Starting /dee2/code/volunteer_pipeline.sh SRR5579254 current disk space = 1523315830784 free memory = 1601770072 SRR5579254 SRAfilesize c90fcdffc371d97f973b97a8b967a241 SRR5579254.sra SRR5579254.sra file validated SRR5579254 is paired end SRR5579254 is conventional basespace SRR5579254 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579254_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.18925 34.0 33.0 34.0 30.0 34.0 2 32.8965 34.0 33.0 34.0 30.0 34.0 3 33.0215 34.0 33.0 34.0 32.0 34.0 4 33.158 34.0 33.0 34.0 32.0 34.0 5 32.97875 34.0 33.0 34.0 32.0 34.0 6 36.849 38.0 37.0 38.0 35.0 38.0 7 37.20325 38.0 38.0 38.0 36.0 38.0 8 37.32225 38.0 38.0 38.0 37.0 38.0 9 37.462 38.0 38.0 38.0 37.0 38.0 10-14 37.36425 38.0 38.0 38.0 37.0 38.0 15-19 37.3395 38.0 38.0 38.0 37.0 38.0 20-24 37.26115 38.0 38.0 38.0 36.6 38.0 25-29 37.19315 38.0 38.0 38.0 36.8 38.0 30-34 37.05975 38.0 38.0 38.0 36.2 38.0 35-39 36.7743 38.0 38.0 38.0 35.0 38.0 40-44 36.7566 38.0 38.0 38.0 35.0 38.0 45-49 36.706399999999995 38.0 38.0 38.0 34.6 38.0 50-54 37.144999999999996 38.0 38.0 38.0 36.0 38.0 55-59 36.99855 38.0 38.0 38.0 36.0 38.0 60-64 36.997 38.0 38.0 38.0 36.0 38.0 65-69 36.391000000000005 38.0 38.0 38.0 33.8 38.0 70-74 36.68205 38.0 38.0 38.0 34.4 38.0 75-79 36.574799999999996 38.0 38.0 38.0 34.4 38.0 80-84 36.441950000000006 38.0 38.0 38.0 33.8 38.0 85-89 36.50205 38.0 38.0 38.0 34.0 38.0 90-94 36.36965 38.0 38.0 38.0 33.8 38.0 95-99 36.28215 38.0 38.0 38.0 33.6 38.0 100-104 35.85865 38.0 37.0 38.0 32.2 38.0 105-109 35.732800000000005 38.0 36.8 38.0 31.0 38.0 110-114 35.53555 38.0 36.4 38.0 30.6 38.0 115-119 35.2745 38.0 36.0 38.0 28.4 38.0 120-124 35.06145 38.0 35.6 38.0 28.2 38.0 125-129 34.13565 38.0 34.4 38.0 22.4 38.0 130-134 34.6946 38.0 34.8 38.0 26.6 38.0 135-139 34.35275 38.0 34.2 38.0 24.8 38.0 140-144 34.2625 38.0 33.8 38.0 25.4 38.0 145-149 33.35555000000001 38.0 33.0 38.0 21.0 38.0 150-151 28.2155 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 4.0 16 4.0 17 4.0 18 2.0 19 7.0 20 6.0 21 7.0 22 8.0 23 10.0 24 11.0 25 20.0 26 25.0 27 23.0 28 36.0 29 50.0 30 56.0 31 76.0 32 95.0 33 150.0 34 192.0 35 300.0 36 752.0 37 2159.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.03735325506937 12.780149413020277 8.537886872998932 33.644610458911416 2 22.675 19.625 35.225 22.475 3 21.775 24.3 22.900000000000002 31.025000000000002 4 29.65 30.925000000000004 18.775 20.65 5 25.785373209349082 33.75219904498618 20.859512440311637 19.602915305353104 6 21.125 32.25 24.575 22.05 7 18.6 18.375 40.8 22.225 8 21.625 20.325 27.474999999999998 30.575000000000003 9 21.15 19.825 29.225 29.799999999999997 10-14 24.169999999999998 25.71 24.4 25.72 15-19 24.610000000000003 24.615000000000002 24.610000000000003 26.165 20-24 24.26 24.834999999999997 24.865000000000002 26.040000000000003 25-29 24.7 24.98 24.555 25.765 30-34 24.445 25.025 24.685000000000002 25.845000000000002 35-39 24.015 24.825 24.93 26.229999999999997 40-44 24.33 25.319999999999997 24.44 25.91 45-49 24.46 24.905 24.465 26.169999999999998 50-54 24.04 24.63 24.755 26.575 55-59 24.545 24.915000000000003 24.515 26.025 60-64 24.785 24.615000000000002 24.104999999999997 26.495 65-69 24.965 24.325 24.455 26.255 70-74 24.92 24.765 24.205 26.11 75-79 25.069999999999997 