Starting /dee2/code/volunteer_pipeline.sh SRR5579257 current disk space = 1523277254656 free memory = 1392573236 SRR5579257 SRAfilesize 9bfb7aa783a9e8326a6754f6106571f7 SRR5579257.sra SRR5579257.sra file validated SRR5579257 is paired end SRR5579257 is conventional basespace SRR5579257 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579257_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.3775 34.0 33.0 34.0 31.0 34.0 2 32.8165 34.0 33.0 34.0 30.0 34.0 3 32.94875 34.0 33.0 34.0 32.0 34.0 4 33.06975 34.0 33.0 34.0 32.0 34.0 5 32.99 34.0 33.0 34.0 32.0 34.0 6 36.895 38.0 37.0 38.0 35.0 38.0 7 37.1665 38.0 38.0 38.0 36.0 38.0 8 37.24625 38.0 38.0 38.0 36.0 38.0 9 37.397 38.0 38.0 38.0 37.0 38.0 10-14 37.2779 38.0 38.0 38.0 37.0 38.0 15-19 37.30425 38.0 38.0 38.0 37.0 38.0 20-24 37.182849999999995 38.0 38.0 38.0 36.6 38.0 25-29 37.08645 38.0 38.0 38.0 36.4 38.0 30-34 36.98965 38.0 38.0 38.0 36.0 38.0 35-39 36.757400000000004 38.0 38.0 38.0 35.0 38.0 40-44 36.71355 38.0 38.0 38.0 35.0 38.0 45-49 36.612399999999994 38.0 38.0 38.0 34.4 38.0 50-54 37.052 38.0 38.0 38.0 36.0 38.0 55-59 36.87975 38.0 38.0 38.0 35.4 38.0 60-64 36.93305 38.0 38.0 38.0 35.6 38.0 65-69 36.303 38.0 38.0 38.0 33.2 38.0 70-74 36.6207 38.0 38.0 38.0 34.4 38.0 75-79 36.596199999999996 38.0 38.0 38.0 34.6 38.0 80-84 36.34394999999999 38.0 38.0 38.0 33.6 38.0 85-89 36.429649999999995 38.0 38.0 38.0 34.0 38.0 90-94 36.206100000000006 38.0 37.8 38.0 33.6 38.0 95-99 36.193900000000006 38.0 38.0 38.0 33.2 38.0 100-104 35.80385 38.0 37.0 38.0 32.2 38.0 105-109 35.6996 38.0 36.8 38.0 30.8 38.0 110-114 35.4353 38.0 36.0 38.0 29.6 38.0 115-119 35.0789 38.0 35.8 38.0 27.8 38.0 120-124 34.83805 38.0 35.0 38.0 27.2 38.0 125-129 33.952149999999996 38.0 34.2 38.0 22.8 38.0 130-134 34.424099999999996 38.0 34.6 38.0 25.4 38.0 135-139 34.116150000000005 38.0 34.2 38.0 23.4 38.0 140-144 34.038599999999995 38.0 33.8 38.0 24.0 38.0 145-149 33.049150000000004 38.0 33.0 38.0 17.8 38.0 150-151 28.421125 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 3.0 15 2.0 16 3.0 17 4.0 18 4.0 19 4.0 20 6.0 21 7.0 22 9.0 23 15.0 24 22.0 25 11.0 26 26.0 27 39.0 28 42.0 29 49.0 30 66.0 31 60.0 32 121.0 33 136.0 34 184.0 35 333.0 36 739.0 37 2112.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.01324503311258 14.463576158940397 10.039735099337749 29.48344370860927 2 24.575 20.225 32.800000000000004 22.400000000000002 3 20.925 26.05 24.425 28.599999999999998 4 26.0 32.025 20.45 21.525 5 25.113008538422903 34.856855851330984 21.496735308890006 18.533400301356103 6 21.25 33.775 23.125 21.85 7 18.575 18.75 40.925 21.75 8 20.974999999999998 20.849999999999998 27.875 30.3 9 21.275 19.2 30.049999999999997 29.475 10-14 23.035 26.72 24.87 25.374999999999996 15-19 23.369999999999997 25.41 25.474999999999998 25.745 20-24 22.875 25.81 25.295 26.02 25-29 23.710927731932983 25.4913728432108 25.171292823205803 25.626406601650416 30-34 23.549999999999997 25.779999999999998 25.319999999999997 25.35 35-39 23.21 25.264999999999997 25.515 26.009999999999998 40-44 24.035 25.419999999999998 25.319999999999997 25.224999999999998 45-49 24.175 25.264999999999997 24.834999999999997 25.724999999999998 50-54 23.5 25.724999999999998 25.650000000000002 25.124999999999996 55-59 23.82 25.765 25.45 24.965 60-64 23.255 25.95 25.095 25.7 65-69 23.49 25.69 25.3 25.52 70-74 24.065 25.105 25.5 25.330000000000002 75-79 23.68 25.31 25.055 25.955000000000002 80-84 23.849999999999998 25.295 25.319999999999997 25.535000000000004 85-89 23.73 26.16 24.85 25.259999999999998 90-94 23.875 25.69 25.145 25.290000000000003 95-99 24.154999999999998 25.46 25.014999999999997 25.369999999999997 100-104 24.04 25.255 25.105 25.6 105-109 24.435000000000002 25.34 24.595 25.629999999999995 110-114 24.465 25.8 24.44 25.295 115-119 24.853728059208883 