Starting /dee2/code/volunteer_pipeline.sh SRR5579252 current disk space = 1523309637632 free memory = 1562898656 SRR5579252 SRAfilesize 1f44a6612e6c5ead4c7f927be928eb57 SRR5579252.sra SRR5579252.sra file validated SRR5579252 is paired end SRR5579252 is conventional basespace SRR5579252 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579252_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.4715 34.0 33.0 34.0 2.0 34.0 2 32.647 34.0 33.0 34.0 28.0 34.0 3 32.86075 34.0 33.0 34.0 31.0 34.0 4 33.1365 34.0 33.0 34.0 32.0 34.0 5 33.2285 34.0 33.0 34.0 33.0 34.0 6 37.01325 38.0 37.0 38.0 36.0 38.0 7 37.28625 38.0 38.0 38.0 37.0 38.0 8 37.377 38.0 38.0 38.0 37.0 38.0 9 37.45825 38.0 38.0 38.0 37.0 38.0 10-14 37.4399 38.0 38.0 38.0 37.4 38.0 15-19 37.4037 38.0 38.0 38.0 37.2 38.0 20-24 37.4127 38.0 38.0 38.0 37.2 38.0 25-29 37.38595 38.0 38.0 38.0 37.0 38.0 30-34 37.36185 38.0 38.0 38.0 37.0 38.0 35-39 37.2179 38.0 38.0 38.0 37.0 38.0 40-44 37.09205 38.0 38.0 38.0 36.0 38.0 45-49 37.04995 38.0 38.0 38.0 36.0 38.0 50-54 36.92855 38.0 38.0 38.0 35.6 38.0 55-59 36.919650000000004 38.0 38.0 38.0 35.4 38.0 60-64 36.9547 38.0 38.0 38.0 35.8 38.0 65-69 36.7613 38.0 38.0 38.0 35.0 38.0 70-74 36.7582 38.0 38.0 38.0 35.0 38.0 75-79 36.746300000000005 38.0 38.0 38.0 35.0 38.0 80-84 36.59505 38.0 38.0 38.0 34.4 38.0 85-89 36.446 38.0 38.0 38.0 34.0 38.0 90-94 36.401399999999995 38.0 38.0 38.0 34.0 38.0 95-99 36.31565 38.0 38.0 38.0 34.0 38.0 100-104 36.17295 38.0 38.0 38.0 33.6 38.0 105-109 35.97275 38.0 37.0 38.0 33.0 38.0 110-114 35.8977 38.0 37.2 38.0 32.4 38.0 115-119 35.64775 38.0 36.8 38.0 31.0 38.0 120-124 35.46595 38.0 36.0 38.0 31.0 38.0 125-129 35.2768 38.0 36.0 38.0 29.6 38.0 130-134 35.057700000000004 38.0 35.6 38.0 29.0 38.0 135-139 34.75915 38.0 35.2 38.0 27.4 38.0 140-144 34.596349999999994 38.0 35.0 38.0 27.4 38.0 145-149 33.70825 38.0 35.0 38.0 21.2 38.0 150-151 30.310000000000002 36.5 29.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 0.0 12 2.0 13 3.0 14 1.0 15 1.0 16 3.0 17 3.0 18 5.0 19 8.0 20 5.0 21 5.0 22 14.0 23 14.0 24 16.0 25 18.0 26 18.0 27 22.0 28 24.0 29 31.0 30 43.0 31 69.0 32 77.0 33 108.0 34 121.0 35 251.0 36 647.0 37 2488.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.59652124322783 13.77245508982036 10.094097519247219 31.53692614770459 2 24.0 18.975 32.775 24.25 3 22.225 25.575 23.9 28.299999999999997 4 27.725 31.7 18.575 22.0 5 25.45 31.624999999999996 22.3 20.625 6 21.775 33.425 22.125 22.675 7 18.325 19.325 40.025 22.325 8 20.424999999999997 20.724999999999998 26.55 32.300000000000004 9 20.7 20.275000000000002 29.375 29.65 10-14 23.169999999999998 25.619999999999997 24.815 26.395000000000003 15-19 23.1 24.64 25.775 26.484999999999996 20-24 23.400000000000002 25.53 25.380000000000003 25.69 25-29 23.49 25.869999999999997 25.330000000000002 25.31 30-34 23.7 24.985 25.779999999999998 25.535000000000004 35-39 23.9 25.85 24.740000000000002 25.509999999999998 40-44 24.04 24.990000000000002 25.15 25.82 45-49 23.74 25.245 25.145 25.869999999999997 50-54 23.34 25.485000000000003 25.185000000000002 25.990000000000002 55-59 23.849999999999998 25.0 25.09 26.06 60-64 23.835 25.28 24.75 26.135 65-69 24.315 