Starting /dee2/code/volunteer_pipeline.sh SRR5579250 current disk space = 1523293278208 free memory = 1598616492 SRR5579250 SRAfilesize a266972f1ecb9a38636e5b8fb7b23fd2 SRR5579250.sra SRR5579250.sra file validated SRR5579250 is paired end SRR5579250 is conventional basespace SRR5579250 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579250_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.70075 34.0 33.0 34.0 32.0 34.0 2 32.89425 34.0 33.0 34.0 31.0 34.0 3 33.01175 34.0 33.0 34.0 32.0 34.0 4 33.1215 34.0 33.0 34.0 32.0 34.0 5 32.984 34.0 33.0 34.0 32.0 34.0 6 36.86875 38.0 37.0 38.0 35.0 38.0 7 37.1425 38.0 38.0 38.0 36.0 38.0 8 37.29875 38.0 38.0 38.0 37.0 38.0 9 37.38675 38.0 38.0 38.0 37.0 38.0 10-14 37.28435 38.0 38.0 38.0 37.0 38.0 15-19 37.281400000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.2319 38.0 38.0 38.0 36.6 38.0 25-29 37.1183 38.0 38.0 38.0 36.6 38.0 30-34 36.977250000000005 38.0 38.0 38.0 36.0 38.0 35-39 36.691449999999996 38.0 38.0 38.0 35.0 38.0 40-44 36.674850000000006 38.0 38.0 38.0 34.6 38.0 45-49 36.60385 38.0 38.0 38.0 34.6 38.0 50-54 37.03435 38.0 38.0 38.0 36.0 38.0 55-59 36.864 38.0 38.0 38.0 35.6 38.0 60-64 36.909 38.0 38.0 38.0 35.6 38.0 65-69 36.26115 38.0 38.0 38.0 33.2 38.0 70-74 36.5829 38.0 38.0 38.0 34.4 38.0 75-79 36.54355 38.0 38.0 38.0 34.6 38.0 80-84 36.30159999999999 38.0 38.0 38.0 33.8 38.0 85-89 36.41555 38.0 38.0 38.0 34.0 38.0 90-94 36.249849999999995 38.0 38.0 38.0 33.8 38.0 95-99 36.21615 38.0 38.0 38.0 33.6 38.0 100-104 35.78789999999999 38.0 37.2 38.0 31.8 38.0 105-109 35.644 38.0 36.8 38.0 31.4 38.0 110-114 35.44785 38.0 36.4 38.0 30.0 38.0 115-119 35.157 38.0 36.0 38.0 28.8 38.0 120-124 34.967099999999995 38.0 35.6 38.0 27.4 38.0 125-129 33.8798 38.0 34.0 38.0 22.4 38.0 130-134 34.468650000000004 38.0 34.8 38.0 25.4 38.0 135-139 34.211850000000005 38.0 34.2 38.0 24.2 38.0 140-144 34.077000000000005 38.0 33.8 38.0 24.6 38.0 145-149 33.220349999999996 38.0 33.0 38.0 19.8 38.0 150-151 28.49575 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 1.0 5 0.0 6 0.0 7 2.0 8 2.0 9 1.0 10 1.0 11 0.0 12 1.0 13 1.0 14 0.0 15 2.0 16 3.0 17 3.0 18 6.0 19 7.0 20 5.0 21 9.0 22 9.0 23 11.0 24 7.0 25 19.0 26 25.0 27 44.0 28 38.0 29 51.0 30 55.0 31 79.0 32 96.0 33 118.0 34 199.0 35 307.0 36 731.0 37 2165.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.57773109243697 16.491596638655462 6.959033613445379 25.971638655462186 2 23.35 20.025000000000002 33.800000000000004 22.825 3 21.975 27.325 25.324999999999996 25.374999999999996 4 27.575 31.25 20.625 20.549999999999997 5 24.69879518072289 34.63855421686747 21.66164658634538 19.001004016064257 6 20.3 32.5 23.674999999999997 23.525 7 16.525000000000002 19.875 41.05 22.55 8 19.5 20.599999999999998 28.499999999999996 31.4 9 20.95 19.825 29.725 29.5 10-14 23.169999999999998 26.13 25.045 25.655 15-19 23.94 25.61 