24.785 24.075 26.07 80-84 25.22 25.19 23.865 25.724999999999998 85-89 24.990000000000002 24.72 24.015 26.275 90-94 25.509999999999998 24.72 23.974999999999998 25.795 95-99 25.324999999999996 24.26 24.375 26.040000000000003 100-104 25.53 24.58 23.385 26.505000000000003 105-109 25.94 24.45 23.21 26.400000000000002 110-114 25.169999999999998 24.62 23.84 26.369999999999997 115-119 25.392539253925396 24.867486748674867 23.367336733673366 26.37263726372637 120-124 25.27 24.98 23.189999999999998 26.56 125-129 25.11 25.165 23.515 26.21 130-134 25.5 24.915000000000003 23.555 26.029999999999998 135-139 25.19 24.52 23.515 26.775 140-144 24.626231311565576 25.076253812690634 23.84619230961548 26.451322566128304 145-149 24.66116529132283 24.991247811952988 23.68592148037009 26.66166541635409 150-151 24.8625 24.325 23.775 27.037499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 2.5 28 4.5 29 5.5 30 8.5 31 10.0 32 10.0 33 17.5 34 25.0 35 38.5 36 54.0 37 68.0 38 71.0 39 83.5 40 115.0 41 137.0 42 154.5 43 164.5 44 174.5 45 189.5 46 188.5 47 172.5 48 171.5 49 161.5 50 146.0 51 142.0 52 118.5 53 103.0 54 107.0 55 101.0 56 89.5 57 81.5 58 82.0 59 87.0 60 80.5 61 76.5 62 73.5 63 66.5 64 68.0 65 75.0 66 70.5 67 61.5 68 63.0 69 57.5 70 53.5 71 38.0 72 30.5 73 34.5 74 24.0 75 16.0 76 10.5 77 7.0 78 4.0 79 2.5 80 1.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.3 2 0.0 3 0.0 4 0.0 5 0.525 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.01 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.005 145-149 0.025 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 98.9638615112459 97.89999999999999 2 0.9855951478392722 1.95 3 0.050543340914834464 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.5625 0.0 0.0 0.0 0.0 86-87 0.775 0.0 0.0 0.0 0.0 88-89 0.9375 0.0 0.0 0.0 0.0 90-91 1.2374999999999998 0.0 0.0 0.0 0.0 92-93 1.5625 0.0 0.0 0.0 0.0 94-95 1.9 0.0 0.0 0.0 0.0 96-97 2.3499999999999996 0.0 0.0 0.0 0.0 98-99 2.6624999999999996 0.0 0.0 0.0 0.0 100-101 2.975 0.0 0.0 0.0 0.0 102-103 3.4625 0.0 0.0 0.0 0.0 104-105 3.7 0.0 0.0 0.0 0.0 106-107 4.175 0.0 0.0 0.0 0.0 108-109 4.6875 0.0 0.0 0.0 0.0 110-111 5.3 0.0 0.0 0.0 0.0 112-113 5.824999999999999 0.0 0.0 0.0 0.0 114-115 6.5875 0.0 0.0 0.0 0.0 116-117 7.2 0.0 0.0 0.0 0.0 118-119 7.887499999999999 0.0 0.0 0.0 0.0 120-121 8.6125 0.0 0.0 0.0 0.0 122-123 9.2625 0.0 0.0 0.0 0.0 124-125 9.9875 0.0 0.0 0.0 0.0 126-127 10.8125 0.0 0.0 0.0 0.0 128-129 11.5875 0.0 0.0 0.0 0.0 130-131 12.25 0.0 0.0 0.0 0.0 132-133 12.9875 0.0 0.0 0.0 0.0 134-135 13.8 0.0 0.0 0.0 0.0 136-137 14.65 0.0 0.0 0.0 0.0 138-139 15.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCGCCG 10 0.0068378756 144.95 145 GAGATCG 40 0.0076702754 18.11875 125-129 >>END_MODULE SRR5579254 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579254_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.60525 33.0 33.0 34.0 32.0 34.0 2 32.7345 33.0 33.0 34.0 32.0 34.0 3 32.77125 34.0 33.0 34.0 32.0 34.0 4 32.7575 34.0 33.0 34.0 32.0 34.0 5 32.82675 34.0 33.0 34.0 32.0 34.0 6 36.8355 38.0 38.0 38.0 36.0 38.0 7 36.89875 38.0 38.0 38.0 36.0 38.0 8 36.73 38.0 38.0 38.0 35.0 38.0 9 36.47075 38.0 38.0 38.0 34.0 38.0 10-14 36.767649999999996 38.0 38.0 38.0 35.4 38.0 15-19 36.823949999999996 38.0 38.0 38.0 36.0 38.0 