25.055 25.230000000000004 25.4 70-74 23.755000000000003 25.16 24.82 26.265 75-79 24.125 24.625 25.19 26.06 80-84 23.77 24.93 24.905 26.395000000000003 85-89 24.735 24.535 25.22 25.509999999999998 90-94 24.355 25.085 24.67 25.89 95-99 23.78 24.9 24.905 26.415 100-104 24.75 24.404999999999998 24.855 25.990000000000002 105-109 24.67 25.165 24.09 26.075 110-114 24.52 25.130000000000003 24.72 25.629999999999995 115-119 24.975 24.81 23.97 26.245 120-124 24.6 25.369999999999997 24.355 25.674999999999997 125-129 24.32 25.074999999999996 24.785 25.82 130-134 24.775 25.21 24.325 25.69 135-139 24.025 25.419999999999998 23.645 26.91 140-144 24.215 25.474999999999998 24.095 26.215 145-149 24.455 24.745 24.565 26.235000000000003 150-151 24.975 24.7875 24.375 25.8625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 3.5 28 4.0 29 4.0 30 5.0 31 7.0 32 12.5 33 24.0 34 29.0 35 37.0 36 49.0 37 62.5 38 90.5 39 101.5 40 114.0 41 150.5 42 167.5 43 175.5 44 188.5 45 187.0 46 188.5 47 187.5 48 173.5 49 159.5 50 154.0 51 134.0 52 131.5 53 133.5 54 114.5 55 105.5 56 88.0 57 83.5 58 81.0 59 89.0 60 99.5 61 85.0 62 74.0 63 69.5 64 63.5 65 60.0 66 57.5 67 50.5 68 38.0 69 27.0 70 28.5 71 25.0 72 20.5 73 20.5 74 15.0 75 10.0 76 7.0 77 4.0 78 3.5 79 3.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 12.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44695827048768 98.9 2 0.5530417295123178 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.6625 0.0 0.0 0.0 0.0 94-95 0.7875 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.0750000000000002 0.0 0.0 0.0 0.0 100-101 1.225 0.0 0.0 0.0 0.0 102-103 1.5875 0.0 0.0 0.0 0.0 104-105 1.825 0.0 0.0 0.0 0.0 106-107 2.1500000000000004 0.0 0.0 0.0 0.0 108-109 2.55 0.0 0.0 0.0 0.0 110-111 2.8499999999999996 0.0 0.0 0.0 0.0 112-113 3.25 0.0 0.0 0.0 0.0 114-115 3.6375 0.0 0.0 0.0 0.0 116-117 4.050000000000001 0.0 0.0 0.0 0.0 118-119 4.4375 0.0 0.0 0.0 0.0 120-121 4.85 0.0 0.0 0.0 0.0 122-123 5.45 0.0 0.0 0.0 0.0 124-125 5.95 0.0 0.0 0.0 0.0 126-127 6.199999999999999 0.0 0.0 0.0 0.0 128-129 6.737500000000001 0.0 0.0 0.0 0.0 130-131 7.3125 0.0 0.0 0.0 0.0 132-133 7.8125 0.0 0.0 0.0 0.0 134-135 8.35 0.0 0.0 0.0 0.0 136-137 8.8375 0.0 0.0 0.0 0.0 138-139 9.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5579252 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579252_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.80725 33.0 33.0 34.0 32.0 34.0 2 32.84075 34.0 33.0 34.0 32.0 34.0 3 32.823 34.0 33.0 34.0 32.0 34.0 4 32.736 34.0 33.0 34.0 32.0 34.0 5 32.77275 34.0 33.0 34.0 32.0 34.0 6 36.8375 38.0 38.0 38.0 36.0 38.0 7 36.956 38.0 38.0 38.0 37.0 38.0 8 36.8855 38.0 38.0 38.0 36.0 38.0 9 36.93275 38.0 38.0 38.0 36.0 38.0 10-14 36.881899999999995 38.0 38.0 38.0 36.4 38.0 15-19 36.87 38.0 38.0 38.0 36.4 38.0 20-24 36.788900000000005 38.0 38.0 38.0 36.0 38.0 25-29 36.777849999999994 38.0 38.0 38.0 36.2 38.0 30-34 36.84009999999999 38.0 38.0 38.0 36.0 38.0 35-39 36.8089 38.0 38.0 38.0 36.2 38.0 40-44 36.744 38.0 38.0 38.0 36.0 38.0 45-49 36.73345 38.0 38.0 38.0 36.0 38.0 50-54 36.73555 38.0 38.0 38.0 36.0 38.0 55-59 36.7137 38.0 38.0 38.0 36.0 38.0 60-64 36.64175 38.0 38.0 38.0 35.8 38.0 65-69 36.53375 