Starting /dee2/code/volunteer_pipeline.sh SRR5579253 current disk space = 1523309637632 free memory = 1562898880 SRR5579253 SRAfilesize 6ab4bb16b28aa8e83478f50536b32f87 SRR5579253.sra SRR5579253.sra file validated SRR5579253 is paired end SRR5579253 is conventional basespace SRR5579253 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579253_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.2115 34.0 33.0 34.0 2.0 34.0 2 32.525 34.0 33.0 34.0 28.0 34.0 3 32.78475 34.0 33.0 34.0 28.0 34.0 4 33.094 34.0 33.0 34.0 32.0 34.0 5 33.13675 34.0 33.0 34.0 32.0 34.0 6 36.92275 38.0 37.0 38.0 35.0 38.0 7 37.23225 38.0 38.0 38.0 36.0 38.0 8 37.35775 38.0 38.0 38.0 37.0 38.0 9 37.44675 38.0 38.0 38.0 37.0 38.0 10-14 37.41495 38.0 38.0 38.0 37.0 38.0 15-19 37.37915 38.0 38.0 38.0 37.0 38.0 20-24 37.38315000000001 38.0 38.0 38.0 37.0 38.0 25-29 37.35335 38.0 38.0 38.0 37.0 38.0 30-34 37.298 38.0 38.0 38.0 37.0 38.0 35-39 37.2245 38.0 38.0 38.0 36.8 38.0 40-44 37.0787 38.0 38.0 38.0 36.2 38.0 45-49 37.01754999999999 38.0 38.0 38.0 36.0 38.0 50-54 37.0415 38.0 38.0 38.0 36.0 38.0 55-59 36.925349999999995 38.0 38.0 38.0 35.4 38.0 60-64 36.81955 38.0 38.0 38.0 35.0 38.0 65-69 36.88225 38.0 38.0 38.0 35.0 38.0 70-74 36.79765 38.0 38.0 38.0 35.0 38.0 75-79 36.74985 38.0 38.0 38.0 35.0 38.0 80-84 36.68435 38.0 38.0 38.0 34.8 38.0 85-89 36.55545 38.0 38.0 38.0 34.2 38.0 90-94 36.504599999999996 38.0 38.0 38.0 34.0 38.0 95-99 36.4562 38.0 38.0 38.0 34.0 38.0 100-104 36.220150000000004 38.0 37.6 38.0 33.4 38.0 105-109 36.1657 38.0 37.4 38.0 33.4 38.0 110-114 35.937149999999995 38.0 37.0 38.0 32.4 38.0 115-119 35.900400000000005 38.0 36.8 38.0 32.4 38.0 120-124 35.6528 38.0 36.0 38.0 31.0 38.0 125-129 35.472699999999996 38.0 36.0 38.0 31.0 38.0 130-134 35.3489 38.0 36.0 38.0 30.2 38.0 135-139 35.073249999999994 38.0 35.2 38.0 29.2 38.0 140-144 34.78355 38.0 35.0 38.0 27.6 38.0 145-149 34.3447 38.0 35.0 38.0 27.0 38.0 150-151 30.968874999999997 36.5 31.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 4.0 13 1.0 14 1.0 15 1.0 16 0.0 17 1.0 18 2.0 19 4.0 20 3.0 21 8.0 22 5.0 23 4.0 24 10.0 25 14.0 26 14.0 27 31.0 28 33.0 29 33.0 30 41.0 31 56.0 32 83.0 33 101.0 34 152.0 35 276.0 36 647.0 37 2471.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.34957020057307 13.123209169054443 9.828080229226362 34.69914040114613 2 23.1 19.225 34.699999999999996 22.975 3 22.175 24.65 23.9 29.275000000000002 4 29.675 30.275000000000002 18.725 21.325 5 25.45 34.849999999999994 20.125 19.575 6 20.974999999999998 33.625 23.125 22.275 7 17.75 19.6 39.65 23.0 8 19.85 20.349999999999998 27.85 31.95 9 20.75 19.125 30.349999999999998 29.775000000000002 10-14 23.080000000000002 26.729999999999997 23.915 26.275 15-19 24.099999999999998 24.75 24.825 26.325 20-24 23.375 25.7 24.68 26.245 25-29 23.645 25.385 24.715 26.255 30-34 24.09 25.14 24.245 26.525 35-39 24.84 25.05 24.485 25.624999999999996 40-44 24.529999999999998 25.305 24.45 25.715 45-49 24.485 24.709999999999997 24.435000000000002 26.369999999999997 50-54 23.695 24.995 24.43 26.88 55-59 24.11 24.785 24.595 26.51 60-64 24.490000000000002 24.94 24.125 26.445 65-69 24.279999999999998 25.21 