Starting /dee2/code/volunteer_pipeline.sh SRR5579255 current disk space = 1523353796608 free memory = 1566007596 SRR5579255 SRAfilesize 36fb5f4091ab197892eded61b99de5de SRR5579255.sra SRR5579255.sra file validated SRR5579255 is paired end SRR5579255 is conventional basespace SRR5579255 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579255_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.087 34.0 33.0 34.0 30.0 34.0 2 32.96425 34.0 33.0 34.0 30.0 34.0 3 33.153 34.0 33.0 34.0 32.0 34.0 4 33.36875 34.0 33.0 34.0 33.0 34.0 5 33.38175 34.0 33.0 34.0 33.0 34.0 6 37.1515 38.0 38.0 38.0 36.0 38.0 7 37.51675 38.0 38.0 38.0 37.0 38.0 8 37.558 38.0 38.0 38.0 38.0 38.0 9 37.584 38.0 38.0 38.0 38.0 38.0 10-14 37.5531 38.0 38.0 38.0 38.0 38.0 15-19 37.5106 38.0 38.0 38.0 38.0 38.0 20-24 37.362 38.0 38.0 38.0 37.0 38.0 25-29 37.25555 38.0 38.0 38.0 37.0 38.0 30-34 37.2658 38.0 38.0 38.0 37.0 38.0 35-39 37.086800000000004 38.0 38.0 38.0 36.6 38.0 40-44 36.99275 38.0 38.0 38.0 36.2 38.0 45-49 37.08355 38.0 38.0 38.0 36.4 38.0 50-54 37.3135 38.0 38.0 38.0 37.0 38.0 55-59 37.1764 38.0 38.0 38.0 36.6 38.0 60-64 37.215700000000005 38.0 38.0 38.0 36.8 38.0 65-69 36.933 38.0 38.0 38.0 36.0 38.0 70-74 37.00975 38.0 38.0 38.0 36.0 38.0 75-79 36.86695 38.0 38.0 38.0 35.6 38.0 80-84 36.66675 38.0 38.0 38.0 34.4 38.0 85-89 36.8403 38.0 38.0 38.0 35.0 38.0 90-94 36.6472 38.0 38.0 38.0 34.4 38.0 95-99 36.67425 38.0 38.0 38.0 34.8 38.0 100-104 36.040949999999995 38.0 37.4 38.0 33.0 38.0 105-109 36.1195 38.0 37.8 38.0 33.4 38.0 110-114 35.841499999999996 38.0 37.0 38.0 31.8 38.0 115-119 35.6402 38.0 36.6 38.0 30.6 38.0 120-124 35.5272 38.0 36.2 38.0 31.0 38.0 125-129 35.52005 38.0 36.0 38.0 30.6 38.0 130-134 35.34035 38.0 36.0 38.0 30.6 38.0 135-139 35.30885 38.0 36.0 38.0 31.0 38.0 140-144 35.027699999999996 38.0 35.6 38.0 29.8 38.0 145-149 34.24245 38.0 34.4 38.0 26.8 38.0 150-151 29.956875 35.5 27.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 2.0 14 1.0 15 0.0 16 2.0 17 4.0 18 1.0 19 5.0 20 4.0 21 7.0 22 4.0 23 8.0 24 11.0 25 18.0 26 15.0 27 28.0 28 25.0 29 33.0 30 42.0 31 62.0 32 92.0 33 89.0 34 138.0 35 229.0 36 580.0 37 2598.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.66567647853092 14.312719416689172 9.61382662705914 30.407777477720764 2 23.400000000000002 19.775000000000002 33.875 22.95 3 21.625 27.025 24.625 26.724999999999998 4 25.674999999999997 32.15 19.25 22.925 5 24.15 35.275 22.025 18.55 6 21.349999999999998 34.0 22.225 22.425 7 17.299999999999997 19.225 40.425 23.05 8 20.275000000000002 19.925 27.875 31.924999999999997 9 20.3 20.599999999999998 30.375000000000004 28.725 10-14 23.31 26.179999999999996 24.54 25.97 15-19 23.294999999999998 25.569999999999997 25.650000000000002 25.485000000000003 20-24 22.746373186593296 25.937968984492244 25.49274637318659 25.822911455727866 25-29 23.485568505827622 26.251813315992194 25.07628432794758 25.186333850232607 30-34 22.8 25.97 26.05 25.180000000000003 35-39 22.895 25.705 25.55 25.85 40-44 23.115 25.685000000000002 25.8 25.4 45-49 23.56089022255564 25.95648912228057 25.006251562890725 25.476369092273067 