002 25.555 135-139 23.9 25.424999999999997 24.485 26.19 140-144 24.044999999999998 25.615 23.52 26.82 145-149 24.08 25.380000000000003 24.08 26.46 150-151 23.775 25.887500000000003 23.9125 26.424999999999997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 1.0 26 0.0 27 1.0 28 3.0 29 3.5 30 6.5 31 13.5 32 18.5 33 22.5 34 25.5 35 36.0 36 60.0 37 76.0 38 91.5 39 107.0 40 132.0 41 150.5 42 153.5 43 172.5 44 185.5 45 200.5 46 208.0 47 207.5 48 203.5 49 178.0 50 159.5 51 145.5 52 133.5 53 129.5 54 106.5 55 91.5 56 96.5 57 86.5 58 79.0 59 85.0 60 82.0 61 59.0 62 50.5 63 59.5 64 56.5 65 58.0 66 50.5 67 34.5 68 31.0 69 27.5 70 24.0 71 23.0 72 17.0 73 15.0 74 14.0 75 7.5 76 5.5 77 6.0 78 3.5 79 1.0 80 1.0 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 12.85 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37011841773746 98.6 2 0.5291005291005291 1.05 3 0.05039052658100278 0.15 4 0.05039052658100278 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.5375 0.0 0.0 0.0 0.0 92-93 0.65 0.0 0.0 0.0 0.0 94-95 0.7875 0.0 0.0 0.0 0.0 96-97 1.0625 0.0 0.0 0.0 0.0 98-99 1.275 0.0 0.0 0.0 0.0 100-101 1.475 0.0 0.0 0.0 0.0 102-103 1.7625000000000002 0.0 0.0 0.0 0.0 104-105 2.1875 0.0 0.0 0.0 0.0 106-107 2.5625 0.0 0.0 0.0 0.0 108-109 3.0625 0.0 0.0 0.0 0.0 110-111 3.4875 0.0 0.0 0.0 0.0 112-113 3.9625 0.0 0.0 0.0 0.0 114-115 4.5625 0.0 0.0 0.0 0.0 116-117 4.9625 0.0 0.0 0.0 0.0 118-119 5.425 0.0 0.0 0.0 0.0 120-121 6.025 0.0 0.0 0.0 0.0 122-123 6.4375 0.0 0.0 0.0 0.0 124-125 7.0 0.0 0.0 0.0 0.0 126-127 7.800000000000001 0.0 0.0 0.0 0.0 128-129 8.537500000000001 0.0 0.0 0.0 0.0 130-131 8.975 0.0 0.0 0.0 0.0 132-133 9.8 0.0 0.0 0.0 0.0 134-135 10.5125 0.0 0.0 0.0 0.0 136-137 11.087499999999999 0.0 0.0 0.0 0.0 138-139 11.537500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGGTAT 10 0.0047684857 163.25352 1 GAGGAGT 10 0.006846698 144.88751 2 AGGTATT 10 0.006846698 144.88751 2 >>END_MODULE SRR5579249 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579249_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.67525 33.0 33.0 34.0 32.0 34.0 2 32.75825 33.0 33.0 34.0 32.0 34.0 3 32.73275 34.0 33.0 34.0 32.0 34.0 4 32.69575 34.0 33.0 34.0 32.0 34.0 5 32.68925 34.0 33.0 34.0 32.0 34.0 6 36.86375 38.0 38.0 38.0 36.0 38.0 7 36.854 38.0 38.0 38.0 36.0 38.0 8 36.8215 38.0 38.0 38.0 36.0 38.0 9 36.78175 38.0 38.0 38.0 36.0 38.0 10-14 36.7986 38.0 38.0 38.0 36.0 38.0 15-19 36.77005 38.0 38.0 38.0 36.0 38.0 20-24 36.7654 38.0 38.0 38.0 36.0 38.0 25-29 36.72795 38.0 38.0 38.0 36.0 38.0 30-34 36.7414 38.0 38.0 38.0 36.0 38.0 35-39 36.7342 38.0 38.0 38.0 36.0 38.0 40-44 36.740249999999996 38.0 38.0 38.0 36.2 38.0 45-49 36.6355 38.0 38.0 38.0 35.8 38.0 50-54 36.6337 38.0 38.0 38.0 36.0 38.0 55-59 36.56205 38.0 38.0 38.0 35.2 38.0 60-64 36.5523 38.0 38.0 38.0 35.6 38.0 65-69 36.4834 38.0 38.0 38.0 35.2 38.0 70-74 36.356950000000005 38.0 38.0 38.0 34.4 38.0 75-79 36.3931 38.0 38.0 38.0 34.6 38.0 80-84 36.373250000000006 38.0 38.0 38.0 34.6 38.0 85-89 36.29834999999999 38.0 38.0 38.0 34.4 38.0 90-94 36.15095 38.0 