24.965 25.485000000000003 20-24 23.26 25.47 25.5 25.77 25-29 24.06120306015301 25.19625981299065 25.186259312965646 25.556277813890695 30-34 23.580000000000002 25.91 25.014999999999997 25.495 35-39 22.994999999999997 25.995 25.259999999999998 25.75 40-44 23.73 25.585 24.88 25.805 45-49 23.68 25.495 24.945 25.88 50-54 24.45 25.080000000000002 25.005 25.465 55-59 23.54 25.36 25.15 25.95 60-64 23.674999999999997 24.985 25.11 26.229999999999997 65-69 23.735 25.130000000000003 24.67 26.465 70-74 24.240000000000002 25.3 24.515 25.945 75-79 24.03 25.36 25.085 25.525 80-84 24.595 25.275 24.625 25.505 85-89 23.855 25.759999999999998 25.074999999999996 25.31 90-94 24.135 25.55 24.32 25.995 95-99 24.265 24.94 24.865000000000002 25.929999999999996 100-104 24.21 25.235000000000003 24.645 25.91 105-109 24.805 24.67 24.845 25.679999999999996 110-114 24.355 25.735000000000003 24.515 25.395 115-119 24.16483296659332 25.58511702340468 24.33486697339468 25.91518303660732 120-124 24.21 25.905 24.474999999999998 25.41 125-129 24.52245224522452 25.662566256625663 23.86738673867387 25.947594759475944 130-134 24.560000000000002 25.615 24.23 25.595000000000002 135-139 24.718707806170926 25.263789568435264 24.16862529379407 25.84887733159974 140-144 24.157415741574155 25.112511251125113 24.3974397439744 26.332633263326333 145-149 23.765941485371343 25.66641660415104 24.33108277069267 26.236559139784948 150-151 24.57807225903238 25.565695711963997 24.32804100512564 25.528191023877984 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.5 22 1.0 23 0.0 24 0.0 25 1.5 26 2.0 27 1.0 28 2.5 29 4.5 30 9.0 31 12.0 32 15.0 33 17.5 34 22.0 35 33.5 36 52.0 37 70.5 38 78.0 39 99.5 40 129.0 41 146.0 42 165.5 43 192.0 44 196.5 45 185.0 46 186.5 47 191.0 48 188.0 49 172.0 50 156.0 51 139.5 52 122.5 53 111.0 54 102.5 55 103.5 56 94.5 57 84.0 58 91.0 59 93.0 60 80.0 61 72.0 62 76.5 63 71.5 64 71.5 65 62.0 66 47.0 67 50.0 68 45.0 69 38.0 70 29.0 71 19.5 72 17.5 73 13.5 74 9.5 75 7.5 76 3.0 77 2.5 78 4.5 79 3.0 80 1.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.8 2 0.0 3 0.0 4 0.0 5 0.4 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.02 120-124 0.0 125-129 0.01 130-134 0.0 135-139 0.015 140-144 0.01 145-149 0.025 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49736114601659 98.97500000000001 2 0.4775069112842423 0.95 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.16249999999999998 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.2875 0.0 0.0 0.0 0.0 74-75 0.325 0.0 0.0 0.0 0.0 76-77 0.4375 0.0 0.0 0.0 0.0 78-79 0.575 0.0 0.0 0.0 0.0 80-81 0.65 0.0 0.0 0.0 0.0 82-83 0.8 0.0 0.0 0.0 0.0 84-85 0.975 0.0 0.0 0.0 0.0 86-87 1.1625 0.0 0.0 0.0 0.0 88-89 1.4375 0.0 0.0 0.0 0.0 90-91 1.6625 0.0 0.0 0.0 0.0 92-93 2.0250000000000004 0.0 0.0 0.0 0.0 94-95 2.2750000000000004 0.0 0.0 0.0 0.0 96-97 2.5875000000000004 0.0 0.0 0.0 