Starting /dee2/code/volunteer_pipeline.sh SRR5579251 current disk space = 1523312771072 free memory = 1402760152 SRR5579251 SRAfilesize b8091ab3f9d0e44b3385a7a0ab23a9be SRR5579251.sra SRR5579251.sra file validated SRR5579251 is paired end SRR5579251 is conventional basespace SRR5579251 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579251_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.01925 34.0 34.0 34.0 33.0 34.0 2 33.56025 34.0 34.0 34.0 33.0 34.0 3 33.68175 34.0 34.0 34.0 33.0 34.0 4 33.73775 34.0 34.0 34.0 33.0 34.0 5 33.7 34.0 34.0 34.0 33.0 34.0 6 37.65375 38.0 38.0 38.0 37.0 38.0 7 37.7275 38.0 38.0 38.0 38.0 38.0 8 37.7735 38.0 38.0 38.0 38.0 38.0 9 37.78075 38.0 38.0 38.0 38.0 38.0 10-14 37.76225 38.0 38.0 38.0 38.0 38.0 15-19 37.7822 38.0 38.0 38.0 38.0 38.0 20-24 37.7958 38.0 38.0 38.0 38.0 38.0 25-29 37.75255 38.0 38.0 38.0 38.0 38.0 30-34 37.7872 38.0 38.0 38.0 38.0 38.0 35-39 37.70415 38.0 38.0 38.0 38.0 38.0 40-44 37.645199999999996 38.0 38.0 38.0 38.0 38.0 45-49 37.62855 38.0 38.0 38.0 38.0 38.0 50-54 37.674 38.0 38.0 38.0 38.0 38.0 55-59 37.62135 38.0 38.0 38.0 38.0 38.0 60-64 37.65755 38.0 38.0 38.0 38.0 38.0 65-69 37.59135 38.0 38.0 38.0 38.0 38.0 70-74 37.6175 38.0 38.0 38.0 38.0 38.0 75-79 37.56655 38.0 38.0 38.0 38.0 38.0 80-84 37.4919 38.0 38.0 38.0 38.0 38.0 85-89 37.48480000000001 38.0 38.0 38.0 38.0 38.0 90-94 37.45535 38.0 38.0 38.0 38.0 38.0 95-99 37.400850000000005 38.0 38.0 38.0 37.6 38.0 100-104 37.3039 38.0 38.0 38.0 37.0 38.0 105-109 37.201649999999994 38.0 38.0 38.0 36.2 38.0 110-114 37.07435 38.0 38.0 38.0 36.0 38.0 115-119 37.06734999999999 38.0 38.0 38.0 36.0 38.0 120-124 36.9829 38.0 38.0 38.0 35.8 38.0 125-129 36.898399999999995 38.0 38.0 38.0 35.2 38.0 130-134 36.76225 38.0 38.0 38.0 35.0 38.0 135-139 36.6685 38.0 38.0 38.0 35.0 38.0 140-144 36.44355 38.0 38.0 38.0 34.2 38.0 145-149 36.045649999999995 38.0 38.0 38.0 33.0 38.0 150-151 32.59125 35.5 33.0 38.0 17.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 2.0 11 1.0 12 0.0 13 1.0 14 0.0 15 0.0 16 1.0 17 1.0 18 1.0 19 0.0 20 2.0 21 1.0 22 1.0 23 5.0 24 4.0 25 2.0 26 5.0 27 5.0 28 11.0 29 13.0 30 13.0 31 21.0 32 28.0 33 26.0 34 55.0 35 116.0 36 306.0 37 3378.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.75159723996933 16.02351137234858 9.838998211091235 30.38589317659085 2 22.650000000000002 19.45 35.125 22.775000000000002 3 21.975 25.525 24.65 27.85 4 25.974999999999998 32.45 19.925 21.65 5 23.125 35.699999999999996 21.925 19.25 6 18.65 36.275 22.95 22.125 7 16.725 21.0 41.125 21.15 8 19.625 21.925 26.8 31.65 9 19.05 21.3 30.45 29.2 10-14 22.720000000000002 26.640000000000004 25.53 25.11 15-19 22.735 26.36 25.635 25.27 20-24 22.746137306865343 25.796289814490724 26.066303315165758 25.391269563478176 25-29 22.036101805090254 26.446322316115804 26.03130156507825 25.486274313715683 30-34 22.689999999999998 26.75 25.655 24.905 35-39 22.85 25.75 26.0 25.4 40-44 23.1 26.58 25.775 24.545 45-49 22.759999999999998 