38.0 38.0 34.0 38.0 95-99 36.0942 38.0 38.0 38.0 34.0 38.0 100-104 35.92405 38.0 38.0 38.0 33.2 38.0 105-109 35.75605 38.0 38.0 38.0 32.6 38.0 110-114 35.64505 38.0 38.0 38.0 32.4 38.0 115-119 35.599849999999996 38.0 38.0 38.0 32.2 38.0 120-124 35.3382 38.0 37.0 38.0 31.0 38.0 125-129 35.15075 38.0 36.8 38.0 30.6 38.0 130-134 34.734500000000004 38.0 36.0 38.0 27.2 38.0 135-139 34.26775 38.0 35.4 38.0 23.4 38.0 140-144 33.94525 38.0 35.0 38.0 22.2 38.0 145-149 33.1139 38.0 34.6 38.0 15.2 38.0 150-151 29.14 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 23.0 3 5.0 4 3.0 5 3.0 6 4.0 7 3.0 8 1.0 9 2.0 10 4.0 11 1.0 12 1.0 13 6.0 14 3.0 15 6.0 16 5.0 17 5.0 18 4.0 19 9.0 20 13.0 21 5.0 22 8.0 23 14.0 24 11.0 25 19.0 26 23.0 27 22.0 28 29.0 29 41.0 30 37.0 31 46.0 32 85.0 33 101.0 34 143.0 35 213.0 36 450.0 37 2652.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.35 15.8 10.825 27.025 2 26.974999999999998 22.85 27.975 22.2 3 24.325 24.675 26.950000000000003 24.05 4 27.6 33.324999999999996 17.675 21.4 5 26.900000000000002 33.550000000000004 18.75 20.8 6 22.125 33.800000000000004 18.925 25.15 7 20.95 17.0 38.725 23.325000000000003 8 23.075000000000003 20.424999999999997 23.825 32.675 9 24.474999999999998 21.95 25.124999999999996 28.449999999999996 10-14 25.759999999999998 25.580000000000002 23.82 24.84 15-19 25.580000000000002 25.495 24.68 24.245 20-24 25.785000000000004 25.585 24.02 24.610000000000003 25-29 26.39 24.9 24.26 24.45 30-34 25.564999999999998 25.95 23.599999999999998 24.884999999999998 35-39 25.81 25.215 24.355 24.62 40-44 26.445 25.53 24.125 23.9 45-49 26.39 25.135 24.285 24.19 50-54 25.785000000000004 25.745 23.905 24.565 55-59 25.814999999999998 25.19 24.62 24.375 60-64 25.83 25.525 24.385 24.26 65-69 25.7 25.72 24.23 24.349999999999998 70-74 26.07 25.224999999999998 24.310000000000002 24.395 75-79 26.314999999999998 24.57 24.55 24.565 80-84 25.805 25.755 24.45 23.990000000000002 85-89 25.635 25.335 24.8 24.23 90-94 26.125 24.98 25.035 23.86 95-99 26.009999999999998 24.779999999999998 25.0 24.21 100-104 26.14 25.669999999999998 24.615000000000002 23.575 105-109 26.290000000000003 25.535000000000004 23.93 24.245 110-114 26.355 25.445 24.365000000000002 23.835 115-119 26.695 25.465 23.925 23.915 120-124 27.02 25.81 24.2 22.97 125-129 27.02 25.724999999999998 24.735 22.52 130-134 28.13 25.045 24.13 22.695 135-139 27.485 26.290000000000003 23.794999999999998 22.43 140-144 27.195000000000004 26.119999999999997 24.635 22.05 145-149 28.060000000000002 25.919999999999998 23.815 22.205 150-151 28.262500000000003 26.0375 23.7875 21.912499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 1.5 24 0.0 25 0.0 26 0.5 27 1.5 28 1.5 29 2.5 30 6.0 31 7.5 32 8.5 33 18.0 34 28.0 35 34.0 36 42.0 37 62.0 38 86.5 39 95.5 40 106.0 41 136.0 42 148.0 43 163.0 44 188.5 45 193.0 46 189.0 47 175.0 48 168.5 49 162.5 50 153.5 51 148.0 52 138.5 53 121.0 54 111.5 55 103.0 56 88.0 57 91.5 58 91.0 59 83.0 60 87.5 61 88.5 62 81.5 63 75.5 64 63.5 65 61.5 66 59.5 67 52.5 68 54.0 69 47.5 70 41.5 71 33.0 72 27.5 73 24.0 74 14.5 75 13.0 76 10.0 77 3.5 78 2.0 79 1.0 80 1.0 81 1.