0.0 98-99 2.95 0.0 0.0 0.0 0.0 100-101 3.3625 0.0 0.0 0.0 0.0 102-103 3.6624999999999996 0.0 0.0 0.0 0.0 104-105 4.05 0.0 0.0 0.0 0.0 106-107 4.362500000000001 0.0 0.0 0.0 0.0 108-109 4.762499999999999 0.0 0.0 0.0 0.0 110-111 5.1125 0.0 0.0 0.0 0.0 112-113 5.625 0.0 0.0 0.0 0.0 114-115 6.1875 0.0 0.0 0.0 0.0 116-117 6.737500000000001 0.0 0.0 0.0 0.0 118-119 7.325 0.0 0.0 0.0 0.0 120-121 7.95 0.0 0.0 0.0 0.0 122-123 8.625 0.0 0.0 0.0 0.0 124-125 9.325 0.0 0.0 0.0 0.0 126-127 10.0125 0.0 0.0 0.0 0.0 128-129 10.65 0.0 0.0 0.0 0.0 130-131 11.412500000000001 0.0 0.0 0.0 0.0 132-133 11.8125 0.0 0.0 0.0 0.0 134-135 12.5 0.0 0.0 0.0 0.0 136-137 13.3 0.0 0.0 0.0 0.0 138-139 14.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCTGC 10 0.0068343505 144.975 145 >>END_MODULE SRR5579250 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579250_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4635 33.0 33.0 34.0 32.0 34.0 2 32.52 33.0 33.0 34.0 31.0 34.0 3 32.54525 33.0 33.0 34.0 32.0 34.0 4 32.494 33.0 33.0 34.0 32.0 34.0 5 32.53975 33.0 33.0 34.0 32.0 34.0 6 36.54325 38.0 38.0 38.0 34.0 38.0 7 36.55175 38.0 38.0 38.0 35.0 38.0 8 36.50275 38.0 38.0 38.0 34.0 38.0 9 36.14275 38.0 38.0 38.0 33.0 38.0 10-14 36.458 38.0 38.0 38.0 34.4 38.0 15-19 36.4906 38.0 38.0 38.0 34.8 38.0 20-24 36.4548 38.0 38.0 38.0 34.8 38.0 25-29 36.26845 38.0 38.0 38.0 34.0 38.0 30-34 36.35875 38.0 38.0 38.0 34.2 38.0 35-39 36.48405 38.0 38.0 38.0 34.8 38.0 40-44 36.43315 38.0 38.0 38.0 34.8 38.0 45-49 36.42425 38.0 38.0 38.0 35.0 38.0 50-54 36.3135 38.0 38.0 38.0 34.2 38.0 55-59 36.3076 38.0 38.0 38.0 34.0 38.0 60-64 36.275850000000005 38.0 38.0 38.0 34.0 38.0 65-69 36.05415000000001 38.0 38.0 38.0 33.6 38.0 70-74 35.75015 38.0 38.0 38.0 31.8 38.0 75-79 35.47605 38.0 37.4 38.0 29.8 38.0 80-84 35.577 38.0 37.2 38.0 30.6 38.0 85-89 35.64845 38.0 37.4 38.0 31.6 38.0 90-94 35.62195 38.0 37.6 38.0 31.4 38.0 95-99 35.470749999999995 38.0 37.0 38.0 30.6 38.0 100-104 35.222899999999996 38.0 37.0 38.0 29.0 38.0 105-109 35.06555 38.0 36.4 38.0 28.6 38.0 110-114 34.56904999999999 38.0 35.2 38.0 25.4 38.0 115-119 34.1753 38.0 35.0 38.0 22.8 38.0 120-124 33.48935 38.0 34.6 38.0 16.2 38.0 125-129 32.7585 38.0 33.2 38.0 14.0 38.0 130-134 32.655649999999994 38.0 33.0 38.0 13.4 38.0 135-139 32.00215 38.0 31.4 38.0 13.0 38.0 140-144 31.34055 38.0 31.2 38.0 8.6 38.0 145-149 29.89705 38.0 28.6 38.0 2.0 38.0 150-151 24.2805 32.5 12.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 21.0 3 14.0 4 5.0 5 5.0 6 3.0 7 1.0 8 1.0 9 2.0 10 1.0 11 2.0 12 8.0 13 1.0 14 2.0 15 3.0 16 6.0 17 13.0 18 4.0 19 13.0 20 13.0 21 15.0 22 16.0 23 19.0 24 21.0 25 28.0 26 32.0 27 49.0 28 67.0 29 67.0 30 85.0 31 83.0 32 129.0 33 140.0 34 213.0 35 364.0 36 636.0 37 1918.