24.355 26.155 70-74 24.560000000000002 24.97 23.98 26.490000000000002 75-79 25.095 24.654999999999998 23.895 26.355 80-84 25.095 24.310000000000002 24.335 26.26 85-89 24.555 24.68 24.05 26.715 90-94 24.695 24.895 24.2 26.21 95-99 24.834999999999997 24.695 24.154999999999998 26.314999999999998 100-104 24.975 24.865000000000002 23.810000000000002 26.35 105-109 25.28 24.779999999999998 23.715 26.224999999999998 110-114 25.615 24.64 23.46 26.284999999999997 115-119 25.44 24.44 23.54 26.58 120-124 24.77 24.535 24.07 26.625 125-129 25.779999999999998 24.295 23.895 26.029999999999998 130-134 25.900000000000002 24.605 23.485 26.009999999999998 135-139 25.855 24.725 23.34 26.08 140-144 25.974999999999998 25.174999999999997 22.825 26.025 145-149 25.365 24.88 23.335 26.419999999999998 150-151 26.200000000000003 25.15 23.225 25.424999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 1.5 24 0.0 25 0.5 26 1.0 27 1.0 28 0.5 29 1.0 30 6.5 31 8.5 32 8.5 33 20.0 34 31.5 35 40.0 36 52.0 37 61.0 38 80.5 39 97.0 40 108.5 41 135.0 42 147.5 43 162.0 44 167.0 45 164.5 46 173.5 47 172.5 48 159.5 49 154.0 50 162.0 51 142.5 52 127.0 53 128.0 54 118.0 55 112.5 56 105.0 57 93.0 58 98.5 59 106.5 60 100.0 61 85.0 62 73.5 63 74.0 64 69.5 65 62.0 66 62.0 67 63.0 68 57.5 69 42.0 70 35.5 71 33.5 72 25.5 73 22.0 74 19.0 75 12.0 76 6.0 77 3.0 78 1.5 79 1.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 12.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01340753857829 97.85000000000001 2 0.8095117632178092 1.6 3 0.15178345560333922 0.44999999999999996 4 0.025297242600556536 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.45 0.0 0.0 0.0 0.0 86-87 0.5125 0.0 0.0 0.0 0.0 88-89 0.5875 0.0 0.0 0.0 0.0 90-91 0.6625000000000001 0.0 0.0 0.0 0.0 92-93 0.8 0.0 0.0 0.0 0.0 94-95 1.0125 0.0 0.0 0.0 0.0 96-97 1.25 0.0 0.0 0.0 0.0 98-99 1.4625 0.0 0.0 0.0 0.0 100-101 1.6625 0.0 0.0 0.0 0.0 102-103 1.975 0.0 0.0 0.0 0.0 104-105 2.2750000000000004 0.0 0.0 0.0 0.0 106-107 2.6625 0.0 0.0 0.0 0.0 108-109 2.9625 0.0 0.0 0.0 0.0 110-111 3.3 0.0 0.0 0.0 0.0 112-113 3.65 0.0 0.0 0.0 0.0 114-115 4.1625 0.0 0.0 0.0 0.0 116-117 4.637499999999999 0.0 0.0 0.0 0.0 118-119 5.1125 0.0 0.0 0.0 0.0 120-121 5.5625 0.0 0.0 0.0 0.0 122-123 5.9125 0.0 0.0 0.0 0.0 124-125 6.5 0.0 0.0 0.0 0.0 126-127 7.15 0.0 0.0 0.0 0.0 128-129 7.75 0.0 0.0 0.0 0.0 130-131 8.2875 0.0 0.0 0.0 0.0 132-133 9.125 0.0 0.0 0.0 0.0 134-135 9.875 0.0 0.0 0.0 0.0 136-137 10.6625 0.0 0.0 0.0 0.0 138-139 11.350000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5579253 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579253_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.70375 33.0 33.0 34.0 32.0 34.0 2 32.81125 33.0 33.0 34.0 32.0 34.0 3 32.8155 34.0 33.0 34.0 32.0 34.0 4 32.74275 34.0 33.0 34.0 32.0 34.0 5 32.8355 34.0 33.0 34.0 32.0 34.0 6 36.90775 38.0 38.0 38.0 36.0 38.0 7 37.02725 38.0 38.0 38.0 36.0 38.0 8 36.9705 38.0 38.0 38.0 36.0 38.0 9 36.91825 38.0 38.0 38.0 36.0 38.0 10-14 36.913500000000006 38.0 38.0 38.0 36.2 38.0 15-19 36.787150000000004 38.0 38.0 38.0 35.8 38.0 20-24 36.7485 38.0 38.0 38.0 35.8 38.0 25-29 36.7857 38.0 38.0 38.0 36.0 38.0 30-34 