Starting /dee2/code/volunteer_pipeline.sh SRR5579256 current disk space = 1523265855488 free memory = 1602274040 SRR5579256 SRAfilesize 6fc390e26ac6de9b18b8da07475f2351 SRR5579256.sra SRR5579256.sra file validated SRR5579256 is paired end SRR5579256 is conventional basespace SRR5579256 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579256_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.88725 34.0 33.0 34.0 2.0 34.0 2 32.64825 34.0 33.0 34.0 28.0 34.0 3 32.867 34.0 33.0 34.0 31.0 34.0 4 33.14575 34.0 33.0 34.0 32.0 34.0 5 33.26875 34.0 33.0 34.0 33.0 34.0 6 36.94225 38.0 37.0 38.0 36.0 38.0 7 37.25475 38.0 38.0 38.0 36.0 38.0 8 37.3925 38.0 38.0 38.0 37.0 38.0 9 37.47725 38.0 38.0 38.0 37.0 38.0 10-14 37.4263 38.0 38.0 38.0 37.0 38.0 15-19 37.40935 38.0 38.0 38.0 37.0 38.0 20-24 37.394949999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.3718 38.0 38.0 38.0 37.0 38.0 30-34 37.300599999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.243750000000006 38.0 38.0 38.0 37.0 38.0 40-44 37.0912 38.0 38.0 38.0 36.0 38.0 45-49 37.04344999999999 38.0 38.0 38.0 36.0 38.0 50-54 37.00755 38.0 38.0 38.0 36.0 38.0 55-59 36.974199999999996 38.0 38.0 38.0 36.0 38.0 60-64 36.914249999999996 38.0 38.0 38.0 35.6 38.0 65-69 36.87275 38.0 38.0 38.0 35.0 38.0 70-74 36.8593 38.0 38.0 38.0 35.0 38.0 75-79 36.78435 38.0 38.0 38.0 35.0 38.0 80-84 36.7347 38.0 38.0 38.0 34.8 38.0 85-89 36.6308 38.0 38.0 38.0 34.4 38.0 90-94 36.54195 38.0 38.0 38.0 34.0 38.0 95-99 36.47095 38.0 38.0 38.0 34.0 38.0 100-104 36.26514999999999 38.0 37.8 38.0 33.6 38.0 105-109 36.237649999999995 38.0 37.8 38.0 33.8 38.0 110-114 35.9782 38.0 37.0 38.0 32.6 38.0 115-119 35.89305 38.0 36.8 38.0 32.4 38.0 120-124 35.74805 38.0 36.2 38.0 31.6 38.0 125-129 35.58390000000001 38.0 36.0 38.0 31.0 38.0 130-134 35.420399999999994 38.0 36.0 38.0 31.0 38.0 135-139 35.174 38.0 35.6 38.0 29.6 38.0 140-144 34.76635 38.0 35.0 38.0 27.8 38.0 145-149 34.30245000000001 38.0 35.0 38.0 26.4 38.0 150-151 31.0075 36.5 31.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 1.0 17 1.0 18 3.0 19 3.0 20 6.0 21 2.0 22 7.0 23 5.0 24 10.0 25 9.0 26 24.0 27 25.0 28 32.0 29 38.0 30 43.0 31 57.0 32 72.0 33 105.0 34 161.0 35 247.0 36 617.0 37 2527.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.22377622377623 13.79020979020979 9.762237762237762 32.22377622377623 2 23.599999999999998 18.85 35.125 22.425 3 22.525000000000002 24.575 26.125 26.775 4 27.875 30.325000000000003 19.35 22.45 5 25.074999999999996 33.074999999999996 21.349999999999998 20.5 6 21.25 34.425 21.55 22.775000000000002 7 16.950000000000003 20.7 40.300000000000004 22.05 8 18.7 21.725 26.625 32.95 9 21.975 19.7 30.25 28.075 10-14 22.785 26.340000000000003 24.240000000000002 26.634999999999998 15-19 23.13 25.75 25.180000000000003 25.94 20-24 22.655 25.785000000000004 25.605 25.955000000000002 25-29 23.51 25.555 25.019999999999996 25.915 30-34 23.674999999999997 25.39 25.235000000000003 25.7 35-39 23.445 25.240000000000002 25.355 25.96 40-44 23.925 25.46 24.865000000000002 25.75 45-49 24.255 25.369999999999997 24.85 25.525 50-54 23.685000000000002 25.295 25.069999999999997 25.95 55-59 23.72 25.145 24.795 26.340000000000003 60-64 23.68 