26.484999999999996 25.715 25.040000000000003 50-54 22.475 26.215 26.13 25.180000000000003 55-59 23.06230623062306 26.82268226822682 25.272527252725276 24.842484248424842 60-64 23.165 26.05 25.729999999999997 25.055 65-69 22.81 25.895000000000003 26.015 25.28 70-74 23.895 26.235000000000003 25.75 24.12 75-79 23.365 25.895000000000003 25.759999999999998 24.98 80-84 23.34 25.965 25.605 25.09 85-89 23.400000000000002 26.145000000000003 25.75 24.705 90-94 23.055 26.26 25.505 25.180000000000003 95-99 23.39 25.715 25.31 25.585 100-104 23.030757689422355 25.941485371342836 25.496374093523382 25.531382845711427 105-109 23.371033930537482 26.06345711140026 25.427885096586927 25.137623861475326 110-114 23.59089772443111 26.261565391347837 25.251312828207052 24.896224056014006 115-119 23.34 26.105 25.435000000000002 25.119999999999997 120-124 23.49 26.195 24.64 25.674999999999997 125-129 23.080000000000002 26.08 25.455 25.385 130-134 23.535 26.305 24.26 25.900000000000002 135-139 23.395 26.6 24.855 25.15 140-144 23.215 27.075 24.415 25.295 145-149 23.49 26.634999999999998 24.785 25.09 150-151 22.875 25.874999999999996 25.624999999999996 25.624999999999996 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.5 24 0.5 25 0.5 26 1.5 27 2.5 28 3.5 29 7.0 30 11.5 31 11.0 32 13.5 33 28.0 34 42.0 35 46.0 36 62.0 37 75.0 38 85.0 39 122.0 40 138.5 41 156.0 42 177.5 43 184.5 44 198.5 45 210.0 46 222.5 47 217.5 48 203.5 49 175.0 50 160.5 51 164.5 52 136.0 53 105.0 54 104.5 55 108.0 56 99.5 57 93.0 58 81.5 59 72.5 60 68.5 61 56.0 62 53.0 63 50.0 64 37.0 65 30.0 66 30.5 67 36.5 68 31.0 69 19.5 70 18.5 71 14.5 72 8.5 73 8.5 74 7.0 75 2.5 76 2.5 77 3.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.005 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.01 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.025 105-109 0.09 110-114 0.025 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0125 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.44999999999999996 0.0 0.0 0.0 0.0 86-87 0.55 0.0 0.0 0.0 0.0 88-89 0.6875 0.0 0.0 0.0 0.0 90-91 0.825 0.0 0.0 0.0 0.0 92-93 0.9750000000000001 0.0 0.0 0.0 0.0 94-95 1.1749999999999998 0.0 0.0 0.0 0.0 96-97 1.425 0.0 0.0 0.0 0.0 98-99 1.775 0.0 0.0 0.0 0.0 100-101 1.975 0.0 0.0 0.0 0.0 102-103 2.35 0.0 0.0 0.0 0.0 104-105 2.6875 0.0 0.0 0.0 0.0 106-107 3.125 0.0 0.0 0.0 0.0 108-109 3.55 0.0 0.0 0.0 0.0 110-111 3.9625000000000004 0.0 0.0 0.0 0.0 112-113 4.362500000000001 0.0 0.0 0.0 0.0 114-115 4.737500000000001 0.0 0.0 0.0 0.0 116-117 5.2625 0.0 0.0 0.0 0.0 118-119 5.75 0.0 0.0 0.0 0.0 120-121 6.225 0.0 0.0 0.0 0.0 122-123 6.625 0.0 0.0 0.0 0.0 124-125 7.175000000000001 0.0 0.0 0.0 0.0 126-127 7.7125 0.0 0.0 0.0 0.0 128-129 8.45 0.0 0.0 0.0 0.0 130-131 9.287500000000001 0.0 0.0 0.0 0.0 132-133 9.925 0.0 0.0 0.0 0.0 134-135 10.6375 0.0 0.0 0.0 0.0 136-137 11.2625 0.0 0.0 0.0 0.0 138-139 11.