50-54 23.395 25.77 25.724999999999998 25.11 55-59 23.817381738173818 25.22252225222522 25.677567756775677 25.28252825282528 60-64 24.1546618647459 25.35514205682273 25.155062024809926 25.33513405362145 65-69 23.464692938587717 26.510302060412084 25.21504300860172 24.80996199239848 70-74 23.995998999749936 25.571392848212053 25.221305326331585 25.211302825706426 75-79 23.580000000000002 25.929999999999996 25.040000000000003 25.45 80-84 23.68 25.46 25.45 25.41 85-89 24.07 25.665 25.0 25.264999999999997 90-94 24.51 25.4 24.85 25.240000000000002 95-99 23.945 25.929999999999996 24.685000000000002 25.44 100-104 24.532266133066532 25.86293146573287 24.327163581790895 25.277638819409702 105-109 24.005006257822277 25.612015018773466 24.585732165206508 25.797246558197745 110-114 24.248336585121816 25.8392115663615 24.798639251588373 25.11381259692831 115-119 24.326081520380093 25.52638159539885 24.601150287571894 25.546386596649164 120-124 24.654999999999998 25.545 24.41 25.39 125-129 23.535 26.215 24.37 25.88 130-134 24.169999999999998 26.1 24.125 25.605 135-139 23.799999999999997 26.26 24.095 25.845000000000002 140-144 23.91 26.025 25.05 25.014999999999997 145-149 23.474999999999998 25.869999999999997 24.745 25.91 150-151 25.1 24.775 24.3875 25.7375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 2.5 27 2.5 28 6.5 29 8.5 30 5.0 31 7.0 32 14.0 33 17.0 34 20.0 35 30.5 36 50.0 37 81.0 38 94.5 39 96.0 40 118.0 41 146.5 42 157.0 43 168.5 44 193.5 45 195.5 46 206.0 47 216.0 48 198.0 49 182.5 50 164.5 51 148.0 52 150.5 53 146.0 54 122.5 55 108.5 56 109.5 57 103.5 58 83.0 59 81.5 60 78.5 61 63.5 62 59.0 63 53.5 64 52.5 65 50.5 66 40.5 67 37.0 68 29.5 69 21.0 70 22.5 71 19.5 72 11.5 73 6.5 74 6.5 75 5.0 76 2.0 77 2.0 78 1.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.425 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.05 25-29 0.045 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.025 50-54 0.0 55-59 0.01 60-64 0.04 65-69 0.02 70-74 0.025 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.05 105-109 0.125 110-114 0.055 115-119 0.025 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.89987484355444 99.775 2 0.0750938673341677 0.15 3 0.025031289111389236 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.32499999999999996 0.0 0.0 0.0 0.0 78-79 0.35 0.0 0.0 0.0 0.0 80-81 0.3625 0.0 0.0 0.0 0.0 82-83 0.42500000000000004 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.6 0.0 0.0 0.0 0.0 88-89 0.7250000000000001 0.0 0.0 0.0 0.0 90-91 0.9125 0.0 0.0 0.0 0.0 92-93 1.125 0.0 0.0 0.0 0.0 94-95 1.3625 0.0 0.0 0.0 0.0 96-97 1.6875 0.0 0.0 0.0 0.0 98-99 1.9125 0.0 0.0 0.0 0.0 100-101 2.2625 0.0 0.0 0.0 0.0 102-103 2.675 0.0 0.0 0.0 0.0 104-105 3.0374999999999996 0.0 0.0 0.0 0.0 106-107 3.35 0.0 0.0 0.0 0.0 108-109 3.8625 0.0 0.0 0.0 0.0 110-111 4.4 0.0 0.0 0.0 0.0 112-113 4.9 0.0 0.0 0.0 0.0 114-115 5.4625 0.0 0.0 0.0 0.0 116-117 5.975 0.0 0.0 0.0 0.0 118-119 6.8 0.0 0.0 0.0 0.0 120-121 7.5625 0.0 0.0 0.0 0.0 122-123 8.1875 0.0 0.0 0.0 0.0 124-125 8.712499999999999 0.0 0.0 0.0 0.0 126-127 9.3875 0.0 0.0 0.0 0.0 128-129 10.2625 0.0 0.0 0.0 0.0 130-131 10.9875 0.0 0.0 0.0 0.0 132-133 11.675 0.0 0.0 0.0 0.0 134-135 12.4625 0.0 0.0 0.0 0.0 136-137 13.2 0.0 0.0 0.0 0.0 138-139 13.