20-24 36.75705 38.0 38.0 38.0 35.6 38.0 25-29 36.620050000000006 38.0 38.0 38.0 34.8 38.0 30-34 36.75535 38.0 38.0 38.0 35.4 38.0 35-39 36.8136 38.0 38.0 38.0 36.0 38.0 40-44 36.835750000000004 38.0 38.0 38.0 36.0 38.0 45-49 36.814949999999996 38.0 38.0 38.0 36.0 38.0 50-54 36.73165000000001 38.0 38.0 38.0 35.6 38.0 55-59 36.680150000000005 38.0 38.0 38.0 35.4 38.0 60-64 36.6788 38.0 38.0 38.0 35.0 38.0 65-69 36.42695 38.0 38.0 38.0 34.4 38.0 70-74 36.11105 38.0 38.0 38.0 33.4 38.0 75-79 35.837050000000005 38.0 38.0 38.0 31.6 38.0 80-84 35.921549999999996 38.0 38.0 38.0 32.6 38.0 85-89 36.0218 38.0 38.0 38.0 33.2 38.0 90-94 36.00664999999999 38.0 38.0 38.0 33.2 38.0 95-99 35.92865 38.0 38.0 38.0 33.2 38.0 100-104 35.601549999999996 38.0 37.0 38.0 31.6 38.0 105-109 35.4346 38.0 36.8 38.0 31.0 38.0 110-114 35.0019 38.0 36.0 38.0 28.2 38.0 115-119 34.681 38.0 35.6 38.0 26.2 38.0 120-124 33.910250000000005 38.0 34.6 38.0 22.2 38.0 125-129 33.18585 38.0 33.4 38.0 16.2 38.0 130-134 33.1479 38.0 33.0 38.0 17.4 38.0 135-139 32.5386 38.0 32.8 38.0 13.0 38.0 140-144 31.870600000000003 38.0 31.8 38.0 12.6 38.0 145-149 30.28415 38.0 29.6 38.0 2.0 38.0 150-151 24.497625 31.5 14.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 5.0 4 3.0 5 1.0 6 1.0 7 2.0 8 1.0 9 3.0 10 1.0 11 3.0 12 3.0 13 3.0 14 6.0 15 6.0 16 7.0 17 5.0 18 5.0 19 9.0 20 12.0 21 12.0 22 9.0 23 19.0 24 20.0 25 28.0 26 29.0 27 32.0 28 61.0 29 56.0 30 79.0 31 89.0 32 117.0 33 159.0 34 196.0 35 332.0 36 701.0 37 1975.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.575 13.350000000000001 10.375 32.7 2 26.125 20.974999999999998 30.0 22.900000000000002 3 24.55 23.9 25.55 26.0 4 30.175 31.825 16.35 21.65 5 29.299999999999997 32.324999999999996 17.625 20.75 6 22.325 35.425000000000004 18.975 23.275000000000002 7 22.0 15.45 36.1 26.450000000000003 8 22.675 19.725 23.025000000000002 34.575 9 24.224999999999998 21.4 24.775 29.599999999999998 10-14 26.045 25.119999999999997 22.770000000000003 26.064999999999998 15-19 26.200000000000003 23.665 23.669999999999998 26.465 20-24 25.955000000000002 24.474999999999998 23.775 25.795 25-29 26.724999999999998 24.4 23.47 25.405 30-34 26.38 24.805 23.05 25.765 35-39 26.400000000000002 23.94 23.75 25.91 40-44 27.26 23.68 23.380000000000003 25.679999999999996 45-49 26.85 23.955000000000002 23.95 25.245 50-54 26.82 24.169999999999998 23.36 25.650000000000002 55-59 26.6 24.055 23.549999999999997 25.795 60-64 26.455000000000002 23.425 24.0 26.119999999999997 65-69 26.105 24.575 23.669999999999998 25.650000000000002 70-74 26.77 23.945 23.685000000000002 25.6 75-79 26.435 23.65 24.33 25.585 80-84 26.200000000000003 23.965 23.86 25.974999999999998 85-89 26.405 24.279999999999998 23.815 25.5 90-94 26.565 23.835 24.165 25.435000000000002 95-99 27.279999999999998 24.15 23.565 25.005 100-104 26.895000000000003 24.01 23.785 25.31 105-109 27.22 24.154999999999998 23.46 25.165 110-114 27.35 24.64 23.48 24.529999999999998 115-119 27.82 24.65 23.425 24.104999999999997 120-124 27.665 24.935 23.380000000000003 24.02 125-129 27.575 25.595000000000002 22.925 23.905 130-134 27.85 24.805 23.880000000000003 23.465 135-139 28.29 25.064999999999998 23.169999999999998 23.474999999999998 140-144 28.299999999999997 25.22 23.31 23.169999999999998 