25.319999999999997 25.185000000000002 25.814999999999998 65-69 23.810000000000002 24.865000000000002 25.195 26.13 70-74 23.74 25.165 25.165 25.929999999999996 75-79 23.91 25.224999999999998 24.755 26.11 80-84 24.03 24.86 24.97 26.14 85-89 24.02 24.765 25.095 26.119999999999997 90-94 24.015 24.9 24.685000000000002 26.400000000000002 95-99 24.22 25.590000000000003 24.145 26.045 100-104 24.37 25.03 24.81 25.790000000000003 105-109 24.72 24.895 24.865000000000002 25.52 110-114 24.42 24.884999999999998 25.005 25.69 115-119 24.62 24.86 24.325 26.195 120-124 24.19 25.335 24.610000000000003 25.865 125-129 24.445 25.135 24.605 25.814999999999998 130-134 24.735 25.290000000000003 24.515 25.46 135-139 24.305 25.81 24.42 25.465 140-144 24.64 25.169999999999998 24.37 25.82 145-149 24.175 25.535000000000004 24.42 25.869999999999997 150-151 24.425 25.387500000000003 23.4125 26.775 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.0 24 1.5 25 1.0 26 1.0 27 1.0 28 2.5 29 8.5 30 10.5 31 8.5 32 9.0 33 14.0 34 22.0 35 35.0 36 51.0 37 70.5 38 83.0 39 89.0 40 109.5 41 150.0 42 170.5 43 173.5 44 184.0 45 182.0 46 183.0 47 183.0 48 188.0 49 179.5 50 165.5 51 157.0 52 144.0 53 125.0 54 104.5 55 113.5 56 116.5 57 97.5 58 87.5 59 94.5 60 84.5 61 76.0 62 69.0 63 55.0 64 58.5 65 51.0 66 40.5 67 39.5 68 34.5 69 33.0 70 28.0 71 23.5 72 24.0 73 17.5 74 14.5 75 13.0 76 8.0 77 4.0 78 3.0 79 2.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 10.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.725 0.0 0.0 0.0 0.0 96-97 0.8375 0.0 0.0 0.0 0.0 98-99 1.025 0.0 0.0 0.0 0.0 100-101 1.1875 0.0 0.0 0.0 0.0 102-103 1.45 0.0 0.0 0.0 0.0 104-105 1.775 0.0 0.0 0.0 0.0 106-107 1.9875 0.0 0.0 0.0 0.0 108-109 2.25 0.0 0.0 0.0 0.0 110-111 2.5250000000000004 0.0 0.0 0.0 0.0 112-113 2.8375000000000004 0.0 0.0 0.0 0.0 114-115 3.0999999999999996 0.0 0.0 0.0 0.0 116-117 3.4625000000000004 0.0 0.0 0.0 0.0 118-119 3.7625 0.0 0.0 0.0 0.0 120-121 4.1125 0.0 0.0 0.0 0.0 122-123 4.5875 0.0 0.0 0.0 0.0 124-125 5.074999999999999 0.0 0.0 0.0 0.0 126-127 5.5625 0.0 0.0 0.0 0.0 128-129 6.1125 0.0 0.0 0.0 0.0 130-131 6.6125 0.0 0.0 0.0 0.0 132-133 7.1375 0.0 0.0 0.0 0.0 134-135 7.6625 0.0 0.0 0.0 0.0 136-137 8.3625 0.0 0.0 0.0 0.0 138-139 9.087499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCAGCA 10 0.0068484643 144.875 145 >>END_MODULE SRR5579256 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579256_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.72225 33.0 33.0 34.0 32.0 34.0 2 32.78825 33.0 33.0 34.0 32.0 34.0 3 32.849 34.0 33.0 34.0 32.0 34.0 4 32.75125 34.0 33.0 34.0 32.0 34.0 5 32.85225 34.0 33.0 34.0 32.0 34.0 6 36.96425 38.0 38.0 38.0 36.0 38.0 7 36.87725 38.0 38.0 38.0 36.0 38.0 8 36.90025 38.0 38.0 38.0 36.0 38.0 9 36.9155 38.0 38.0 38.0 36.0 38.0 10-14 36.90055 38.0 38.0 38.0 36.0 38.0 15-19 36.888549999999995 38.0 38.0 38.0 36.0 38.0 20-24 36.8095 38.0 38.0 38.0 36.0 38.0 25-29 36.7388 38.0 38.0 38.0 36.0 38.0 30-34 36.7228 38.0 38.0 38.0 35.8 38.0 35-39 36.792899999999996 38.0 38.0 38.0 36.0 38.0 40-44 36.743300000000005 38.0 38.0 38.0 36.0 38.0 45-49 36.712 38.0 38.0 38.0 35.6 38.0 50-54 36.655899999999995 38.0 38.0 38.0 35.2 38.0 55-59 36.678250000000006 38.0 38.0 38.0 35.8 