36.71900000000001 38.0 38.0 38.0 35.6 38.0 35-39 36.767100000000006 38.0 38.0 38.0 36.0 38.0 40-44 36.76365 38.0 38.0 38.0 36.0 38.0 45-49 36.722699999999996 38.0 38.0 38.0 35.6 38.0 50-54 36.64105 38.0 38.0 38.0 35.4 38.0 55-59 36.6312 38.0 38.0 38.0 35.2 38.0 60-64 36.5969 38.0 38.0 38.0 35.0 38.0 65-69 36.525999999999996 38.0 38.0 38.0 35.0 38.0 70-74 36.4358 38.0 38.0 38.0 34.2 38.0 75-79 36.39685 38.0 38.0 38.0 34.0 38.0 80-84 36.4716 38.0 38.0 38.0 34.8 38.0 85-89 36.20645 38.0 38.0 38.0 33.8 38.0 90-94 35.6456 38.0 37.4 38.0 30.2 38.0 95-99 35.9129 38.0 38.0 38.0 33.0 38.0 100-104 35.65435 38.0 37.6 38.0 31.6 38.0 105-109 35.66775 38.0 37.6 38.0 31.6 38.0 110-114 35.62675 38.0 37.8 38.0 31.2 38.0 115-119 35.5202 38.0 37.2 38.0 31.4 38.0 120-124 35.26915 38.0 36.4 38.0 29.6 38.0 125-129 34.961549999999995 38.0 36.0 38.0 28.4 38.0 130-134 34.76219999999999 38.0 35.8 38.0 27.6 38.0 135-139 34.41885 38.0 35.4 38.0 25.0 38.0 140-144 33.9496 38.0 35.0 38.0 22.6 38.0 145-149 33.14215 38.0 33.6 38.0 15.6 38.0 150-151 28.582375 35.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 10.0 4 1.0 5 3.0 6 1.0 7 1.0 8 4.0 9 3.0 10 1.0 11 2.0 12 2.0 13 3.0 14 6.0 15 3.0 16 6.0 17 7.0 18 6.0 19 3.0 20 2.0 21 7.0 22 14.0 23 11.0 24 8.0 25 28.0 26 27.0 27 43.0 28 30.0 29 35.0 30 55.0 31 86.0 32 76.0 33 104.0 34 160.0 35 243.0 36 495.0 37 2508.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.0 14.274999999999999 10.25 30.475 2 26.8 21.45 29.5 22.25 3 25.025 23.849999999999998 24.65 26.474999999999998 4 29.349999999999998 30.875000000000004 16.35 23.425 5 26.650000000000002 33.900000000000006 18.75 20.7 6 23.95 32.475 18.95 24.625 7 21.6 14.774999999999999 35.949999999999996 27.675 8 24.275 19.825 22.6 33.300000000000004 9 26.075 19.175 24.9 29.849999999999998 10-14 26.165 24.435000000000002 22.439999999999998 26.96 15-19 26.325 24.044999999999998 23.44 26.19 20-24 26.179999999999996 24.310000000000002 23.44 26.07 25-29 26.355 24.255 23.275000000000002 26.115 30-34 26.284999999999997 24.625 23.07 26.02 35-39 26.419999999999998 24.310000000000002 23.1 26.169999999999998 40-44 26.875 24.195 22.830000000000002 26.1 45-49 26.665 23.875 23.599999999999998 25.86 50-54 26.150000000000002 24.05 23.73 26.07 55-59 27.05 23.695 23.56 25.695 60-64 26.6 23.775 23.61 26.015 65-69 26.21 24.099999999999998 23.674999999999997 26.015 70-74 26.705000000000002 23.02 23.915 26.36 75-79 25.91 24.245 23.65 26.195 80-84 26.275 24.224999999999998 22.99 26.51 85-89 26.27 24.175 24.065 25.490000000000002 90-94 26.474999999999998 24.295 24.044999999999998 25.185000000000002 95-99 26.279999999999998 24.12 24.19 25.41 100-104 26.85 24.47 23.635 25.045 105-109 27.355 24.135 23.765 24.745 110-114 26.57 24.425 23.765 25.240000000000002 115-119 27.735 24.48 23.294999999999998 24.490000000000002 120-124 27.400000000000002 24.335 23.549999999999997 24.715 125-129 27.685 24.985 23.7 23.630000000000003 130-134 27.91 24.925 23.615 23.549999999999997 135-139 27.04 25.25 23.955000000000002 23.755000000000003 140-144 28.449999999999996 25.624999999999996 23.14 22.785 145-149 28.470000000000002 24.834999999999997 23.46 23.235 150-151 28.4125 25.0375 23.1375 