38.0 38.0 38.0 35.0 38.0 70-74 36.41395 38.0 38.0 38.0 35.0 38.0 75-79 36.4615 38.0 38.0 38.0 35.0 38.0 80-84 36.412349999999996 38.0 38.0 38.0 35.0 38.0 85-89 36.337900000000005 38.0 38.0 38.0 34.6 38.0 90-94 36.2616 38.0 38.0 38.0 34.0 38.0 95-99 36.1346 38.0 38.0 38.0 34.0 38.0 100-104 36.0699 38.0 38.0 38.0 34.0 38.0 105-109 35.907 38.0 38.0 38.0 33.4 38.0 110-114 35.7021 38.0 38.0 38.0 32.8 38.0 115-119 35.7011 38.0 38.0 38.0 33.0 38.0 120-124 35.43595 38.0 37.8 38.0 31.4 38.0 125-129 35.15745 38.0 37.0 38.0 30.2 38.0 130-134 34.93755 38.0 36.0 38.0 29.4 38.0 135-139 34.56529999999999 38.0 36.0 38.0 26.6 38.0 140-144 34.31705 38.0 35.8 38.0 24.8 38.0 145-149 33.5363 38.0 34.8 38.0 18.6 38.0 150-151 29.441875 35.5 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 8.0 4 4.0 5 3.0 6 2.0 7 2.0 8 5.0 9 4.0 10 1.0 11 4.0 12 5.0 13 0.0 14 4.0 15 6.0 16 8.0 17 8.0 18 6.0 19 7.0 20 10.0 21 8.0 22 8.0 23 13.0 24 14.0 25 11.0 26 21.0 27 30.0 28 22.0 29 35.0 30 41.0 31 49.0 32 67.0 33 76.0 34 119.0 35 224.0 36 409.0 37 2753.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.025000000000006 16.35 11.875 28.749999999999996 2 27.075 21.0 29.775000000000002 22.15 3 24.55 24.9 25.95 24.6 4 27.725 29.65 18.8 23.825 5 26.474999999999998 33.25 18.9 21.375 6 22.6 33.875 19.3 24.224999999999998 7 20.75 16.05 37.55 25.650000000000002 8 23.175 21.349999999999998 23.575 31.900000000000002 9 24.85 20.724999999999998 24.45 29.975 10-14 26.165 25.0 22.935 25.900000000000002 15-19 25.61 24.305 23.89 26.195 20-24 26.484999999999996 24.685000000000002 23.52 25.31 25-29 25.740000000000002 25.06 23.825 25.374999999999996 30-34 26.095000000000002 24.740000000000002 23.68 25.485000000000003 35-39 25.95 24.81 23.810000000000002 25.430000000000003 40-44 25.974999999999998 24.525 23.635 25.865 45-49 26.43 23.82 23.875 25.874999999999996 50-54 26.015 25.115 23.71 25.16 55-59 26.215 24.625 23.955000000000002 25.205 60-64 25.759999999999998 24.455 24.32 25.465 65-69 26.015 24.805 24.285 24.895 70-74 26.695 24.560000000000002 23.935000000000002 24.81 75-79 26.055 24.765 24.715 24.465 80-84 25.624999999999996 24.87 24.169999999999998 25.335 85-89 26.47 24.83 23.974999999999998 24.725 90-94 25.745 25.624999999999996 24.240000000000002 24.39 95-99 27.169999999999998 24.845 23.849999999999998 24.135 100-104 26.135 25.41 24.355 24.099999999999998 105-109 26.540000000000003 24.675 24.375 24.41 110-114 26.685 25.224999999999998 23.87 24.22 115-119 25.96 25.385 24.095 24.560000000000002 120-124 26.919999999999998 25.44 23.91 23.73 125-129 26.77 24.93 24.48 23.82 130-134 27.384999999999998 24.825 23.77 24.02 135-139 27.485 25.290000000000003 24.335 22.89 140-144 27.634999999999998 25.230000000000004 24.240000000000002 22.895 145-149 27.925 25.515 23.974999999999998 22.585 150-151 27.675 25.474999999999998 24.0625 22.787499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.5 24 1.0 25 1.5 26 1.0 27 1.5 28 3.0 29 2.5 30 4.0 31 6.5 32 7.0 33 8.0 34 13.5 35 25.0 36 33.5 37 49.5 38 65.5 39 78.5 40 93.5 41 127.5 42 147.5 43 154.5 44 173.0 45 183.0 46 188.5 47 177.0 48 168.0 49 154.0 50 151.5 51 139.0 52 121.5 53 122.0 54 120.5 55 115.5 56 97.5 57 93.0 58 91.0 59 97.5 60 104.5 61 91.0 62 93.5 63 93.5 64 77.0 65 71.0 66 73.5 67 67.5 68 55.5 69 47.5 70 50.0 71 43.0 72 30.5 73 26.0 74 17.0 75 12.5 76 10.0 77 6.0 78 4.0 79 3.0 80 1.