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.824999999999996 16.05 9.175 22.95 2 26.825 21.125 29.225 22.825 3 23.825 23.425 27.250000000000004 25.5 4 28.9 31.85 17.349999999999998 21.9 5 26.35 34.775 18.775 20.1 6 21.975 34.150000000000006 19.75 24.125 7 21.925 15.049999999999999 38.375 24.65 8 22.2 19.225 25.575 33.0 9 24.425 20.974999999999998 24.625 29.975 10-14 26.240000000000002 25.4 23.169999999999998 25.19 15-19 25.97 24.435000000000002 24.125 25.47 20-24 25.679999999999996 25.009999999999998 23.990000000000002 25.319999999999997 25-29 25.345000000000002 25.245 24.505 24.905 30-34 25.825 25.230000000000004 24.19 24.755 35-39 26.0 24.245 24.4 25.355 40-44 26.235000000000003 24.985 23.84 24.94 45-49 26.255 24.695 24.45 24.6 50-54 26.584999999999997 24.34 24.355 24.72 55-59 26.305 24.605 24.075 25.014999999999997 60-64 26.174999999999997 24.385 25.124999999999996 24.315 65-69 26.05 25.085 24.349999999999998 24.515 70-74 26.240000000000002 24.990000000000002 24.125 24.645 75-79 26.325 24.455 24.349999999999998 24.87 80-84 26.275 24.935 24.315 24.474999999999998 85-89 25.525 25.014999999999997 25.0 24.46 90-94 26.165 24.975 24.55 24.310000000000002 95-99 26.265 25.15 24.349999999999998 24.235 100-104 26.33 25.06 24.245 24.365000000000002 105-109 27.235 25.055 24.02 23.69 110-114 27.029999999999998 25.745 23.48 23.745 115-119 26.935 25.740000000000002 24.279999999999998 23.044999999999998 120-124 27.029999999999998 25.66 23.71 23.599999999999998 125-129 27.765 25.669999999999998 23.615 22.95 130-134 27.63 25.64 24.310000000000002 22.42 135-139 28.349999999999998 25.39 23.735 22.525000000000002 140-144 27.73 26.090000000000003 23.79 22.39 145-149 28.084999999999997 26.895000000000003 23.494999999999997 21.525 150-151 28.475 26.224999999999998 23.525 21.775 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 1.5 26 2.0 27 2.0 28 2.5 29 4.0 30 4.0 31 7.5 32 13.5 33 15.5 34 20.5 35 26.5 36 32.5 37 42.0 38 63.5 39 83.5 40 105.0 41 141.0 42 155.0 43 161.0 44 167.0 45 174.5 46 191.0 47 180.0 48 172.5 49 164.0 50 151.0 51 143.0 52 128.0 53 110.5 54 103.0 55 112.0 56 93.5 57 86.0 58 96.5 59 87.5 60 93.0 61 109.0 62 101.5 63 89.5 64 83.5 65 75.5 66 74.0 67 64.5 68 53.5 69 50.0 70 41.5 71 34.5 72 25.0 73 18.0 74 16.5 75 8.0 76 5.0 77 3.5 78 0.5 79 1.0 80 1.0 81 1.0 82 1.0 83 1.0 84 1.0 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26915322580645 98.475 2 0.6804435483870968 1.35 3 0.025201612903225805 0.075 4 0.025201612903225805 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.1375 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.2875 0.0 0.0 0.0 0.0 74-75 0.325 0.0 0.0 0.0 0.0 76-77 0.4375 0.0 0.0 0.0 0.0 78-79 0.575 0.0 0.0 0.0 0.0 80-81 0.65 0.0 0.0 0.0 0.0 82-83 0.8 0.0 0.0 0.0 0.0 84-85 0.975 0.0 0.0 0.0 0.0 86-87 1.175 0.0 0.0 0.0 0.0 88-89 1.45 0.0 0.0 0.0 0.0 90-91 1.65 0.0 0.0 0.0 0.0 92-93 1.9625 0.0 0.0 0.0 0.0 94-95 2.25 0.0 0.0 0.0 0.0 96-97 2.5374999999999996 0.0 0.0 0.0 0.0 98-99 2.9 