23.4125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 1.0 25 0.0 26 0.0 27 0.5 28 2.0 29 3.5 30 5.0 31 5.5 32 4.5 33 7.5 34 14.5 35 25.5 36 36.0 37 40.5 38 57.0 39 77.0 40 85.0 41 112.0 42 130.5 43 135.0 44 147.0 45 145.5 46 137.0 47 135.5 48 147.0 49 160.5 50 161.5 51 139.5 52 124.0 53 125.0 54 128.0 55 122.5 56 102.0 57 107.0 58 115.0 59 122.5 60 131.0 61 111.5 62 107.5 63 106.0 64 89.0 65 81.5 66 78.5 67 72.5 68 69.0 69 64.0 70 55.0 71 47.0 72 37.5 73 24.0 74 17.0 75 17.5 76 13.0 77 6.0 78 2.0 79 1.0 80 1.0 81 1.0 82 1.0 83 0.5 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 98.93724696356276 97.75 2 0.9109311740890688 1.7999999999999998 3 0.15182186234817813 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.45 0.0 0.0 0.0 0.0 86-87 0.5125 0.0 0.0 0.0 0.0 88-89 0.5875 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.85 0.0 0.0 0.0 0.0 94-95 1.0625 0.0 0.0 0.0 0.0 96-97 1.3 0.0 0.0 0.0 0.0 98-99 1.4625 0.0 0.0 0.0 0.0 100-101 1.65 0.0 0.0 0.0 0.0 102-103 1.9625 0.0 0.0 0.0 0.0 104-105 2.25 0.0 0.0 0.0 0.0 106-107 2.6624999999999996 0.0 0.0 0.0 0.0 108-109 2.95 0.0 0.0 0.0 0.0 110-111 3.275 0.0 0.0 0.0 0.0 112-113 3.6 0.0 0.0 0.0 0.0 114-115 4.0875 0.0 0.0 0.0 0.0 116-117 4.525 0.0 0.0 0.0 0.0 118-119 4.9875 0.0 0.0 0.0 0.0 120-121 5.4125 0.0 0.0 0.0 0.0 122-123 5.737500000000001 0.0 0.0 0.0 0.0 124-125 6.275 0.0 0.0 0.0 0.0 126-127 6.975 0.0 0.0 0.0 0.0 128-129 7.5625 0.0 0.0 0.0 0.0 130-131 8.0875 0.0 0.0 0.0 0.0 132-133 8.875 0.0 0.0 0.0 0.0 134-135 9.6 0.0 0.0 0.0 0.0 136-137 10.350000000000001 0.0 0.0 0.0 0.0 138-139 11.024999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1307985 spots for SRR5579253.sra Written 1307985 spots for SRR5579253.sra Read 1307985 spots for SRR5579253.sra Written 1307985 spots for SRR5579253.sra Read 1307985 spots for SRR5579253.sra Written 1307985 spots for SRR5579253.sra Read 1307985 spots for SRR5579253.sra Written 1307985 spots for SRR5579253.sra Read 1307985 spots for SRR5579253.sra Written 1307985 spots for SRR5579253.sra Read 1307985 spots for SRR5579253.sra Written 1307985 spots for SRR5579253.sra Read 1307985 spots for SRR5579253.sra Written 1307985 spots for SRR5579253.sra Read 1307985 spots for SRR5579253.sra Written 1307985 spots for SRR5579253.sra Read 1307988 spots for SRR5579253.sra Written 1307988 spots for SRR5579253.sra Read 1307985 spots for SRR5579253.sra Written 1307985 spots for SRR5579253.sra Read 1307985 spots for SRR5579253.sra Written 1307985 spots for SRR5579253.sra Read 1307985 spots for SRR5579253.sra Written 1307985 spots for SRR5579253.sra Read 1307985 spots for SRR5579253.sra Written 1307985 spots for SRR5579253.sra Read 1307985 spots for SRR5579253.sra Written 1307985 spots for SRR5579253.sra Read 1307985 spots for SRR5579253.sra Written 1307985 spots for SRR5579253.sra Read 1307985 spots for SRR5579253.sra Written 1307985 spots for SRR5579253.sra Read 1307985 spots for SRR5579253.sra Written 1307985 spots for SRR5579253.sra Read 1307985 spots for SRR5579253.sra Written 1307985 spots for SRR5579253.sra Read 1307985 spots for SRR5579253.sra Written 1307985 spots for SRR5579253.sra Read 1307985 spots for SRR5579253.sra Written 1307985 spots for SRR5579253.sra SRR ids: ['SRR5579253.