38.0 60-64 36.6226 38.0 38.0 38.0 35.2 38.0 65-69 36.49855 38.0 38.0 38.0 35.0 38.0 70-74 36.45555 38.0 38.0 38.0 34.4 38.0 75-79 36.42345 38.0 38.0 38.0 34.4 38.0 80-84 36.3642 38.0 38.0 38.0 34.2 38.0 85-89 36.2115 38.0 38.0 38.0 34.0 38.0 90-94 35.6649 38.0 37.2 38.0 31.4 38.0 95-99 35.83645 38.0 38.0 38.0 32.8 38.0 100-104 35.709799999999994 38.0 37.6 38.0 31.6 38.0 105-109 35.69805 38.0 37.8 38.0 32.2 38.0 110-114 35.63545 38.0 37.6 38.0 32.0 38.0 115-119 35.552800000000005 38.0 37.4 38.0 31.4 38.0 120-124 35.415499999999994 38.0 37.0 38.0 31.2 38.0 125-129 35.11475 38.0 36.0 38.0 29.6 38.0 130-134 34.9366 38.0 36.0 38.0 28.2 38.0 135-139 34.536199999999994 38.0 35.4 38.0 26.2 38.0 140-144 34.0368 38.0 35.0 38.0 23.0 38.0 145-149 33.2143 38.0 33.8 38.0 17.8 38.0 150-151 28.91975 35.5 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 4.0 4 4.0 5 2.0 6 3.0 7 0.0 8 4.0 9 2.0 10 1.0 11 4.0 12 2.0 13 7.0 14 2.0 15 4.0 16 3.0 17 5.0 18 1.0 19 9.0 20 6.0 21 13.0 22 13.0 23 10.0 24 16.0 25 18.0 26 32.0 27 29.0 28 31.0 29 39.0 30 39.0 31 64.0 32 78.0 33 105.0 34 156.0 35 259.0 36 466.0 37 2557.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.800000000000004 14.374999999999998 10.7 29.125 2 27.85 21.625 29.5 21.025 3 24.525 24.425 25.6 25.45 4 28.249999999999996 31.75 17.424999999999997 22.575 5 26.900000000000002 32.875 19.125 21.099999999999998 6 21.75 35.099999999999994 19.15 24.0 7 20.275000000000002 16.05 38.35 25.324999999999996 8 21.85 20.225 23.400000000000002 34.525 9 24.775 20.1 25.25 29.875 10-14 25.845000000000002 25.540000000000003 22.95 25.665 15-19 26.029999999999998 24.695 23.74 25.535000000000004 20-24 25.895000000000003 24.93 23.599999999999998 25.575 25-29 26.474999999999998 24.67 23.865 24.990000000000002 30-34 25.855 25.355 23.71 25.080000000000002 35-39 26.040000000000003 24.82 23.380000000000003 25.759999999999998 40-44 26.05 24.545 24.529999999999998 24.875 45-49 26.08 24.705 24.044999999999998 25.169999999999998 50-54 25.724999999999998 25.395 24.060000000000002 24.82 55-59 25.485000000000003 25.380000000000003 24.42 24.715 60-64 26.345000000000002 23.97 24.485 25.2 65-69 25.740000000000002 24.295 24.665 25.3 70-74 26.400000000000002 24.435000000000002 24.785 24.38 75-79 26.085 24.935 24.25 24.73 80-84 25.825 24.525 24.86 24.79 85-89 26.02 24.98 24.445 24.555 90-94 26.08 24.505 24.43 24.985 95-99 25.69 25.825 23.74 24.745 100-104 26.825 25.064999999999998 23.615 24.495 105-109 26.245 25.27 24.59 23.895 110-114 26.265 24.975 24.145 24.615000000000002 115-119 26.935 24.665 24.575 23.825 120-124 26.645000000000003 25.569999999999997 23.825 23.96 125-129 27.195000000000004 25.419999999999998 24.0 23.385 130-134 27.58 25.490000000000002 24.315 22.615 135-139 27.49 24.92 24.15 23.44 140-144 27.6 25.419999999999998 23.995 22.985 145-149 27.905 25.535000000000004 23.74 22.82 150-151 27.8625 26.8625 22.900000000000002 22.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 0.0 27 1.0 28 2.0 29 2.5 30 7.5 31 9.5 32 9.0 33 13.0 34 25.0 35 34.0 36 37.0 37 40.5 38 59.0 39 85.0 40 98.0 41 119.0 42 142.5 43 152.5 44 165.0 45 175.5 46 173.5 47 184.0 48 190.5 49 177.0 50 159.0 51 139.0 52 137.0 53 130.0 54 110.0 55 103.5 56 100.5 57 95.5 58 96.5 59 103.0 60 96.0 61 90.5 62 87.5 63 76.5 64 68.5 65 70.0 66 67.0 67 58.0 68 55.5 69 56.0 70 53.0 71 46.0 72 32.0 73 21.0 74 15.5 75 7.5 76 6.5 77 6.5 78 4.5 79 1.