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCATATT 10 0.006892826 144.5625 2 >>END_MODULE SRR5579255 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579255_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.62575 33.0 33.0 34.0 32.0 34.0 2 32.77775 34.0 33.0 34.0 32.0 34.0 3 32.761 34.0 33.0 34.0 32.0 34.0 4 32.66225 34.0 33.0 34.0 32.0 34.0 5 32.53625 34.0 33.0 34.0 32.0 34.0 6 36.80075 38.0 38.0 38.0 36.0 38.0 7 36.94575 38.0 38.0 38.0 36.0 38.0 8 36.81 38.0 38.0 38.0 36.0 38.0 9 36.75325 38.0 38.0 38.0 36.0 38.0 10-14 36.697250000000004 38.0 38.0 38.0 35.6 38.0 15-19 36.85645 38.0 38.0 38.0 36.2 38.0 20-24 36.79295 38.0 38.0 38.0 36.2 38.0 25-29 36.748599999999996 38.0 38.0 38.0 36.0 38.0 30-34 36.762699999999995 38.0 38.0 38.0 36.4 38.0 35-39 36.9131 38.0 38.0 38.0 37.0 38.0 40-44 36.8724 38.0 38.0 38.0 37.0 38.0 45-49 36.76425 38.0 38.0 38.0 36.6 38.0 50-54 36.7817 38.0 38.0 38.0 36.2 38.0 55-59 36.70215 38.0 38.0 38.0 36.2 38.0 60-64 36.7248 38.0 38.0 38.0 36.0 38.0 65-69 36.599199999999996 38.0 38.0 38.0 35.8 38.0 70-74 36.303599999999996 38.0 38.0 38.0 34.4 38.0 75-79 35.8937 38.0 38.0 38.0 32.0 38.0 80-84 36.0573 38.0 38.0 38.0 33.6 38.0 85-89 36.2303 38.0 38.0 38.0 34.2 38.0 90-94 36.33624999999999 38.0 38.0 38.0 34.8 38.0 95-99 36.2774 38.0 38.0 38.0 34.6 38.0 100-104 36.048350000000006 38.0 38.0 38.0 34.0 38.0 105-109 35.67705 38.0 38.0 38.0 32.4 38.0 110-114 35.6151 38.0 38.0 38.0 32.0 38.0 115-119 35.252700000000004 38.0 36.8 38.0 30.6 38.0 120-124 34.704499999999996 38.0 35.6 38.0 26.2 38.0 125-129 34.29735 38.0 35.0 38.0 23.0 38.0 130-134 34.385549999999995 38.0 35.0 38.0 25.2 38.0 135-139 34.0224 38.0 34.6 38.0 23.8 38.0 140-144 33.3563 38.0 33.2 38.0 19.0 38.0 145-149 32.1343 38.0 33.0 38.0 8.6 38.0 150-151 27.743625 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 20.0 3 9.0 4 2.0 5 5.0 6 2.0 7 2.0 8 3.0 9 3.0 10 2.0 11 2.0 12 2.0 13 2.0 14 5.0 15 1.0 16 6.0 17 7.0 18 12.0 19 5.0 20 5.0 21 4.0 22 15.0 23 14.0 24 10.0 25 20.0 26 20.0 27 22.0 28 35.0 29 39.0 30 54.0 31 59.0 32 72.0 33 124.0 34 157.0 35 269.0 36 534.0 37 2457.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.625942684766216 16.7420814479638 10.910005027652087 26.7219708396179 2 26.56289229224203 21.591765001255336 29.24930956565403 22.596033140848608 3 24.119718309859156 23.616700201207244 27.640845070422536 24.622736418511064 4 27.590543259557343 31.53923541247485 18.133802816901408 22.736418511066397 5 26.790650917315904 34.5061573259613 18.597637597386278 20.105554159336517 6 21.317635270541082 34.168336673346694 19.76452905811623 24.749498997995993 7 19.994982438534873 17.26041144004014 37.55644756648269 25.188158554942298 8 21.700953336678374 21.600602107375817 23.908680381334673 32.78976417461114 9 23.76535472549511 20.330910002506894 25.41990473802958 30.483830533968415 10-14 24.43965301108158 26.314997743569172 23.326480469337614 25.91886877601163 15-19 25.57404993482402 25.478792740399076 23.834352752431563 