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14184755174155 98.2 2 0.7571933366986371 1.5 3 0.10095911155981827 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.44999999999999996 0.0 0.0 0.0 0.0 90-91 0.6 0.0 0.0 0.0 0.0 92-93 0.7 0.0 0.0 0.0 0.0 94-95 0.825 0.0 0.0 0.0 0.0 96-97 0.975 0.0 0.0 0.0 0.0 98-99 1.1125 0.0 0.0 0.0 0.0 100-101 1.2625000000000002 0.0 0.0 0.0 0.0 102-103 1.6375 0.0 0.0 0.0 0.0 104-105 1.875 0.0 0.0 0.0 0.0 106-107 2.2 0.0 0.0 0.0 0.0 108-109 2.625 0.0 0.0 0.0 0.0 110-111 2.925 0.0 0.0 0.0 0.0 112-113 3.35 0.0 0.0 0.0 0.0 114-115 3.725 0.0 0.0 0.0 0.0 116-117 4.0625 0.0 0.0 0.0 0.0 118-119 4.45 0.0 0.0 0.0 0.0 120-121 4.875 0.0 0.0 0.0 0.0 122-123 5.5 0.0 0.0 0.0 0.0 124-125 6.050000000000001 0.0 0.0 0.0 0.0 126-127 6.3375 0.0 0.0 0.0 0.0 128-129 6.875 0.0 0.0 0.0 0.0 130-131 7.4625 0.0 0.0 0.0 0.0 132-133 7.9375 0.0 0.0 0.0 0.0 134-135 8.525 0.0 0.0 0.0 0.0 136-137 9.0375 0.0 0.0 0.0 0.0 138-139 9.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTTGTC 10 0.006830828 145.0 7 >>END_MODULE Read 1170737 spots for SRR5579252.sra Written 1170737 spots for SRR5579252.sra Read 1170737 spots for SRR5579252.sra Written 1170737 spots for SRR5579252.sra Read 1170737 spots for SRR5579252.sra Written 1170737 spots for SRR5579252.sra Read 1170737 spots for SRR5579252.sra Written 1170737 spots for SRR5579252.sra Read 1170737 spots for SRR5579252.sra Written 1170737 spots for SRR5579252.sra Read 1170737 spots for SRR5579252.sra Written 1170737 spots for SRR5579252.sra Read 1170737 spots for SRR5579252.sra Written 1170737 spots for SRR5579252.sra Read 1170737 spots for SRR5579252.sra Written 1170737 spots for SRR5579252.sra Read 1170737 spots for SRR5579252.sra Written 1170737 spots for SRR5579252.sra Read 1170737 spots for SRR5579252.sra Written 1170737 spots for SRR5579252.sra Read 1170737 spots for SRR5579252.sra Written 1170737 spots for SRR5579252.sra Read 1170756 spots for SRR5579252.sra Written 1170756 spots for SRR5579252.sra Read 1170737 spots for SRR5579252.sra Written 1170737 spots for SRR5579252.sra Read 1170737 spots for SRR5579252.sra Written 1170737 spots for SRR5579252.sra Read 1170737 spots for SRR5579252.sra Written 1170737 spots for SRR5579252.sra Read 1170737 spots for SRR5579252.sra Written 1170737 spots for SRR5579252.sra Read 1170737 spots for SRR5579252.sra Written 1170737 spots for SRR5579252.sra Read 1170737 spots for SRR5579252.sra Written 1170737 spots for SRR5579252.sra Read 1170737 spots for SRR5579252.sra Written 1170737 spots for SRR5579252.sra Read 1170737 spots for SRR5579252.sra Written 1170737 spots for SRR5579252.sra SRR ids: ['SRR5579252.