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11593836827481 98.1 2 0.7577671129072998 1.5 3 0.10103561505430665 0.3 4 0.025258903763576663 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.8125 0.0 0.0 0.0 0.0 96-97 1.0875 0.0 0.0 0.0 0.0 98-99 1.2999999999999998 0.0 0.0 0.0 0.0 100-101 1.5 0.0 0.0 0.0 0.0 102-103 1.7875 0.0 0.0 0.0 0.0 104-105 2.1875 0.0 0.0 0.0 0.0 106-107 2.5374999999999996 0.0 0.0 0.0 0.0 108-109 3.075 0.0 0.0 0.0 0.0 110-111 3.5125 0.0 0.0 0.0 0.0 112-113 3.9875 0.0 0.0 0.0 0.0 114-115 4.6125 0.0 0.0 0.0 0.0 116-117 5.0375 0.0 0.0 0.0 0.0 118-119 5.5125 0.0 0.0 0.0 0.0 120-121 6.125 0.0 0.0 0.0 0.0 122-123 6.5625 0.0 0.0 0.0 0.0 124-125 7.125 0.0 0.0 0.0 0.0 126-127 7.9 0.0 0.0 0.0 0.0 128-129 8.587499999999999 0.0 0.0 0.0 0.0 130-131 9.025 0.0 0.0 0.0 0.0 132-133 9.8625 0.0 0.0 0.0 0.0 134-135 10.587499999999999 0.0 0.0 0.0 0.0 136-137 11.162500000000001 0.0 0.0 0.0 0.0 138-139 11.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1220744 spots for SRR5579249.sra Written 1220744 spots for SRR5579249.sra Read 1220744 spots for SRR5579249.sra Written 1220744 spots for SRR5579249.sra Read 1220744 spots for SRR5579249.sra Written 1220744 spots for SRR5579249.sra Read 1220744 spots for SRR5579249.sra Written 1220744 spots for SRR5579249.sra Read 1220744 spots for SRR5579249.sra Written 1220744 spots for SRR5579249.sra Read 1220744 spots for SRR5579249.sra Written 1220744 spots for SRR5579249.sra Read 1220744 spots for SRR5579249.sra Written 1220744 spots for SRR5579249.sra Read 1220744 spots for SRR5579249.sra Written 1220744 spots for SRR5579249.sra Read 1220744 spots for SRR5579249.sra Written 1220744 spots for SRR5579249.sra Read 1220744 spots for SRR5579249.sra Written 1220744 spots for SRR5579249.sra Read 1220744 spots for SRR5579249.sra Written 1220744 spots for SRR5579249.sra Read 1220744 spots for SRR5579249.sra Written 1220744 spots for SRR5579249.sra Read 1220744 spots for SRR5579249.sra Written 1220744 spots for SRR5579249.sra Read 1220746 spots for SRR5579249.sra Written 1220746 spots for SRR5579249.sra Read 1220744 spots for SRR5579249.sra Written 1220744 spots for SRR5579249.sra Read 1220744 spots for SRR5579249.sra Written 1220744 spots for SRR5579249.sra Read 1220744 spots for SRR5579249.sra Written 1220744 spots for SRR5579249.sra Read 1220744 spots for SRR5579249.sra Written 1220744 spots for SRR5579249.sra Read 1220744 spots for SRR5579249.sra Written 1220744 spots for SRR5579249.sra Read 1220744 spots for SRR5579249.sra Written 1220744 spots for SRR5579249.sra SRR ids: ['SRR5579249.