0.0 0.0 0.0 0.0 100-101 3.3375 0.0 0.0 0.0 0.0 102-103 3.625 0.0 0.0 0.0 0.0 104-105 3.975 0.0 0.0 0.0 0.0 106-107 4.262499999999999 0.0 0.0 0.0 0.0 108-109 4.6875 0.0 0.0 0.0 0.0 110-111 5.0375 0.0 0.0 0.0 0.0 112-113 5.574999999999999 0.0 0.0 0.0 0.0 114-115 6.125 0.0 0.0 0.0 0.0 116-117 6.675 0.0 0.0 0.0 0.0 118-119 7.237500000000001 0.0 0.0 0.0 0.0 120-121 7.825 0.0 0.0 0.0 0.0 122-123 8.4875 0.0 0.0 0.0 0.0 124-125 9.2125 0.0 0.0 0.0 0.0 126-127 9.9375 0.0 0.0 0.0 0.0 128-129 10.625 0.0 0.0 0.0 0.0 130-131 11.3875 0.0 0.0 0.0 0.0 132-133 11.8 0.0 0.0 0.0 0.0 134-135 12.5 0.0 0.0 0.0 0.0 136-137 13.2625 0.0 0.0 0.0 0.0 138-139 14.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 125 4.26335E-4 10.440001 135-139 >>END_MODULE Read 1159607 spots for SRR5579250.sra Written 1159607 spots for SRR5579250.sra Read 1159607 spots for SRR5579250.sra Written 1159607 spots for SRR5579250.sra Read 1159607 spots for SRR5579250.sra Written 1159607 spots for SRR5579250.sra Read 1159607 spots for SRR5579250.sra Written 1159607 spots for SRR5579250.sra Read 1159607 spots for SRR5579250.sra Written 1159607 spots for SRR5579250.sra Read 1159607 spots for SRR5579250.sra Written 1159607 spots for SRR5579250.sra Read 1159607 spots for SRR5579250.sra Written 1159607 spots for SRR5579250.sra Read 1159607 spots for SRR5579250.sra Written 1159607 spots for SRR5579250.sra Read 1159607 spots for SRR5579250.sra Written 1159607 spots for SRR5579250.sra Read 1159607 spots for SRR5579250.sra Written 1159607 spots for SRR5579250.sra Read 1159607 spots for SRR5579250.sra Written 1159607 spots for SRR5579250.sra Read 1159607 spots for SRR5579250.sra Written 1159607 spots for SRR5579250.sra Read 1159607 spots for SRR5579250.sra Written 1159607 spots for SRR5579250.sra Read 1159607 spots for SRR5579250.sra Written 1159607 spots for SRR5579250.sra Read 1159607 spots for SRR5579250.sra Written 1159607 spots for SRR5579250.sra Read 1159607 spots for SRR5579250.sra Written 1159607 spots for SRR5579250.sra Read 1159607 spots for SRR5579250.sra Written 1159607 spots for SRR5579250.sra Read 1159607 spots for SRR5579250.sra Written 1159607 spots for SRR5579250.sra Read 1159610 spots for SRR5579250.sra Written 1159610 spots for SRR5579250.sra Read 1159607 spots for SRR5579250.sra Written 1159607 spots for SRR5579250.sra SRR ids: ['SRR5579250.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zq7q6tcw SRR5579250.sra spots: 23192143 blocks: [[1, 1159607], [1159608, 2319214], [2319215, 3478821], [3478822, 4638428], [4638429, 5798035], [5798036, 6957642], [6957643, 8117249], [8117250, 9276856], [9276857, 10436463], [10436464, 11596070], [11596071, 12755677], [12755678, 13915284], [13915285, 15074891], [15074892, 16234498], [16234499, 17394105], [17394106, 18553712], [18553713, 19713319], [19713320, 20872926], [20872927, 22032533], [22032534, 