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26693629929221 98.175 2 0.6066734074823054 1.2 3 0.05055611729019212 0.15 4 0.0 0.0 5 0.02527805864509606 0.125 6 0.0 0.0 7 0.05055611729019212 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 7 0.17500000000000002 No Hit CTCTTGTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCG 7 0.17500000000000002 No Hit GTTAGCTATCTACGTACGTGTACGATGGCTCCCACAGTGATGTCGTCAGC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 1.05 0.0 0.0 0.0 0.0 100-101 1.1875 0.0 0.0 0.0 0.0 102-103 1.45 0.0 0.0 0.0 0.0 104-105 1.825 0.0 0.0 0.0 0.0 106-107 2.0375 0.0 0.0 0.0 0.0 108-109 2.325 0.0 0.0 0.0 0.0 110-111 2.5999999999999996 0.0 0.0 0.0 0.0 112-113 2.9124999999999996 0.0 0.0 0.0 0.0 114-115 3.1875 0.0 0.0 0.0 0.0 116-117 3.5625 0.0 0.0 0.0 0.0 118-119 3.8625 0.0 0.0 0.0 0.0 120-121 4.175000000000001 0.0 0.0 0.0 0.0 122-123 4.65 0.0 0.0 0.0 0.0 124-125 5.125 0.0 0.0 0.0 0.0 126-127 5.625 0.0 0.0 0.0 0.0 128-129 6.2 0.0 0.0 0.0 0.0 130-131 6.675000000000001 0.0 0.0 0.0 0.0 132-133 7.1875 0.0 0.0 0.0 0.0 134-135 7.75 0.0 0.0 0.0 0.0 136-137 8.412500000000001 0.0 0.0 0.0 0.0 138-139 9.087499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1192217 spots for SRR5579256.sra Written 1192217 spots for SRR5579256.sra Read 1192217 spots for SRR5579256.sra Written 1192217 spots for SRR5579256.sra Read 1192217 spots for SRR5579256.sra Written 1192217 spots for SRR5579256.sra Read 1192217 spots for SRR5579256.sra Written 1192217 spots for SRR5579256.sra Read 1192217 spots for SRR5579256.sra Written 1192217 spots for SRR5579256.sra Read 1192217 spots for SRR5579256.sra Written 1192217 spots for SRR5579256.sra Read 1192217 spots for SRR5579256.sra Written 1192217 spots for SRR5579256.sra Read 1192217 spots for SRR5579256.sra Written 1192217 spots for SRR5579256.sra Read 1192217 spots for SRR5579256.sra Written 1192217 spots for SRR5579256.sra Read 1192217 spots for SRR5579256.sra Written 1192217 spots for SRR5579256.sra Read 1192223 spots for SRR5579256.sra Written 1192223 spots for SRR5579256.sra Read 1192217 spots for SRR5579256.sra Written 1192217 spots for SRR5579256.sra Read 1192217 spots for SRR5579256.sra Written 1192217 spots for SRR5579256.sra Read 1192217 spots for SRR5579256.sra Written 1192217 spots for SRR5579256.sra Read 1192217 spots for SRR5579256.sra Written 1192217 spots for SRR5579256.sra Read 1192217 spots for SRR5579256.sra Written 1192217 spots for SRR5579256.sra Read 1192217 spots for SRR5579256.sra Written 1192217 spots for SRR5579256.sra Read 1192217 spots for SRR5579256.sra Written 1192217 spots for SRR5579256.sra Read 1192217 spots for SRR5579256.sra Written 1192217 spots for SRR5579256.sra Read 1192217 spots for SRR5579256.sra Written 1192217 spots for SRR5579256.sra SRR ids: ['SRR5579256.