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__qrxt7os SRR5579249.sra spots: 24414882 blocks: [[1, 1220744], [1220745, 2441488], [2441489, 3662232], [3662233, 4882976], [4882977, 6103720], [6103721, 7324464], [7324465, 8545208], [8545209, 9765952], [9765953, 10986696], [10986697, 12207440], [12207441, 13428184], [13428185, 14648928], [14648929, 15869672], [15869673, 17090416], [17090417, 18311160], [18311161, 19531904], [19531905, 20752648], [20752649, 21973392], [21973393, 23194136], [23194137, 24414882]] SRR5579249 file size 8251702 SRR5579249 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579249 SRR5579249_1.fastq SRR5579249_2.fastq Input file: SRR5579249_1.fastq Paired file: SRR5579249_2.fastq trimmed: SRR5579249-trimmed-pair1.fastq, SRR5579249-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 23:54:17 2024 >> started Mon Dec 9 23:54:59 2024 >> done (41.665s) 24414882 read pairs processed; of these: 62773 ( 0.26%) short read pairs filtered out after trimming by size control 84720 ( 0.35%) empty read pairs filtered out after trimming by size control 24267389 (99.40%) read pairs available; of these: 10836799 (44.66%) trimmed read pairs available after processing 13430590 (55.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 9 0.00% 20 14 0.00% 21 9 0.00% 22 14 0.00% 23 9 0.00% 24 16 0.00% 25 16 0.00% 26 23 0.00% 27 27 0.00% 28 13 0.00% 29 13 0.00% 30 32 0.00% 31 20 0.00% 32 32 0.00% 33 26 0.00% 34 19 0.00% 35 27 0.00% 36 39 0.00% 37 29 0.00% 38 45 0.00% 39 62 0.00% 40 61 0.00% 41 56 0.00% 42 73 0.00% 43 78 0.00% 44 101 0.00% 45 101 0.00% 46 105 0.00% 47 143 0.00% 48 164 0.00% 49 164 0.00% 50 208 0.00% 51 229 0.00% 52 276 0.00% 53 287 0.00% 54 359 0.00% 55 434 0.00% 56 420 0.00% 57 475 0.00% 58 547 0.00% 59 615 0.00% 60 749 0.00% 61 776 0.00% 62 961 0.00% 63 1125 0.00% 64 1174 0.00% 65 1369 0.01% 66 1582 0.01% 67 1786 0.01% 68 2025 0.01% 69 2436 0.01% 70 2753 0.01% 71 3015 0.01% 72 3584 0.01% 73 3941 0.02% 74 4329 0.02% 75 4799 0.02% 76 5309 0.02% 77 5780 0.02% 78 6498 0.03% 79 7495 0.03% 80 8479 0.03% 81 9458 0.04% 82 10737 0.04% 83 12111 0.05% 84 15408 0.06% 85 17061 0.07% 86 17705 0.07% 87 18773 0.08% 88 19927 0.08% 89 20995 0.09% 90 22607 0.09% 91 24128 0.10% 92 26261 0.11% 93 28184 0.12% 94 29890 0.12% 95 31262 0.13% 96 32618 0.13% 97 33648 0.14% 98 34934 0.14% 99 37298 0.15% 100 38511 0.16% 101 40981 0.17% 102 43905 0.18% 103 45179 0.19% 104 47615 0.20% 105 48996 0.20% 106 50704 0.21% 107 51935 0.21% 108 53291 0.22% 109 54522 0.22% 110 56221 0.23% 111 58902 0.24% 112 61430 0.25% 113 63889 0.26% 114 66755 0.28% 115 69425 0.29% 116 70277 0.29% 117 71592 0.30% 118 72056 0.30% 119 73929 0.30% 120 75647 0.31% 121 78395 0.32% 122 80695 0.33% 123 84129 0.35% 124 87490 0.36% 125 89457 0.37% 126 92505 0.38% 127 92351 0.38% 128 93487 0.39% 129 95602 0.39% 130 97292 0.40% 131 100634 0.41% 132 104186 0.43% 133 108383 0.45% 134 111181 0.46% 135 116296 0.48% 136 119995 0.49% 137 123595 0.51% 138 128050 0.53% 139 131173 0.54% 140 137163 0.57% 141 145086 0.60% 142 154471 0.64% 143 166281 0.69% 144 184032 0.76% 145 207835 0.86% 146 243297 1.00% 147 307621 1.27% 148 434547 1.79% 149 799456 3.29% 150 4387981 18.08% 151 13430590 55.34% 24267389 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=22 prefix-density=0.67 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=26 fanout-score=15.59 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=2.8 