25.112804572345333 20-24 25.342088115883914 25.397223196832243 24.464939100796954 24.79574958648689 25-29 24.733069326783298 24.96867010877738 24.983708456564237 25.314552107875084 30-34 25.256930866797013 25.11154559582895 24.695442923747933 24.93608061362611 35-39 25.1654301183076 25.506316422699015 24.192901544014436 25.135351914978944 40-44 25.67174654100662 25.355925406055746 24.66412672949669 24.308201323440947 45-49 26.32291040288635 25.080176388053715 24.714371617558626 23.8825415915013 50-54 25.88730699819531 24.914778423902145 25.01503910166433 24.18287547623822 55-59 25.925183030789288 24.927289138501653 24.340587704342592 24.806940126366463 60-64 25.011284417473295 25.603089422739355 25.05642208736647 24.329204072420886 65-69 25.30972563575262 25.490294427446457 24.642624266439284 24.557355670361638 70-74 25.787678105558896 25.040136463977525 24.78426650612081 24.387918924342767 75-79 25.312578458448403 25.287471754958574 24.800401707255837 24.599548079337183 80-84 25.83057312054602 25.218307738632944 24.325002509284353 24.626116631536686 85-89 25.821337212218488 24.848272056979486 24.79309825951748 24.537292471284548 90-94 26.19620824556124 24.61631056274451 25.127896479085166 24.059584712609087 95-99 25.759855552211857 25.253285184070617 25.07774099709098 23.909118266626542 100-104 25.846076710955128 25.921283529706695 24.617698671346204 23.614941087991976 105-109 26.201223793760658 25.78493329320895 24.566155080750327 23.447687832280067 110-114 26.79108970499699 25.170579971904477 24.46317479430062 23.575155528797914 115-119 26.820096269554757 25.58162855996791 24.28800641797032 23.310268752507017 120-124 27.095868431608505 25.64179703168873 24.523666265543522 22.738668271159245 125-129 26.805158312007627 26.333483867730443 24.527071102413565 22.33428671784836 130-134 27.168239309375625 25.552097972294717 24.212005621361172 23.06765709696848 135-139 27.436026091319622 26.18665328650276 24.982438534872053 21.394882087305568 140-144 27.296443084332513 26.167661666583054 24.55225003762605 21.983645211458384 145-149 27.930549979927736 26.505419510236855 23.76555600160578 21.798474508229624 150-151 28.962228635964358 25.724683147195382 23.641611243568832 21.671476973271428 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 3.0 2 1.5 3 1.5 4 1.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.5 28 2.0 29 3.0 30 4.5 31 5.5 32 8.5 33 15.0 34 23.5 35 25.5 36 32.5 37 47.0 38 69.0 39 95.0 40 107.0 41 127.0 42 138.5 43 151.0 44 179.0 45 188.5 46 206.0 47 203.5 48 187.0 49 182.5 50 156.5 51 144.0 52 158.0 53 153.0 54 136.0 55 123.0 56 108.5 57 103.0 58 101.0 59 86.5 60 75.5 61 71.5 62 70.0 63 65.0 64 59.0 65 51.5 66 50.0 67 56.0 68 52.5 69 44.0 70 28.5 71 21.0 72 20.0 73 17.0 74 10.0 75 7.5 76 6.0 77 2.5 78 2.0 79 2.0 80 1.