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACCACC 10 0.006832588 144.9875 9 AAAAAAA 85 1.1507094E-5 15.351617 135-139 >>END_MODULE SRR5579251 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579251_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.22 34.0 33.0 34.0 33.0 34.0 2 33.269 34.0 33.0 34.0 33.0 34.0 3 33.29625 34.0 33.0 34.0 33.0 34.0 4 33.2425 34.0 33.0 34.0 33.0 34.0 5 33.2475 34.0 33.0 34.0 33.0 34.0 6 37.48775 38.0 38.0 38.0 38.0 38.0 7 37.44925 38.0 38.0 38.0 38.0 38.0 8 37.4365 38.0 38.0 38.0 38.0 38.0 9 37.49875 38.0 38.0 38.0 38.0 38.0 10-14 37.4582 38.0 38.0 38.0 38.0 38.0 15-19 37.47585 38.0 38.0 38.0 38.0 38.0 20-24 37.45455 38.0 38.0 38.0 38.0 38.0 25-29 37.45245 38.0 38.0 38.0 38.0 38.0 30-34 37.46 38.0 38.0 38.0 38.0 38.0 35-39 37.49985 38.0 38.0 38.0 38.0 38.0 40-44 37.4422 38.0 38.0 38.0 38.0 38.0 45-49 37.467349999999996 38.0 38.0 38.0 38.0 38.0 50-54 37.4619 38.0 38.0 38.0 38.0 38.0 55-59 37.42155 38.0 38.0 38.0 38.0 38.0 60-64 37.42655 38.0 38.0 38.0 38.0 38.0 65-69 37.38035 38.0 38.0 38.0 38.0 38.0 70-74 37.29885 38.0 38.0 38.0 38.0 38.0 75-79 37.258500000000005 38.0 38.0 38.0 38.0 38.0 80-84 37.15605000000001 38.0 38.0 38.0 38.0 38.0 85-89 37.23244999999999 38.0 38.0 38.0 38.0 38.0 90-94 37.1878 38.0 38.0 38.0 37.8 38.0 95-99 37.1471 38.0 38.0 38.0 37.6 38.0 100-104 37.08 38.0 38.0 38.0 37.0 38.0 105-109 36.989799999999995 38.0 38.0 38.0 36.6 38.0 110-114 36.95115 38.0 38.0 38.0 36.6 38.0 115-119 36.799099999999996 38.0 38.0 38.0 35.8 38.0 120-124 36.5541 38.0 38.0 38.0 35.0 38.0 125-129 36.461149999999996 38.0 38.0 38.0 35.0 38.0 130-134 36.31535 38.0 38.0 38.0 34.4 38.0 135-139 35.99249999999999 38.0 38.0 38.0 33.4 38.0 140-144 35.6472 38.0 38.0 38.0 32.0 38.0 145-149 35.0987 38.0 36.8 38.0 30.6 38.0 150-151 31.024625 35.5 29.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 0.0 4 4.0 5 0.0 6 1.0 7 2.0 8 2.0 9 2.0 10 2.0 11 1.0 12 3.0 13 0.0 14 1.0 15 1.0 16 3.0 17 5.0 18 3.0 19 2.0 20 2.0 21 2.0 22 5.0 23 6.0 24 4.0 25 15.0 26 9.0 27 12.0 28 10.0 29 16.0 30 20.0 31 15.0 32 31.0 33 40.0 34 44.0 35 121.0 36 337.0 37 3271.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.83709273182958 16.892230576441104 12.230576441102757 26.04010025062657 2 28.22378324134471 21.801304565980935 30.030105368790768 19.944806823883592 3 22.768304914744235 25.55165496489468 28.184553660982946 23.495486459378135 4 27.76104417670683 32.10341365461847 19.427710843373493 20.707831325301203 5 27.398292315419386 34.053239578101454 18.784530386740332 19.763937719738824 6 21.6270337922403 34.51814768460576 20.250312891113893 23.60450563204005 7 19.19799498746867 16.265664160401002 39.64912280701755 24.887218045112782 8 21.965897693079235 21.439317953861583 24.523570712136408 32.07121364092277 9 22.35294117647059 22.778473091364205 27.083854818523157 27.784730913642054 10-14 25.02505512126679 26.393064742433353 23.8825415915013 24.699338544798557 15-19 25.300420588824352 25.716002403364712 24.58942519527338 24.394151812537554 20-24 24.71836979922896 26.03514744905623 25.324187653331997 23.92229509838282 25-29 25.136447849381604 