23192143]] SRR5579250 file size 7837355 SRR5579250 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579250 SRR5579250_1.fastq SRR5579250_2.fastq Input file: SRR5579250_1.fastq Paired file: SRR5579250_2.fastq trimmed: SRR5579250-trimmed-pair1.fastq, SRR5579250-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 23:33:00 2024 >> started Mon Dec 9 23:33:32 2024 >> done (31.733s) 23192143 read pairs processed; of these: 51598 ( 0.22%) short read pairs filtered out after trimming by size control 72266 ( 0.31%) empty read pairs filtered out after trimming by size control 23068279 (99.47%) read pairs available; of these: 13913337 (60.31%) trimmed read pairs available after processing 9154942 (39.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 22 0.00% 19 20 0.00% 20 28 0.00% 21 26 0.00% 22 36 0.00% 23 31 0.00% 24 25 0.00% 25 36 0.00% 26 30 0.00% 27 41 0.00% 28 41 0.00% 29 52 0.00% 30 45 0.00% 31 62 0.00% 32 60 0.00% 33 53 0.00% 34 64 0.00% 35 90 0.00% 36 109 0.00% 37 111 0.00% 38 132 0.00% 39 127 0.00% 40 172 0.00% 41 166 0.00% 42 209 0.00% 43 198 0.00% 44 241 0.00% 45 256 0.00% 46 319 0.00% 47 377 0.00% 48 455 0.00% 49 545 0.00% 50 564 0.00% 51 663 0.00% 52 753 0.00% 53 765 0.00% 54 892 0.00% 55 935 0.00% 56 1079 0.00% 57 1326 0.01% 58 1486 0.01% 59 1688 0.01% 60 2044 0.01% 61 2337 0.01% 62 2506 0.01% 63 2721 0.01% 64 3062 0.01% 65 3354 0.01% 66 3860 0.02% 67 4096 0.02% 68 4792 0.02% 69 6016 0.03% 70 6674 0.03% 71 7160 0.03% 72 8255 0.04% 73 8871 0.04% 74 9526 0.04% 75 10472 0.05% 76 11267 0.05% 77 12018 0.05% 78 13678 0.06% 79 14958 0.06% 80 16962 0.07% 81 18712 0.08% 82 21269 0.09% 83 23098 0.10% 84 27055 0.12% 85 28786 0.12% 86 29348 0.13% 87 30592 0.13% 88 32019 0.14% 89 33891 0.15% 90 36385 0.16% 91 38494 0.17% 92 40986 0.18% 93 44096 0.19% 94 46020 0.20% 95 47200 0.20% 96 48531 0.21% 97 48813 0.21% 98 50433 0.22% 99 53222 0.23% 100 55518 0.24% 101 58179 0.25% 102 61157 0.27% 103 63598 0.28% 104 65570 0.28% 105 67018 0.29% 106 68253 0.30% 107 68197 0.30% 108 70484 0.31% 109 71048 0.31% 110 73310 0.32% 111 76485 0.33% 112 79272 0.34% 113 81279 0.35% 114 85415 0.37% 115 87069 0.38% 116 86956 0.38% 117 88823 0.39% 118 87778 0.38% 119 90210 0.39% 120 92515 0.40% 121 94563 0.41% 122 96825 0.42% 123 101985 0.44% 124 105649 0.46% 125 106941 0.46% 126 110458 0.48% 127 110226 0.48% 128 110451 0.48% 129 113946 0.49% 130 114324 0.50% 131 118176 0.51% 132 124046 0.54% 133 128902 0.56% 134 133546 0.58% 135 140911 0.61% 136 145701 0.63% 137 149305 0.65% 138 155849 0.68% 139 163044 0.71% 140 174182 0.76% 141 187667 0.81% 142 208217 0.90% 143 218421 0.95% 144 248946 1.08% 145 286140 1.24% 146 341919 1.48% 147 455487 1.97% 148 622220 2.70% 149 1166654 5.06% 150 5232593 22.68% 151 9154942 39.69% 23068279 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=23 prefix-density=0.72 prefix-fanout=2.0 