145-149 28.33 26.224999999999998 23.13 22.314999999999998 150-151 28.599999999999998 26.025 22.725 22.650000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 0.5 26 1.5 27 4.0 28 5.0 29 6.0 30 5.5 31 5.0 32 8.0 33 16.5 34 19.5 35 21.0 36 32.5 37 43.5 38 61.5 39 77.0 40 86.0 41 109.0 42 139.0 43 145.0 44 147.0 45 170.5 46 179.5 47 164.5 48 145.0 49 138.5 50 134.5 51 128.5 52 122.0 53 114.5 54 113.5 55 109.0 56 100.0 57 98.0 58 95.5 59 104.5 60 106.0 61 98.0 62 110.0 63 111.5 64 89.5 65 74.5 66 78.5 67 82.5 68 72.5 69 63.5 70 56.5 71 44.0 72 42.0 73 38.5 74 27.5 75 18.0 76 13.0 77 10.0 78 6.5 79 2.5 80 1.0 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19273461150352 98.3 2 0.7315842583249244 1.4500000000000002 3 0.050454086781029264 0.15 4 0.025227043390514632 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.4625 0.0 0.0 0.0 0.0 84-85 0.6125 0.0 0.0 0.0 0.0 86-87 0.825 0.0 0.0 0.0 0.0 88-89 1.0 0.0 0.0 0.0 0.0 90-91 1.3125 0.0 0.0 0.0 0.0 92-93 1.6375 0.0 0.0 0.0 0.0 94-95 1.9625000000000001 0.0 0.0 0.0 0.0 96-97 2.4125 0.0 0.0125 0.0 0.0 98-99 2.725 0.0 0.025 0.0 0.0 100-101 3.025 0.0 0.025 0.0 0.0 102-103 3.5625 0.0 0.025 0.0 0.0 104-105 3.8499999999999996 0.0 0.025 0.0 0.0 106-107 4.3 0.0 0.025 0.0 0.0 108-109 4.8625 0.0 0.025 0.0 0.0 110-111 5.475 0.0 0.025 0.0 0.0 112-113 6.0 0.0 0.025 0.0 0.0 114-115 6.699999999999999 0.0 0.025 0.0 0.0 116-117 7.325 0.0 0.025 0.0 0.0 118-119 8.025 0.0 0.025 0.0 0.0 120-121 8.8 0.0 0.025 0.0 0.0 122-123 9.475000000000001 0.0 0.025 0.0 0.0 124-125 10.1875 0.0 0.025 0.0 0.0 126-127 10.9875 0.0 0.025 0.0 0.0 128-129 11.7625 0.0 0.025 0.0 0.0 130-131 12.399999999999999 0.0 0.025 0.0 0.0 132-133 13.125 0.0 0.025 0.0 0.0 134-135 13.95 0.0 0.025 0.0 0.0 136-137 14.787500000000001 0.0 0.025 0.0 0.0 138-139 15.7125 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTGTAG 60 0.004491891 14.500001 140-144 AGATCGG 80 0.0020131238 12.6875 125-129 >>END_MODULE Read 1324765 spots for SRR5579254.sra Written 1324765 spots for SRR5579254.sra Read 1324765 spots for SRR5579254.sra Written 1324765 spots for SRR5579254.sra Read 1324765 spots for SRR5579254.sra Written 1324765 spots for SRR5579254.sra Read 1324765 spots for SRR5579254.sra Written 1324765 spots for SRR5579254.sra Read 1324765 spots for SRR5579254.sra Written 1324765 spots for SRR5579254.sra Read 1324765 spots for SRR5579254.sra Written 1324765 spots for SRR5579254.sra Read 1324765 spots for SRR5579254.sra Written 1324765 spots for SRR5579254.sra Read 1324765 spots for SRR5579254.sra Written 1324765 spots for SRR5579254.sra Read 1324765 spots for SRR5579254.sra Written 1324765 spots for SRR5579254.sra Read 1324765 spots for SRR5579254.sra Written 1324765 spots for SRR5579254.sra Read 1324765 spots for SRR5579254.sra Written 1324765 spots for SRR5579254.sra Read 1324765 spots for SRR5579254.sra Written 1324765 spots for SRR5579254.sra Read 1324765 spots for SRR5579254.sra Written 1324765 spots for SRR5579254.sra Read 1324765 spots for SRR5579254.sra Written 1324765 spots for SRR5579254.sra Read 1324765 spots for SRR5579254.sra Written 1324765 spots for SRR5579254.sra Read 1324768 spots for SRR5579254.sra Written 1324768 spots for SRR5579254.sra Read 1324765 spots for SRR5579254.sra Written 1324765 spots for SRR5579254.sra Read 1324765 spots for SRR5579254.sra Written 1324765 spots for SRR5579254.sra Read 1324765 spots for SRR5579254.sra Written 1324765 spots for SRR5579254.sra Read 1324765 spots for SRR5579254.sra Written 1324765 spots for SRR5579254.sra SRR ids: ['SRR5579254.