sequence=AGCTTGAGGGTGTAGCTGGCGACTTGCTCAGGGGTGGCCCGCTCCTTGCACTCGGCGCCGGGTGTCACCATGCTGGGCTTGAGGAGGATGCCCTCGAACAAGACGTTGTTCTGGGCCATGTAGTAGAAAGTCTCCGCCCACACCTTCTGCGCCACCTCGAAGGTCCTGTCGATGCCGTGCTCGCCGTCCAGCAGGATCTCCGGCTCCACAATCGGCACCAGACCGTTGTCCTGAGAGATGGCAGCGTAACGGGCAAGACCCCATGCAGCTTCCTTGACAGCAAGCTCAGATGGGCCGTTGGGGATGCTGACGACAGTGCGCCACTTGGCGAAGCGGGCGCCTTGCTGGTAGTAGGCTGCCTCACGGGAGGCAAGGCCATCAAGACCTTGGCACCATGACTCGTCGTTGGAACCAACGAGTGGCACAAGACCCTTGTCAACCTTGATGCCGGGAACGATTCCCTGCTCGACAAGGATGTCAACAATCTTCTTGCCATCAACAGTCGATTGGT criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=3.56 fanout-score-rank=21 prefix-density=0.75 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=87.81 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=6.4 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR5579249 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 23:56:11 Started mapping on | Dec 09 23:56:11 Finished on | Dec 09 23:59:32 Mapping speed, Million of reads per hour | 434.64 Number of input reads | 24267389 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 22567821 Uniquely mapped reads % | 93.00% Average mapped length | 290.37 Number of splices: Total | 24924811 Number of splices: Annotated (sjdb) | 23486572 Number of splices: GT/AG | 24590768 Number of splices: GC/AG | 305321 Number of splices: AT/AC | 12342 Number of splices: Non-canonical | 16380 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.39 Insertion rate per base | 0.00% Insertion average length | 1.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 362424 % of reads mapped to multiple loci | 1.49% Number of reads mapped to too many loci | 54610 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.00% % of reads unmapped: other | 1.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1370292 1370292 1370292 N_multimapping 362424 362424 362424 N_noFeature 938961 21877782 1207252 N_ambiguous 508126 3722 86802 UnstrandedReadsAssigned:21120734 PositiveStrandReadsAssigned:686317 NegativeStrandReadsAssigned:21273767 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR5579249 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579249-trimmed-pair1.fastq SRR5579249-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,267,389 reads, 21,479,280 reads pseudoaligned [quant] estimated average fragment length: 254.468 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,157 rounds 52973 SRR5579249.ke.tsv 35125 SRR5579249.se.tsv 88098 total ==> SRR5579249.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 683.204 0 0 PNS24247 1044 790.532 75.0162 6.47733 PNS24249 1928 1674.53 52.868 2.15507 PNS24246 1044 790.532 75.0162 6.47733 PNS24248 1044 790.532 75.0162 6.47733 PNS24244 1471 1217.53 131.083 7.34901 PNS24243 293 104.105 0 0 KQK14069 1603 1349.53 5494.47 277.909 KQK14071 474 244.161 134.994 37.7398 ==> SRR5579249.se.tsv <== BRADI_1g14170v3 6257 BRADI_1g53295v3 163 BRADI_1g59795v3 447 BRADI_1g07683v3 0 BRADI_1g00485v3 48 BRADI_1g20270v3 3148 BRADI_1g74790v3 229 BRADI_1g09890v3 4 BRADI_1g77505v3 384 BRADI_1g48960v3 1 SRR5579249 completed mapping pipeline successfully