sequence=GGCTTGAAGGCGATGAAGCTGATGCACTGCACCTGCCGGGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.17 sequence-density-rank=27 fanout-score=12.76 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=4.2 sequence=ACTTGCCGGGGACGAAGTTGGTGGCGAAGGCCCA criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=3.86 fanout-score-rank=8 prefix-density=0.77 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=45.81 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=3.7 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGGCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR5579250 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 23:34:20 Started mapping on | Dec 09 23:34:20 Finished on | Dec 09 23:37:21 Mapping speed, Million of reads per hour | 458.82 Number of input reads | 23068279 Average input read length | 285 UNIQUE READS: Uniquely mapped reads number | 21644848 Uniquely mapped reads % | 93.83% Average mapped length | 284.98 Number of splices: Total | 22501689 Number of splices: Annotated (sjdb) | 21292195 Number of splices: GT/AG | 22207551 Number of splices: GC/AG | 264715 Number of splices: AT/AC | 11214 Number of splices: Non-canonical | 18209 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.32 Insertion rate per base | 0.00% Insertion average length | 1.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 223225 % of reads mapped to multiple loci | 0.97% Number of reads mapped to too many loci | 8865 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.96% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1240297 1240297 1240297 N_multimapping 223225 223225 223225 N_noFeature 697705 20969535 966424 N_ambiguous 476078 3116 69981 UnstrandedReadsAssigned:20471065 PositiveStrandReadsAssigned:672197 NegativeStrandReadsAssigned:20608443 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=142 echo kmer=137 SRR5579250 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579250-trimmed-pair1.fastq SRR5579250-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,068,279 reads, 20,726,599 reads pseudoaligned [quant] estimated average fragment length: 234.991 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,139 rounds 52973 SRR5579250.ke.tsv 35125 SRR5579250.se.tsv 88098 total ==> SRR5579250.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 702.509 0 0 PNS24247 1044 810.009 67.3048 5.81661 PNS24249 1928 1694.01 48.8817 2.01997 PNS24246 1044 810.009 67.3048 5.81661 PNS24248 1044 810.009 67.3048 5.81661 PNS24244 1471 1237.01 114.204 6.46282 PNS24243 293 112.818 0 0 KQK14069 1603 1369.01 7839.72 400.874 KQK14071 474 258.396 198.977 53.9052 ==> SRR5579250.se.tsv <== BRADI_1g14170v3 8829 BRADI_1g53295v3 81 BRADI_1g59795v3 614 BRADI_1g07683v3 0 BRADI_1g00485v3 55 BRADI_1g20270v3 2808 BRADI_1g74790v3 82 BRADI_1g09890v3 3 BRADI_1g77505v3 293 BRADI_1g48960v3 0 SRR5579250 completed mapping pipeline successfully