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5499999999999999 2 0.42500000000000004 3 0.6 4 0.6 5 0.525 6 0.2 7 0.35000000000000003 8 0.35000000000000003 9 0.27499999999999997 10-14 0.28500000000000003 15-19 0.27 20-24 0.245 25-29 0.255 30-34 0.265 35-39 0.26 40-44 0.26 45-49 0.22 50-54 0.26 55-59 0.29 60-64 0.305 65-69 0.315 70-74 0.33999999999999997 75-79 0.42500000000000004 80-84 0.37 85-89 0.315 90-94 0.31 95-99 0.31 100-104 0.27499999999999997 105-109 0.31 110-114 0.33999999999999997 115-119 0.27999999999999997 120-124 0.27999999999999997 125-129 0.35500000000000004 130-134 0.38 135-139 0.35000000000000003 140-144 0.335 145-149 0.36 150-151 0.3875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79934788061199 99.47500000000001 2 0.1254075746175069 0.25 3 0.025081514923501375 0.075 4 0.05016302984700275 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.23750000000000002 0.0 0.0 0.0 0.0 76-77 0.32499999999999996 0.0 0.0 0.0 0.0 78-79 0.35 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.44999999999999996 0.0 0.0 0.0 0.0 84-85 0.4875 0.0 0.0 0.0 0.0 86-87 0.6 0.0 0.0 0.0 0.0 88-89 0.7125 0.0 0.0 0.0 0.0 90-91 0.8999999999999999 0.0 0.0 0.0 0.0 92-93 1.1 0.0 0.0 0.0 0.0 94-95 1.3375 0.0 0.0 0.0 0.0 96-97 1.675 0.0 0.0 0.0 0.0 98-99 1.925 0.0 0.0 0.0 0.0 100-101 2.3 0.0 0.0 0.0 0.0 102-103 2.7 0.0 0.0 0.0 0.0 104-105 3.1125 0.0 0.0 0.0 0.0 106-107 3.425 0.0 0.0 0.0 0.0 108-109 3.9375 0.0 0.0 0.0 0.0 110-111 4.525 0.0 0.0 0.0 0.0 112-113 5.025 0.0 0.0 0.0 0.0 114-115 5.5875 0.0 0.0 0.0 0.0 116-117 6.1 0.0 0.0 0.0 0.0 118-119 6.9875 0.0 0.0 0.0 0.0 120-121 7.762499999999999 0.0 0.0 0.0 0.0 122-123 8.425 0.0 0.0 0.0 0.0 124-125 8.975 0.0 0.0 0.0 0.0 126-127 9.6 0.0 0.0 0.0 0.0 128-129 10.4875 0.0 0.0 0.0 0.0 130-131 11.225 0.0 0.0 0.0 0.0 132-133 11.95 0.0 0.0 0.0 0.0 134-135 12.75 0.0 0.0 0.0 0.0 136-137 13.45 0.0 0.0 0.0 0.0 138-139 14.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTTGAC 10 0.006824188 145.0 1 TCACCAA 15 1.1388992E-4 145.0 8 TTCACCA 25 8.69634E-4 87.0 7 >>END_MODULE Read 1025238 spots for SRR5579255.sra Written 1025238 spots for SRR5579255.sra Read 1025238 spots for SRR5579255.sra Written 1025238 spots for SRR5579255.sra Read 1025238 spots for SRR5579255.sra Written 1025238 spots for SRR5579255.sra Read 1025238 spots for SRR5579255.sra Written 1025238 spots for SRR5579255.sra Read 1025238 spots for SRR5579255.sra Written 1025238 spots for SRR5579255.sra Read 1025238 spots for SRR5579255.sra Written 1025238 spots for SRR5579255.sra Read 1025238 spots for SRR5579255.sra Written 1025238 spots for SRR5579255.sra Read 1025238 spots for SRR5579255.sra Written 1025238 spots for SRR5579255.sra Read 1025238 spots for SRR5579255.sra Written 1025238 spots for SRR5579255.sra Read 1025238 spots for SRR5579255.sra Written 1025238 spots for SRR5579255.sra Read 1025238 spots for SRR5579255.sra Written 1025238 spots for SRR5579255.sra Read 1025238 spots for SRR5579255.sra Written 1025238 spots for SRR5579255.sra Read 1025238 spots for SRR5579255.sra Written 1025238 spots for SRR5579255.sra Read 1025242 spots for SRR5579255.sra Written 1025242 spots for SRR5579255.sra Read 1025238 spots for SRR5579255.sra Written 1025238 spots for SRR5579255.sra Read 1025238 spots for SRR5579255.sra Written 1025238 spots for SRR5579255.sra Read 1025238 spots for SRR5579255.sra Written 1025238 spots for SRR5579255.sra Read 1025238 spots for SRR5579255.sra Written 1025238 spots for SRR5579255.sra Read 1025238 spots for SRR5579255.sra Written 1025238 spots for SRR5579255.sra Read 1025238 spots for SRR5579255.sra Written 1025238 spots for SRR5579255.sra SRR ids: ['SRR5579255.