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4oj44n2i SRR5579253.sra spots: 26159703 blocks: [[1, 1307985], [1307986, 2615970], [2615971, 3923955], [3923956, 5231940], [5231941, 6539925], [6539926, 7847910], [7847911, 9155895], [9155896, 10463880], [10463881, 11771865], [11771866, 13079850], [13079851, 14387835], [14387836, 15695820], [15695821, 17003805], [17003806, 18311790], [18311791, 19619775], [19619776, 20927760], [20927761, 22235745], [22235746, 23543730], [23543731, 24851715], [24851716, 26159703]] SRR5579253 file size 8842964 SRR5579253 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579253 SRR5579253_1.fastq SRR5579253_2.fastq Input file: SRR5579253_1.fastq Paired file: SRR5579253_2.fastq trimmed: SRR5579253-trimmed-pair1.fastq, SRR5579253-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 23:36:23 2024 >> started Mon Dec 9 23:36:55 2024 >> done (31.946s) 26159703 read pairs processed; of these: 44524 ( 0.17%) short read pairs filtered out after trimming by size control 36087 ( 0.14%) empty read pairs filtered out after trimming by size control 26079092 (99.69%) read pairs available; of these: 11444228 (43.88%) trimmed read pairs available after processing 14634864 (56.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 11 0.00% 20 11 0.00% 21 12 0.00% 22 15 0.00% 23 16 0.00% 24 10 0.00% 25 19 0.00% 26 18 0.00% 27 14 0.00% 28 14 0.00% 29 20 0.00% 30 21 0.00% 31 13 0.00% 32 24 0.00% 33 24 0.00% 34 28 0.00% 35 47 0.00% 36 48 0.00% 37 44 0.00% 38 39 0.00% 39 43 0.00% 40 54 0.00% 41 77 0.00% 42 60 0.00% 43 67 0.00% 44 99 0.00% 45 82 0.00% 46 120 0.00% 47 159 0.00% 48 148 0.00% 49 153 0.00% 50 195 0.00% 51 206 0.00% 52 254 0.00% 53 260 0.00% 54 281 0.00% 55 343 0.00% 56 353 0.00% 57 408 0.00% 58 525 0.00% 59 591 0.00% 60 646 0.00% 61 796 0.00% 62 877 0.00% 63 949 0.00% 64 1014 0.00% 65 1171 0.00% 66 1417 0.01% 67 1573 0.01% 68 1850 0.01% 69 2405 0.01% 70 2935 0.01% 71 2885 0.01% 72 3163 0.01% 73 3503 0.01% 74 3822 0.01% 75 4279 0.02% 76 4942 0.02% 77 5462 0.02% 78 6095 0.02% 79 7024 0.03% 80 7853 0.03% 81 8729 0.03% 82 9853 0.04% 83 11289 0.04% 84 14010 0.05% 85 15566 0.06% 86 16497 0.06% 87 17792 0.07% 88 18923 0.07% 89 19756 0.08% 90 21397 0.08% 91 23265 0.09% 92 25199 0.10% 93 26811 0.10% 94 28573 0.11% 95 30192 0.12% 96 31917 0.12% 97 33635 0.13% 98 34532 0.13% 99 36721 0.14% 100 38377 0.15% 101 40863 0.16% 102 43900 0.17% 103 45962 0.18% 104 48289 0.19% 105 49876 0.19% 106 52269 0.20% 107 53129 0.20% 108 55021 0.21% 109 56976 0.22% 110 58384 0.22% 111 60963 0.23% 112 64489 0.25% 113 66458 0.25% 114 70251 0.27% 115 73057 0.28% 116 74104 0.28% 117 75969 0.29% 118 76562 0.29% 119 78423 0.30% 120 81030 0.31% 121 83098 0.32% 122 86180 0.33% 123 89292 0.34% 124 93859 0.36% 125 96315 0.37% 126 99043 0.38% 127 99508 0.38% 128 100762 0.39% 129 103381 0.40% 130 104721 0.40% 131 106743 0.41% 132 111764 0.43% 133 115829 0.44% 134 119446 0.46% 135 124259 0.48% 136 127877 0.49% 137 131370 0.50% 138 134416 0.52% 139 140389 0.54% 140 144094 0.55% 141 151053 0.58% 142 161092 0.62% 143 172013 0.66% 144 187851 0.72% 145 212748 