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7zlkkncd SRR5579256.sra spots: 23844346 blocks: [[1, 1192217], [1192218, 2384434], [2384435, 3576651], [3576652, 4768868], [4768869, 5961085], [5961086, 7153302], [7153303, 8345519], [8345520, 9537736], [9537737, 10729953], [10729954, 11922170], [11922171, 13114387], [13114388, 14306604], [14306605, 15498821], [15498822, 16691038], [16691039, 17883255], [17883256, 19075472], [19075473, 20267689], [20267690, 21459906], [21459907, 22652123], [22652124, 23844346]] SRR5579256 file size 8058366 SRR5579256 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579256 SRR5579256_1.fastq SRR5579256_2.fastq Input file: SRR5579256_1.fastq Paired file: SRR5579256_2.fastq trimmed: SRR5579256-trimmed-pair1.fastq, SRR5579256-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 23:42:05 2024 >> started Mon Dec 9 23:42:33 2024 >> done (27.146s) 23844346 read pairs processed; of these: 41386 ( 0.17%) short read pairs filtered out after trimming by size control 34667 ( 0.15%) empty read pairs filtered out after trimming by size control 23768293 (99.68%) read pairs available; of these: 9958405 (41.90%) trimmed read pairs available after processing 13809888 (58.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 10 0.00% 20 13 0.00% 21 19 0.00% 22 12 0.00% 23 14 0.00% 24 20 0.00% 25 9 0.00% 26 9 0.00% 27 22 0.00% 28 14 0.00% 29 18 0.00% 30 23 0.00% 31 17 0.00% 32 20 0.00% 33 29 0.00% 34 19 0.00% 35 73 0.00% 36 51 0.00% 37 25 0.00% 38 35 0.00% 39 48 0.00% 40 56 0.00% 41 56 0.00% 42 35 0.00% 43 57 0.00% 44 67 0.00% 45 70 0.00% 46 84 0.00% 47 92 0.00% 48 95 0.00% 49 116 0.00% 50 130 0.00% 51 140 0.00% 52 142 0.00% 53 197 0.00% 54 207 0.00% 55 205 0.00% 56 239 0.00% 57 294 0.00% 58 340 0.00% 59 365 0.00% 60 408 0.00% 61 517 0.00% 62 571 0.00% 63 617 0.00% 64 691 0.00% 65 769 0.00% 66 898 0.00% 67 967 0.00% 68 1108 0.00% 69 1481 0.01% 70 1724 0.01% 71 1748 0.01% 72 2031 0.01% 73 2247 0.01% 74 2470 0.01% 75 2829 0.01% 76 3117 0.01% 77 3541 0.01% 78 3927 0.02% 79 4456 0.02% 80 5110 0.02% 81 5794 0.02% 82 6565 0.03% 83 7480 0.03% 84 9764 0.04% 85 11217 0.05% 86 11699 0.05% 87 12170 0.05% 88 12918 0.05% 89 13741 0.06% 90 14790 0.06% 91 16217 0.07% 92 17313 0.07% 93 18636 0.08% 94 20066 0.08% 95 21085 0.09% 96 22170 0.09% 97 23162 0.10% 98 24341 0.10% 99 26342 0.11% 100 27598 0.12% 101 29641 0.12% 102 31484 0.13% 103 33219 0.14% 104 34714 0.15% 105 36481 0.15% 106 37761 0.16% 107 38813 0.16% 108 40559 0.17% 109 41976 0.18% 110 43209 0.18% 111 45715 0.19% 112 48106 0.20% 113 50183 0.21% 114 52793 0.22% 115 54607 0.23% 116 55983 0.24% 117 57218 0.24% 118 58543 0.25% 119 59682 0.25% 120 62338 0.26% 121 64491 0.27% 122 66675 0.28% 123 70600 0.30% 124 72466 0.30% 125 74978 0.32% 126 77521 0.33% 127 78265 0.33% 128 79832 0.34% 129 82187 0.35% 130 83769 0.35% 131 86215 0.36% 132 91328 0.38% 133 94441 0.40% 134 97655 0.41% 135 102383 0.43% 136 105889 0.45% 137 108705 0.46% 138 112255 0.47% 139 116866 0.49% 140 122589 0.52% 141 128820 0.54% 142 138570 0.58% 143 149838 0.63% 144 165382 0.70% 145 187599 0.79% 146 222552 0.94% 147 283841 1.19% 148 401190 1.69% 149 746428 3.14% 150 4464258 18.78% 151 13809888 58.10% 23768293 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=25 prefix-density=0.73 prefix-fanout=2.0 sequence=TAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=26 fanout-score=13.73 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=2.8 