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p7blb974 SRR5579255.sra spots: 20504764 blocks: [[1, 1025238], [1025239, 2050476], [2050477, 3075714], [3075715, 4100952], [4100953, 5126190], [5126191, 6151428], [6151429, 7176666], [7176667, 8201904], [8201905, 9227142], [9227143, 10252380], [10252381, 11277618], [11277619, 12302856], [12302857, 13328094], [13328095, 14353332], [14353333, 15378570], [15378571, 16403808], [16403809, 17429046], [17429047, 18454284], [18454285, 19479522], [19479523, 20504764]] SRR5579255 file size 6926691 SRR5579255 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579255 SRR5579255_1.fastq SRR5579255_2.fastq Input file: SRR5579255_1.fastq Paired file: SRR5579255_2.fastq trimmed: SRR5579255-trimmed-pair1.fastq, SRR5579255-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 23:37:26 2024 >> started Mon Dec 9 23:37:54 2024 >> done (28.262s) 20504764 read pairs processed; of these: 45087 ( 0.22%) short read pairs filtered out after trimming by size control 101441 ( 0.49%) empty read pairs filtered out after trimming by size control 20358236 (99.29%) read pairs available; of these: 11354467 (55.77%) trimmed read pairs available after processing 9003769 (44.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 18 0.00% 20 19 0.00% 21 8 0.00% 22 14 0.00% 23 21 0.00% 24 19 0.00% 25 19 0.00% 26 18 0.00% 27 31 0.00% 28 37 0.00% 29 19 0.00% 30 28 0.00% 31 20 0.00% 32 30 0.00% 33 30 0.00% 34 44 0.00% 35 35 0.00% 36 45 0.00% 37 41 0.00% 38 62 0.00% 39 61 0.00% 40 83 0.00% 41 65 0.00% 42 94 0.00% 43 99 0.00% 44 106 0.00% 45 131 0.00% 46 112 0.00% 47 133 0.00% 48 157 0.00% 49 234 0.00% 50 204 0.00% 51 267 0.00% 52 269 0.00% 53 336 0.00% 54 361 0.00% 55 394 0.00% 56 483 0.00% 57 557 0.00% 58 620 0.00% 59 677 0.00% 60 803 0.00% 61 970 0.00% 62 1037 0.01% 63 1207 0.01% 64 1332 0.01% 65 1638 0.01% 66 1686 0.01% 67 1961 0.01% 68 2432 0.01% 69 2818 0.01% 70 3214 0.02% 71 3490 0.02% 72 3932 0.02% 73 4391 0.02% 74 4866 0.02% 75 5542 0.03% 76 6016 0.03% 77 6821 0.03% 78 7783 0.04% 79 8467 0.04% 80 9726 0.05% 81 10935 0.05% 82 12765 0.06% 83 14115 0.07% 84 16710 0.08% 85 18450 0.09% 86 19959 0.10% 87 21120 0.10% 88 22516 0.11% 89 24558 0.12% 90 25863 0.13% 91 27919 0.14% 92 30075 0.15% 93 32521 0.16% 94 34118 0.17% 95 35668 0.18% 96 37321 0.18% 97 38327 0.19% 98 39880 0.20% 99 43130 0.21% 100 45125 0.22% 101 48290 0.24% 102 50214 0.25% 103 51776 0.25% 104 53779 0.26% 105 56721 0.28% 106 56983 0.28% 107 57556 0.28% 108 60033 0.29% 109 60769 0.30% 110 62294 0.31% 111 65735 0.32% 112 68425 0.34% 113 70634 0.35% 114 74085 0.36% 115 74919 0.37% 116 76177 0.37% 117 77501 0.38% 118 78062 0.38% 119 78712 0.39% 120 80456 0.40% 121 83407 0.41% 122 85691 0.42% 123 88811 0.44% 124 91708 0.45% 125 93558 0.46% 126 95428 0.47% 127 95383 0.47% 128 96387 0.47% 129 98099 0.48% 130 98948 0.49% 131 101173 0.50% 132 105216 0.52% 133 109319 0.54% 134 111695 0.55% 135 