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ys68w2wv SRR5579254.sra spots: 26495303 blocks: [[1, 1324765], [1324766, 2649530], [2649531, 3974295], [3974296, 5299060], [5299061, 6623825], [6623826, 7948590], [7948591, 9273355], [9273356, 10598120], [10598121, 11922885], [11922886, 13247650], [13247651, 14572415], [14572416, 15897180], [15897181, 17221945], [17221946, 18546710], [18546711, 19871475], [19871476, 21196240], [21196241, 22521005], [22521006, 23845770], [23845771, 25170535], [25170536, 26495303]] SRR5579254 file size 8956688 SRR5579254 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579254 SRR5579254_1.fastq SRR5579254_2.fastq Input file: SRR5579254_1.fastq Paired file: SRR5579254_2.fastq trimmed: SRR5579254-trimmed-pair1.fastq, SRR5579254-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 23:39:27 2024 >> started Mon Dec 9 23:39:59 2024 >> done (31.650s) 26495303 read pairs processed; of these: 36151 ( 0.14%) short read pairs filtered out after trimming by size control 60911 ( 0.23%) empty read pairs filtered out after trimming by size control 26398241 (99.63%) read pairs available; of these: 16196773 (61.36%) trimmed read pairs available after processing 10201468 (38.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 17 0.00% 20 24 0.00% 21 21 0.00% 22 26 0.00% 23 25 0.00% 24 34 0.00% 25 22 0.00% 26 31 0.00% 27 26 0.00% 28 35 0.00% 29 40 0.00% 30 48 0.00% 31 42 0.00% 32 54 0.00% 33 66 0.00% 34 63 0.00% 35 92 0.00% 36 69 0.00% 37 94 0.00% 38 131 0.00% 39 122 0.00% 40 157 0.00% 41 193 0.00% 42 169 0.00% 43 194 0.00% 44 227 0.00% 45 266 0.00% 46 297 0.00% 47 361 0.00% 48 426 0.00% 49 463 0.00% 50 542 0.00% 51 626 0.00% 52 688 0.00% 53 745 0.00% 54 811 0.00% 55 895 0.00% 56 1075 0.00% 57 1283 0.00% 58 1402 0.01% 59 1645 0.01% 60 1864 0.01% 61 2150 0.01% 62 2322 0.01% 63 2640 0.01% 64 2916 0.01% 65 3284 0.01% 66 3644 0.01% 67 4227 0.02% 68 4691 0.02% 69 6145 0.02% 70 6643 0.03% 71 7160 0.03% 72 8011 0.03% 73 9112 0.03% 74 9875 0.04% 75 11100 0.04% 76 12197 0.05% 77 13310 0.05% 78 14678 0.06% 79 16513 0.06% 80 18321 0.07% 81 20497 0.08% 82 23032 0.09% 83 25001 0.09% 84 28400 0.11% 85 30761 0.12% 86 32421 0.12% 87 34305 0.13% 88 36580 0.14% 89 38598 0.15% 90 41499 0.16% 91 44706 0.17% 92 47472 0.18% 93 50228 0.19% 94 52869 0.20% 95 55165 0.21% 96 57113 0.22% 97 59329 0.22% 98 61214 0.23% 99 64283 0.24% 100 67857 0.26% 101 69768 0.26% 102 73147 0.28% 103 76416 0.29% 104 78484 0.30% 105 80816 0.31% 106 83803 0.32% 107 84289 0.32% 108 86846 0.33% 109 88724 0.34% 110 90554 0.34% 111 94963 0.36% 112 97840 0.37% 113 99794 0.38% 114 102876 0.39% 115 106353 0.40% 116 107229 0.41% 117 108628 0.41% 118 108435 0.41% 119 110296 0.42% 120 113934 0.43% 121 116133 0.44% 122 119224 0.45% 123 123025 0.47% 124 127775 0.48% 125 129930 0.49% 126 132403 0.50% 127 134477 0.51% 128 134504 0.51% 129 138906 0.53% 130 139582 0.53% 131 142708 0.54% 132 149347 0.57% 133 153537 0.58% 134 158625 0.60% 135 166356 0.63% 136 172196 0.65% 137 177788 