sequence=AGCTTGAGGGTGTAGCTGGCGACTTGCTCAGGGGTGGCCCGCTCCTTGCACTCGGCGCCGGGTGTCACCATGCTGGGCTTGAGGAGGATGCCCTCGAACAAGACGTTGTTCTGGGCCATGTAGTAGAAAGTCTCCGCCCACACCTTCTGCGCCACCTCGAAGGTCCTGTCGATGCCGTGCTCGCCGTCCAGCAGGATCTCCGGCTCCACAATCGGCACCAGACCGTTGTCCTGAGAGATGGCAGCGTAACGGGCAAGACCCCATGCAGCTTCCTTGACAGCAAGCTCAGATGGGCCGTTGGGGATGCTGACGACAGTGCGCCACTTGGCGAAGCGGGCGCCTTGCTGGTAGTAGGCTGCCTCACGGGAGGCAAGGCCATCAAGACCTTGGCACCATGACTCGTCGTTGGAACCAACGAGTGGCACAAGACCCTTGTCAACCTTGATGCCGGGAACGATTCCCTGCTCGACAAGGATGTCAACAATCTTCTTGCCATCAACAGTCGATTGGT criterion=sequence-density sequence-density=0.73 sequence-density-rank=1 fanout-score=3.61 fanout-score-rank=21 prefix-density=0.80 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=99.53 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=7.0 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAATACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR5579256 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 23:43:20 Started mapping on | Dec 09 23:43:20 Finished on | Dec 09 23:46:42 Mapping speed, Million of reads per hour | 423.59 Number of input reads | 23768293 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 22295300 Uniquely mapped reads % | 93.80% Average mapped length | 292.64 Number of splices: Total | 24896417 Number of splices: Annotated (sjdb) | 23450973 Number of splices: GT/AG | 24562772 Number of splices: GC/AG | 306059 Number of splices: AT/AC | 11921 Number of splices: Non-canonical | 15665 Mismatch rate per base, % | 0.10% Deletion rate per base | 0.00% Deletion average length | 1.37 Insertion rate per base | 0.00% Insertion average length | 1.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 307414 % of reads mapped to multiple loci | 1.29% Number of reads mapped to too many loci | 35678 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.84% % of reads unmapped: other | 0.92% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1192510 1192510 1192510 N_multimapping 307414 307414 307414 N_noFeature 861477 21661205 1076141 N_ambiguous 505316 3595 86453 UnstrandedReadsAssigned:20928507 PositiveStrandReadsAssigned:630500 NegativeStrandReadsAssigned:21132706 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR5579256 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579256-trimmed-pair1.fastq SRR5579256-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,768,293 reads, 21,305,076 reads pseudoaligned [quant] estimated average fragment length: 255.624 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,157 rounds 52973 SRR5579256.ke.tsv 35125 SRR5579256.se.tsv 88098 total ==> SRR5579256.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 681.961 0 0 PNS24247 1044 789.376 77.7731 6.70017 PNS24249 1928 1673.38 98.1527 3.98886 PNS24246 1044 789.376 77.7731 6.70017 PNS24248 1044 789.376 77.7731 6.70017 PNS24244 1471 1216.38 100.528 5.62031 PNS24243 293 99.4688 0 0 KQK14069 1603 1348.38 5375.1 271.091 KQK14071 474 240.484 181.316 51.2734 ==> SRR5579256.se.tsv <== BRADI_1g14170v3 6221 BRADI_1g53295v3 168 BRADI_1g59795v3 391 BRADI_1g07683v3 0 BRADI_1g00485v3 40 BRADI_1g20270v3 2698 BRADI_1g74790v3 211 BRADI_1g09890v3 3 BRADI_1g77505v3 341 BRADI_1g48960v3 0 SRR5579256 completed mapping pipeline successfully