116188 0.57% 136 119009 0.58% 137 122474 0.60% 138 126284 0.62% 139 128945 0.63% 140 133874 0.66% 141 142426 0.70% 142 152780 0.75% 143 163600 0.80% 144 184508 0.91% 145 211127 1.04% 146 255906 1.26% 147 317725 1.56% 148 462749 2.27% 149 883203 4.34% 150 4538506 22.29% 151 9003769 44.23% 20358236 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=5.24 fanout-score-rank=21 prefix-density=0.16 prefix-fanout=4.2 sequence=GTGATGGTCTTGCC criterion=fanout-score sequence-density=0.07 sequence-density-rank=13 fanout-score=497.38 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=37.7 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=30 prefix-density=0.33 prefix-fanout=2.3 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=651.70 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=20.0 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR5579255 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 23:39:08 Started mapping on | Dec 09 23:39:09 Finished on | Dec 09 23:50:33 Mapping speed, Million of reads per hour | 107.15 Number of input reads | 20358236 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 16503728 Uniquely mapped reads % | 81.07% Average mapped length | 287.10 Number of splices: Total | 17299390 Number of splices: Annotated (sjdb) | 16370346 Number of splices: GT/AG | 17072889 Number of splices: GC/AG | 201771 Number of splices: AT/AC | 12575 Number of splices: Non-canonical | 12155 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.01% Deletion average length | 1.32 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 190295 % of reads mapped to multiple loci | 0.93% Number of reads mapped to too many loci | 8182 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 17.71% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3689597 3689597 3689597 N_multimapping 190295 190295 190295 N_noFeature 489599 16018487 687447 N_ambiguous 323120 2256 36960 UnstrandedReadsAssigned:15691009 PositiveStrandReadsAssigned:482985 NegativeStrandReadsAssigned:15779321 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=144 echo kmer=139 SRR5579255 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579255-trimmed-pair1.fastq SRR5579255-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,358,236 reads, 16,006,689 reads pseudoaligned [quant] estimated average fragment length: 240.415 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,059 rounds 52973 SRR5579255.ke.tsv 35125 SRR5579255.se.tsv 88098 total ==> SRR5579255.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 697.245 62.1741 8.45529 PNS24247 1044 804.585 42.17 4.96976 PNS24249 1928 1688.58 135.545 7.61138 PNS24246 1044 804.585 42.17 4.96976 PNS24248 1044 804.585 42.17 4.96976 PNS24244 1471 1231.58 148.771 11.4541 PNS24243 293 111.28 0 0 KQK14069 1603 1363.58 4911.48 341.535 KQK14071 474 255.488 132.086 49.0218 ==> SRR5579255.se.tsv <== BRADI_1g14170v3 5637 BRADI_1g53295v3 59 BRADI_1g59795v3 342 BRADI_1g07683v3 0 BRADI_1g00485v3 74 BRADI_1g20270v3 1047 BRADI_1g74790v3 36 BRADI_1g09890v3 3 BRADI_1g77505v3 132 BRADI_1g48960v3 1 SRR5579255 completed mapping pipeline successfully