25.7273045916579 25.246607580992443 23.889639977968052 30-34 24.981222773020882 25.88753692854639 25.11641880727054 24.014821491162188 35-39 25.108897010964803 25.69468782856857 25.574525609572923 23.62188955089371 40-44 25.081400591093523 25.632419976957372 25.276762009717977 24.009417422231127 45-49 25.194050778706995 26.155541088687468 24.51800290450198 24.132405228103558 50-54 25.598517479715515 25.83391766002204 25.24792146649304 23.319643393769407 55-59 24.74211316975463 25.498247371056586 25.883825738607914 23.875813720580872 60-64 25.110154215902263 24.834768676146606 25.7660725015021 24.289004606449026 65-69 25.301687446797853 25.607130338991535 25.261629362575732 23.82955285163487 70-74 25.44215642066236 25.341950999549073 25.557392654942635 23.658499924845934 75-79 25.480961923847694 25.410821643286575 25.430861723446895 23.67735470941884 80-84 25.442422419411443 25.72316639093598 25.342156715295534 23.492254474357047 85-89 25.250350490686962 25.5357500500701 25.5357500500701 23.678149409172843 90-94 25.118934348239776 25.6197105513546 25.689819219790678 23.571535880614952 95-99 25.481852315394242 25.792240300375468 25.151439299123908 23.574468085106385 100-104 26.067584480600754 25.99749687108886 25.42177722152691 22.513141426783477 105-109 25.995093376057675 26.010113653432132 24.993741551093976 23.001051419416214 110-114 26.02753441802253 26.047559449311642 24.986232790988737 22.938673341677095 115-119 26.558197747183982 26.162703379224027 25.11639549436796 22.16270337922403 120-124 26.13158421790507 26.11656318846385 25.32545563789305 22.426396955738035 125-129 26.64964453789927 26.078902573345346 24.86732752578352 22.404125362971865 130-134 27.137062446792527 26.220641995092393 24.723321147779057 21.91897441033602 135-139 26.6853651207052 26.314735049584293 25.353100270459784 21.646799559250727 140-144 27.016189664678464 26.409703774246907 24.67044258433161 21.903663976743022 145-149 27.11362952562431 26.05054658509678 25.047638150636846 21.788185738642063 150-151 27.62036108324975 25.70210631895687 26.654964894684053 20.022567703109328 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 5.0 1 2.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.5 23 2.5 24 1.5 25 1.5 26 1.5 27 0.5 28 2.0 29 5.0 30 6.5 31 11.0 32 17.0 33 23.5 34 24.0 35 28.0 36 46.0 37 60.5 38 77.0 39 102.5 40 114.5 41 133.5 42 162.0 43 178.0 44 187.0 45 200.5 46 206.0 47 212.5 48 205.5 49 182.5 50 160.0 51 151.5 52 154.5 53 138.0 54 123.0 55 118.5 56 111.5 57 93.0 58 81.5 59 75.0 60 69.5 61 64.5 62 66.0 63 64.0 64 51.5 65 43.5 66 40.0 67 41.0 68 35.0 69 24.5 70 20.0 71 20.0 72 18.0 73 15.0 74 9.0 75 5.0 76 5.0 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.35000000000000003 3 0.3 4 0.4 5 0.44999999999999996 6 0.125 7 0.25 8 0.3 9 0.125 10-14 0.22 15-19 0.13999999999999999 20-24 0.135 25-29 0.145 30-34 0.145 35-39 0.135 40-44 0.185 45-49 0.155 50-54 0.16999999999999998 55-59 0.15 60-64 0.13999999999999999 65-69 0.145 70-74 0.20500000000000002 