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_amh9rj85 SRR5579252.sra spots: 23414759 blocks: [[1, 1170737], [1170738, 2341474], [2341475, 3512211], [3512212, 4682948], [4682949, 5853685], [5853686, 7024422], [7024423, 8195159], [8195160, 9365896], [9365897, 10536633], [10536634, 11707370], [11707371, 12878107], [12878108, 14048844], [14048845, 15219581], [15219582, 16390318], [16390319, 17561055], [17561056, 18731792], [18731793, 19902529], [19902530, 21073266], [21073267, 22244003], [22244004, 23414759]] SRR5579252 file size 7912793 SRR5579252 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579252 SRR5579252_1.fastq SRR5579252_2.fastq Input file: SRR5579252_1.fastq Paired file: SRR5579252_2.fastq trimmed: SRR5579252-trimmed-pair1.fastq, SRR5579252-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 23:35:58 2024 >> started Mon Dec 9 23:36:30 2024 >> done (32.367s) 23414759 read pairs processed; of these: 56273 ( 0.24%) short read pairs filtered out after trimming by size control 59820 ( 0.26%) empty read pairs filtered out after trimming by size control 23298666 (99.50%) read pairs available; of these: 10207512 (43.81%) trimmed read pairs available after processing 13091154 (56.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 20 0.00% 20 14 0.00% 21 13 0.00% 22 14 0.00% 23 14 0.00% 24 19 0.00% 25 12 0.00% 26 13 0.00% 27 22 0.00% 28 24 0.00% 29 27 0.00% 30 33 0.00% 31 24 0.00% 32 20 0.00% 33 22 0.00% 34 19 0.00% 35 39 0.00% 36 42 0.00% 37 39 0.00% 38 44 0.00% 39 48 0.00% 40 56 0.00% 41 55 0.00% 42 74 0.00% 43 84 0.00% 44 78 0.00% 45 92 0.00% 46 94 0.00% 47 140 0.00% 48 148 0.00% 49 187 0.00% 50 170 0.00% 51 243 0.00% 52 245 0.00% 53 262 0.00% 54 288 0.00% 55 328 0.00% 56 352 0.00% 57 448 0.00% 58 499 0.00% 59 591 0.00% 60 637 0.00% 61 729 0.00% 62 834 0.00% 63 964 0.00% 64 1065 0.00% 65 1167 0.01% 66 1366 0.01% 67 1438 0.01% 68 1776 0.01% 69 2157 0.01% 70 2634 0.01% 71 2658 0.01% 72 2937 0.01% 73 3162 0.01% 74 3645 0.02% 75 3932 0.02% 76 4382 0.02% 77 4933 0.02% 78 5454 0.02% 79 6208 0.03% 80 6821 0.03% 81 8002 0.03% 82 9025 0.04% 83 10161 0.04% 84 13259 0.06% 85 14980 0.06% 86 15470 0.07% 87 16354 0.07% 88 17223 0.07% 89 17986 0.08% 90 19527 0.08% 91 20994 0.09% 92 22778 0.10% 93 24334 0.10% 94 25883 0.11% 95 26679 0.11% 96 27760 0.12% 97 29450 0.13% 98 30159 0.13% 99 32739 0.14% 100 33827 0.15% 101 36314 0.16% 102 38651 0.17% 103 39990 0.17% 104 41878 0.18% 105 43412 0.19% 106 45080 0.19% 107 45819 0.20% 108 46989 0.20% 109 48986 0.21% 110 50389 0.22% 111 53475 0.23% 112 55730 0.24% 113 57542 0.25% 114 60393 0.26% 115 62529 0.27% 116 63341 0.27% 117 64705 0.28% 118 64762 0.28% 119 67527 0.29% 120 69316 0.30% 121 71348 0.31% 122 73893 0.32% 123 77551 0.33% 124 80902 0.35% 125 82139 0.35% 126 83932 0.36% 127 85324 0.37% 128 86307 0.37% 129 88563 0.38% 130 89644 0.38% 131 91901 0.39% 132 97622 0.42% 133 100704 0.43% 134 104600 0.45% 135 108612 0.47% 136 111234 0.48% 137 114642 0.49% 138 119251 0.51% 139 122628 0.53% 140 127606 0.55% 141 135259 0.58% 142 144108 0.62% 143 156043 0.67% 144 173400 0.74% 145 195306 0.84% 146 228970 0.98% 147 288937 1.24% 148 411595 1.77% 149 756452 3.25% 150 4261755 18.29% 151 13091154 56.19% 23298666 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=25 prefix-density=0.73 prefix-fanout=2.1 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCCATCATAGTACCCAGGGGAGCTGTTGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=22.50 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=3.7 