0.67% 138 183930 0.70% 139 194592 0.74% 140 204660 0.78% 141 218942 0.83% 142 242911 0.92% 143 253290 0.96% 144 287621 1.09% 145 329790 1.25% 146 392832 1.49% 147 523369 1.98% 148 717469 2.72% 149 1344736 5.09% 150 5977223 22.64% 151 10201468 38.64% 26398241 reads passed initial QC criterion=sequence-density sequence-density=0.74 sequence-density-rank=1 fanout-score=2.85 fanout-score-rank=15 prefix-density=0.80 prefix-fanout=2.6 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.27 sequence-density-rank=16 fanout-score=8.37 fanout-score-rank=1 prefix-density=1.02 prefix-fanout=2.2 sequence=TCCAGCTCCTTTAGCACCTGCGTGGCGTCGGTGCACCCGAACATGGG criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=5.46 fanout-score-rank=7 prefix-density=0.80 prefix-fanout=3.9 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=22.21 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.9 sequence=GCCTCCTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGCGGCTACTGCCGTTGCTCCTTTCCAGGGCCTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCC SRR5579254 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 23:40:50 Started mapping on | Dec 09 23:40:50 Finished on | Dec 09 23:44:01 Mapping speed, Million of reads per hour | 497.56 Number of input reads | 26398241 Average input read length | 285 UNIQUE READS: Uniquely mapped reads number | 25028717 Uniquely mapped reads % | 94.81% Average mapped length | 284.92 Number of splices: Total | 24842276 Number of splices: Annotated (sjdb) | 23434423 Number of splices: GT/AG | 24514229 Number of splices: GC/AG | 296190 Number of splices: AT/AC | 12063 Number of splices: Non-canonical | 19794 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 352837 % of reads mapped to multiple loci | 1.34% Number of reads mapped to too many loci | 48977 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.72% % of reads unmapped: other | 0.95% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1042271 1042271 1042271 N_multimapping 352837 352837 352837 N_noFeature 916364 24205648 1259468 N_ambiguous 563771 3656 84049 UnstrandedReadsAssigned:23548582 PositiveStrandReadsAssigned:819413 NegativeStrandReadsAssigned:23685200 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=140 echo kmer=135 SRR5579254 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579254-trimmed-pair1.fastq SRR5579254-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,398,241 reads, 23,818,379 reads pseudoaligned [quant] estimated average fragment length: 229.573 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,186 rounds 52973 SRR5579254.ke.tsv 35125 SRR5579254.se.tsv 88098 total ==> SRR5579254.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 707.853 0 0 PNS24247 1044 815.427 53.6656 3.90045 PNS24249 1928 1699.43 140.379 4.89556 PNS24246 1044 815.427 53.6656 3.90045 PNS24248 1044 815.427 53.6656 3.90045 PNS24244 1471 1242.43 93.6247 4.46606 PNS24243 293 113.483 0 0 KQK14069 1603 1374.43 4616.09 199.048 KQK14071 474 262.022 171.851 38.8704 ==> SRR5579254.se.tsv <== BRADI_1g14170v3 5247 BRADI_1g53295v3 159 BRADI_1g59795v3 850 BRADI_1g07683v3 0 BRADI_1g00485v3 43 BRADI_1g20270v3 2802 BRADI_1g74790v3 154 BRADI_1g09890v3 4 BRADI_1g77505v3 322 BRADI_1g48960v3 2 SRR5579254 completed mapping pipeline successfully