75-79 0.2 80-84 0.265 85-89 0.13999999999999999 90-94 0.155 95-99 0.125 100-104 0.125 105-109 0.135 110-114 0.125 115-119 0.125 120-124 0.13999999999999999 125-129 0.13 130-134 0.155 135-139 0.16999999999999998 140-144 0.245 145-149 0.29 150-151 0.3 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59809093192665 99.125 2 0.37678975131876413 0.75 3 0.0 0.0 4 0.0 0.0 5 0.025119316754584273 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.42500000000000004 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.6625 0.0 0.0 0.0 0.0 90-91 0.8 0.0 0.0 0.0 0.0 92-93 0.9375 0.0 0.0 0.0 0.0 94-95 1.125 0.0 0.0 0.0 0.0 96-97 1.375 0.0 0.0 0.0 0.0 98-99 1.7125 0.0 0.0 0.0 0.0 100-101 1.9 0.0 0.0 0.0 0.0 102-103 2.2375 0.0 0.0 0.0 0.0 104-105 2.5625 0.0 0.0 0.0 0.0 106-107 3.0 0.0 0.0 0.0 0.0 108-109 3.45 0.0 0.0 0.0 0.0 110-111 3.8375000000000004 0.0 0.0 0.0 0.0 112-113 4.237500000000001 0.0 0.0 0.0 0.0 114-115 4.625 0.0 0.0 0.0 0.0 116-117 5.1625 0.0 0.0 0.0 0.0 118-119 5.6375 0.0 0.0 0.0 0.0 120-121 6.0875 0.0 0.0 0.0 0.0 122-123 6.5 0.0 0.0 0.0 0.0 124-125 7.025 0.0 0.0 0.0 0.0 126-127 7.574999999999999 0.0 0.0 0.0 0.0 128-129 8.325 0.0 0.0 0.0 0.0 130-131 9.175 0.0 0.0 0.0 0.0 132-133 9.8625 0.0 0.0 0.0 0.0 134-135 10.55 0.0 0.0 0.0 0.0 136-137 11.1125 0.0 0.0 0.0 0.0 138-139 11.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 165 5.380233E-4 8.787879 130-134 >>END_MODULE Read 441781 spots for SRR5579251.sra Written 441781 spots for SRR5579251.sra Read 441781 spots for SRR5579251.sra Read 441781 spots for SRR5579251.sra Written 441781 spots for SRR5579251.sra Written 441781 spots for SRR5579251.sra Read 441781 spots for SRR5579251.sra Written 441781 spots for SRR5579251.sra Read 441781 spots for SRR5579251.sra Written 441781 spots for SRR5579251.sra Read 441781 spots for SRR5579251.sra Written 441781 spots for SRR5579251.sra Read 441781 spots for SRR5579251.sra Written 441781 spots for SRR5579251.sra Read 441781 spots for SRR5579251.sra Written 441781 spots for SRR5579251.sra Read 441781 spots for SRR5579251.sra Written 441781 spots for SRR5579251.sra Read 441781 spots for SRR5579251.sra Written 441781 spots for SRR5579251.sra Read 441781 spots for SRR5579251.sra Written 441781 spots for SRR5579251.sra Read 441781 spots for SRR5579251.sra Written 441781 spots for SRR5579251.sra Read 441781 spots for SRR5579251.sra Written 441781 spots for SRR5579251.sra Read 441781 spots for SRR5579251.sra Written 441781 spots for SRR5579251.sra Read 441798 spots for SRR5579251.sra Written 441798 spots for SRR5579251.sra Read 441781 spots for SRR5579251.sra Written 441781 spots for SRR5579251.sra Read 441781 spots for SRR5579251.sra Written 441781 spots for SRR5579251.sra Read 441781 spots for SRR5579251.sra Written 441781 spots for SRR5579251.sra Read 441781 spots for SRR5579251.sra Written 441781 spots for SRR5579251.sra Read 441781 spots for SRR5579251.sra Written 441781 spots for SRR5579251.sra SRR ids: ['SRR5579251.