sequence=GCTTTGATATTCTCTGCATCCTATTTAGGGCTATTGATATTTAACAAATATCCAGCAAAGGTTTTTCCAGGAGATGTTGGAACTCTACCAATTGGAGCTTTCTTAGCTGTCTTAGCAGTAGTTTATAAGGAATATATCCCATTTTTAGTTATAATGATGCCTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGTAGGGATGAGCATAAACCAACAACTCTCAAAGAAGATGGGAAGCTATACTATATAGGTGGCTATCTATCCCTACCAAGGCTTATATTGAAGTATAAACCAATGAGAGAGCCTCACTTAGTTACAGTTTTATGGATAATTGGGATATTCTTTGGTATAGTTGGGATTTTAATATCATTAATAGCATGATGGTGATTGTTTTGAAAACCATAGGAGGAAACCTCCTATTGGGATACCTCCCGTCCATTAAGTTAGGGCTTTCAGCCC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=27 prefix-density=0.36 prefix-fanout=2.1 sequence=CAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCCGATCGAGGGCATCAAGAAGTTCGAGACCCTCTCGTACCTGCCCCCTCTCTCCGTGGAGTCTCTCCTGAAGCAGATCGAGTACCTGATCCGCTCCAAGTGGGTTCCTTGCCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=82.45 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.1 sequence=CAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR5579252 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 23:37:42 Started mapping on | Dec 09 23:37:43 Finished on | Dec 09 23:42:26 Mapping speed, Million of reads per hour | 296.38 Number of input reads | 23298666 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 21843763 Uniquely mapped reads % | 93.76% Average mapped length | 291.07 Number of splices: Total | 23043340 Number of splices: Annotated (sjdb) | 21807166 Number of splices: GT/AG | 22747254 Number of splices: GC/AG | 269660 Number of splices: AT/AC | 11012 Number of splices: Non-canonical | 15414 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.01% Deletion average length | 1.29 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 196379 % of reads mapped to multiple loci | 0.84% Number of reads mapped to too many loci | 6387 % of reads mapped to too many loci | 0.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.22% % of reads unmapped: other | 0.16% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1290854 1290854 1290854 N_multimapping 196379 196379 196379 N_noFeature 640249 21182501 872951 N_ambiguous 502225 3015 74375 UnstrandedReadsAssigned:20701289 PositiveStrandReadsAssigned:658247 NegativeStrandReadsAssigned:20896437 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR5579252 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579252-trimmed-pair1.fastq SRR5579252-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,298,666 reads, 21,003,421 reads pseudoaligned [quant] estimated average fragment length: 252.675 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,132 rounds 52973 SRR5579252.ke.tsv 35125 SRR5579252.se.tsv 88098 total ==> SRR5579252.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 684.897 0 0 PNS24247 1044 792.325 48.4576 4.13626 PNS24249 1928 1676.33 71.0328 2.86583 PNS24246 1044 792.325 48.4576 4.13626 PNS24248 1044 792.325 48.4576 4.13626 PNS24244 1471 1219.33 124.594 6.9108 PNS24243 293 102.684 0 0 KQK14069 1603 1351.33 7551.64 377.947 KQK14071 474 243.665 168.629 46.8046 ==> SRR5579252.se.tsv <== BRADI_1g14170v3 8485 BRADI_1g53295v3 84 BRADI_1g59795v3 667 BRADI_1g07683v3 0 BRADI_1g00485v3 53 BRADI_1g20270v3 3015 BRADI_1g74790v3 95 BRADI_1g09890v3 1 BRADI_1g77505v3 267 BRADI_1g48960v3 0 SRR5579252 completed mapping pipeline successfully