0.82% 146 249508 0.96% 147 311247 1.19% 148 434484 1.67% 149 799604 3.07% 150 4793680 18.38% 151 14634864 56.12% 26079092 reads passed initial QC criterion=sequence-density sequence-density=0.86 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=29 prefix-density=0.86 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=17.72 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.3 sequence=TGTTCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATGTTCTCTATTCCG criterion=sequence-density sequence-density=0.92 sequence-density-rank=1 fanout-score=3.76 fanout-score-rank=15 prefix-density=1.02 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=16.87 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.9 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCCGATCGAGGGCATCAAGAAGTTCGAGACCCTCTCGTACCTGCCCCCTCTCTCCGTGGAGTCTCTCCTGAAGCAGATCGAGTACCTGATCCGCTCCAAGTGGGTTCCTTGCCT SRR5579253 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 23:37:44 Started mapping on | Dec 09 23:37:44 Finished on | Dec 09 23:41:29 Mapping speed, Million of reads per hour | 417.27 Number of input reads | 26079092 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 24579493 Uniquely mapped reads % | 94.25% Average mapped length | 290.96 Number of splices: Total | 23241571 Number of splices: Annotated (sjdb) | 22026140 Number of splices: GT/AG | 22956876 Number of splices: GC/AG | 260579 Number of splices: AT/AC | 10055 Number of splices: Non-canonical | 14061 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.36 Insertion rate per base | 0.00% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 314220 % of reads mapped to multiple loci | 1.20% Number of reads mapped to too many loci | 43826 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.40% % of reads unmapped: other | 0.98% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1212277 1212277 1212277 N_multimapping 314220 314220 314220 N_noFeature 607503 23828975 828178 N_ambiguous 614522 2570 86767 UnstrandedReadsAssigned:23357468 PositiveStrandReadsAssigned:747948 NegativeStrandReadsAssigned:23664548 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR5579253 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579253-trimmed-pair1.fastq SRR5579253-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,079,092 reads, 23,744,249 reads pseudoaligned [quant] estimated average fragment length: 236.284 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,164 rounds 52973 SRR5579253.ke.tsv 35125 SRR5579253.se.tsv 88098 total ==> SRR5579253.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 701.045 7.78554 0.605995 PNS24247 1044 808.716 33.8186 2.28184 PNS24249 1928 1692.72 31.3405 1.01029 PNS24246 1044 808.716 33.8186 2.28184 PNS24248 1044 808.716 33.8186 2.28184 PNS24244 1471 1235.72 127.418 5.6265 PNS24243 293 104.233 0 0 KQK14069 1603 1367.72 387.823 15.4726 KQK14071 474 252.722 10.5763 2.2836 ==> SRR5579253.se.tsv <== BRADI_1g14170v3 431 BRADI_1g53295v3 87 BRADI_1g59795v3 295 BRADI_1g07683v3 0 BRADI_1g00485v3 55 BRADI_1g20270v3 1978 BRADI_1g74790v3 98 BRADI_1g09890v3 8 BRADI_1g77505v3 369 BRADI_1g48960v3 0 SRR5579253 completed mapping pipeline successfully