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a5hz6i24 SRR5579251.sra spots: 8835637 blocks: [[1, 441781], [441782, 883562], [883563, 1325343], [1325344, 1767124], [1767125, 2208905], [2208906, 2650686], [2650687, 3092467], [3092468, 3534248], [3534249, 3976029], [3976030, 4417810], [4417811, 4859591], [4859592, 5301372], [5301373, 5743153], [5743154, 6184934], [6184935, 6626715], [6626716, 7068496], [7068497, 7510277], [7510278, 7952058], [7952059, 8393839], [8393840, 8835637]] SRR5579251 file size 2974681 SRR5579251 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579251 SRR5579251_1.fastq SRR5579251_2.fastq Input file: SRR5579251_1.fastq Paired file: SRR5579251_2.fastq trimmed: SRR5579251-trimmed-pair1.fastq, SRR5579251-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 23:34:01 2024 >> started Mon Dec 9 23:34:12 2024 >> done (11.685s) 8835637 read pairs processed; of these: 7518 ( 0.09%) short read pairs filtered out after trimming by size control 41181 ( 0.47%) empty read pairs filtered out after trimming by size control 8786938 (99.45%) read pairs available; of these: 4313201 (49.09%) trimmed read pairs available after processing 4473737 (50.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 13 0.00% 20 12 0.00% 21 19 0.00% 22 20 0.00% 23 18 0.00% 24 15 0.00% 25 20 0.00% 26 16 0.00% 27 26 0.00% 28 19 0.00% 29 20 0.00% 30 28 0.00% 31 22 0.00% 32 17 0.00% 33 19 0.00% 34 30 0.00% 35 33 0.00% 36 22 0.00% 37 30 0.00% 38 27 0.00% 39 38 0.00% 40 30 0.00% 41 47 0.00% 42 45 0.00% 43 44 0.00% 44 48 0.00% 45 45 0.00% 46 79 0.00% 47 70 0.00% 48 94 0.00% 49 104 0.00% 50 118 0.00% 51 135 0.00% 52 128 0.00% 53 143 0.00% 54 166 0.00% 55 165 0.00% 56 211 0.00% 57 207 0.00% 58 251 0.00% 59 313 0.00% 60 357 0.00% 61 437 0.00% 62 464 0.01% 63 525 0.01% 64 567 0.01% 65 605 0.01% 66 780 0.01% 67 760 0.01% 68 948 0.01% 69 1247 0.01% 70 1597 0.02% 71 1597 0.02% 72 1728 0.02% 73 1735 0.02% 74 1991 0.02% 75 2115 0.02% 76 2498 0.03% 77 2588 0.03% 78 2834 0.03% 79 3311 0.04% 80 3904 0.04% 81 4466 0.05% 82 4935 0.06% 83 5243 0.06% 84 6045 0.07% 85 6474 0.07% 86 6684 0.08% 87 7249 0.08% 88 7487 0.09% 89 8180 0.09% 90 8845 0.10% 91 9469 0.11% 92 10432 0.12% 93 10973 0.12% 94 11519 0.13% 95 11966 0.14% 96 12547 0.14% 97 12889 0.15% 98 13197 0.15% 99 14165 0.16% 100 14895 0.17% 101 15543 0.18% 102 16662 0.19% 103 17126 0.19% 104 17538 0.20% 105 18464 0.21% 106 18706 0.21% 107 18684 0.21% 108 19053 0.22% 109 19611 0.22% 110 20127 0.23% 111 21284 0.24% 112 21960 0.25% 113 23089 0.26% 114 23941 0.27% 115 24351 0.28% 116 24663 0.28% 117 24670 0.28% 118 24998 0.28% 119 25301 0.29% 120 25367 0.29% 121 26765 0.30% 122 27744 0.32% 123 29042 0.33% 124 30060 0.34% 125 30720 0.35% 126 31230 0.36% 127 31350 0.36% 128 31861 0.36% 129 31697 0.36% 130 32601 0.37% 131 33713 0.38% 132 35339 0.40% 133 36314 0.41% 134 37843 0.43% 135 40103 0.46% 136 40272 0.46% 137 41115 0.47% 138 42303 0.48% 139 43471 0.49% 140 45010 0.51% 141 47695 0.54% 142 51307 0.58% 143 55020 0.63% 144 60078 0.68% 145 69012 0.79% 146 80631 0.92% 147 103896 1.18% 148 155016 1.76% 149 311533 3.55% 150 2036151 23.17% 151 4473737 50.91% 8786938 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=4.50 fanout-score-rank=24 prefix-density=0.18 prefix-fanout=3.4 sequence=GGCAGCCTCCTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=21 fanout-score=549.35 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=36.4 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=32 prefix-density=0.34 prefix-fanout=2.3 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=23 fanout-score=331.39 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=28.9 sequence=CAAGAAGAAGAT SRR5579251 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 23:35:17 Started mapping on | Dec 09 23:35:17 Finished on | Dec 09 23:40:38 Mapping speed, Million of reads per hour | 98.55 Number of input reads | 8786938 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 7450501 Uniquely mapped reads % | 84.79% Average mapped length | 290.36 Number of splices: Total | 8158313 Number of splices: Annotated (sjdb) | 7750951 Number of splices: GT/AG | 8052908 Number of splices: GC/AG | 93967 Number of splices: AT/AC | 6192 Number of splices: Non-canonical | 5246 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.01% Deletion average length | 1.32 Insertion rate per base | 0.00% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 88638 % of reads mapped to multiple loci | 1.01% Number of reads mapped to too many loci | 2666 % of reads mapped to too many loci | 0.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.99% % of reads unmapped: other | 0.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1253867 1253867 1253867 N_multimapping 88638 88638 88638 N_noFeature 219819 7235207 301716 N_ambiguous 149380 968 16416 UnstrandedReadsAssigned:7081302 PositiveStrandReadsAssigned:214326 NegativeStrandReadsAssigned:7132369 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR5579251 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579251-trimmed-pair1.fastq SRR5579251-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,786,938 reads, 7,219,129 reads pseudoaligned [quant] estimated average fragment length: 250.385 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,088 rounds 52973 SRR5579251.ke.tsv 35125 SRR5579251.se.tsv 88098 total ==> SRR5579251.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 687.295 26.8689 8.20879 PNS24247 1044 794.615 29.034 7.67224 PNS24249 1928 1678.61 48.4612 6.06199 PNS24246 1044 794.615 29.034 7.67224 PNS24248 1044 794.615 29.034 7.67224 PNS24244 1471 1221.61 58.5678 10.0669 PNS24243 293 105.376 0 0 KQK14069 1603 1353.61 2311.57 358.578 KQK14071 474 247.703 47.1456 39.9652 ==> SRR5579251.se.tsv <== BRADI_1g14170v3 2692 BRADI_1g53295v3 23 BRADI_1g59795v3 174 BRADI_1g07683v3 0 BRADI_1g00485v3 29 BRADI_1g20270v3 469 BRADI_1g74790v3 15 BRADI_1g09890v3 0 BRADI_1g77505v3 62 BRADI_1g48960v3 0 SRR5579251 completed mapping pipeline successfully