25.453818072710906 24.37365604840726 25.31879781967295 120-124 23.830000000000002 25.979999999999997 24.104999999999997 26.085 125-129 24.72370855628344 25.51382707406111 24.113617042556385 25.648847327099066 130-134 24.77 25.035 24.25 25.945 135-139 23.932179653896167 25.772731819545864 24.037211163349003 26.257877363208966 140-144 24.293644046606993 25.738860829124366 24.318647797169575 25.648847327099066 145-149 24.519807923169267 25.660264105642256 24.034613845538217 25.78531412565026 150-151 24.0090033762661 25.959734900587723 24.059022133299987 25.97223958984619 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 3.0 26 3.0 27 2.5 28 4.0 29 6.0 30 5.5 31 9.5 32 16.0 33 21.0 34 27.0 35 32.0 36 42.0 37 67.5 38 93.0 39 108.5 40 116.0 41 132.5 42 173.0 43 190.5 44 178.0 45 186.5 46 203.5 47 198.0 48 174.0 49 170.5 50 156.5 51 142.0 52 161.0 53 149.0 54 132.0 55 118.0 56 98.5 57 86.0 58 80.0 59 75.5 60 80.5 61 87.0 62 72.0 63 61.5 64 65.0 65 53.5 66 43.5 67 39.5 68 29.5 69 28.5 70 22.5 71 16.5 72 14.5 73 8.0 74 4.5 75 3.5 76 1.0 77 1.5 78 1.5 79 1.5 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.625 2 0.0 3 0.0 4 0.0 5 0.44999999999999996 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.025 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.015 120-124 0.0 125-129 0.015 130-134 0.0 135-139 0.03 140-144 0.015 145-149 0.04 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.07500000000000001 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.6 0.0 0.0 0.0 0.0 88-89 0.6875 0.0 0.0 0.0 0.0 90-91 0.8500000000000001 0.0 0.0 0.0 0.0 92-93 1.075 0.0 0.0 0.0 0.0 94-95 1.4125 0.0 0.0 0.0 0.0 96-97 1.85 0.0 0.0 0.0 0.0 98-99 2.2 0.0 0.0 0.0 0.0 100-101 2.5250000000000004 0.0 0.0 0.0 0.0 102-103 2.9375 0.0 0.0 0.0 0.0 104-105 3.2625 0.0 0.0 0.0 0.0 106-107 3.6875 0.0 0.0 0.0 0.0 108-109 4.125 0.0 0.0 0.0 0.0 110-111 4.65 0.0 0.0 0.0 0.0 112-113 5.2875 0.0 0.0 0.0 0.0 114-115 5.862500000000001 0.0 0.0 0.0 0.0 116-117 6.35 0.0 0.0 0.0 0.0 118-119 6.85 0.0 0.0 0.0 0.0 120-121 7.4125 0.0 0.0 0.0 0.0 122-123 8.05 0.0 0.0 0.0 0.0 124-125 8.8875 0.0 0.0 0.0 0.0 126-127 9.6875 0.0 0.0 0.0 0.0 128-129 10.7625 0.0 0.0 0.0 0.0 130-131 11.5125 0.0 0.0 0.0 0.0 132-133 12.2 0.0 0.0 0.0 0.0 134-135 12.9125 0.0 0.0 0.0 0.0 136-137 13.825 0.0 0.0 0.0 0.0 138-139 14.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTCTT 10 0.0068378756 144.95 9 >>END_MODULE SRR5579257 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579257_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.45 33.0 33.0 34.0 32.0 34.0 2 32.6225 33.0 33.0 34.0 32.0 34.0 3 32.7245 33.0 33.0 34.0 32.0 34.0 4 32.61825 34.0 33.0 34.0 32.0 34.0 5 32.72625 34.0 33.0 34.0 32.0 34.0 6 36.70375 38.0 38.0 38.0 35.0 38.0 7 36.8005 38.0 38.0 38.0 36.0 38.0 8 36.6275 38.0 38.0 38.0 35.0 38.0 9 36.33475 38.0 38.0 38.0 34.0 38.0 10-14 36.64825 38.0 38.0 38.0 34.6 38.0 15-19 36.73395 38.0 38.0 38.0 35.4 38.0 20-24 36.67835 38.0 38.0 38.0 35.2 38.0 25-29 36.50415 38.0 38.0 38.0 34.8 38.0 30-34 36.53675 38.0 38.0 38.0 34.6 38.0 35-39 36.63035 38.0 38.0 38.0 35.0 38.0 40-44 36.6801 38.0 38.0 38.0 35.6 38.0 45-49 36.64645 38.0 38.0 38.0 35.4 38.0 50-54 36.544200000000004 38.0 38.0 38.0 35.0 38.0 55-59 36.5501 38.0 38.0 38.0 34.8 38.0 60-64 36.572449999999996 38.0 38.0 38.0 35.0 38.0 65-69 36.27515 38.0 38.0 38.0 33.8 38.0 70-74 35.8728 38.0 38.0 38.0 32.0 38.0 75-79 35.71055 38.0 37.6 38.0 31.2 38.0 80-84 35.77725 38.0 38.0 38.0 31.0 38.0 85-89 35.8654 38.0 38.0 38.0 32.8 38.0 90-94 35.853300000000004 38.0 38.0 38.0 33.0 38.0 95-99 35.787349999999996 38.0 37.6 38.0 32.6 38.0 100-104 35.57855 38.0 37.0 38.0 31.0 38.0 105-109 35.345 38.0 36.8 38.0 29.8 38.0 110-114 34.8806 38.0 35.8 38.0 27.6 38.0 115-119 34.537 38.0 35.2 38.0 25.4 38.0 120-124 33.83455 38.0 34.6 38.0 20.6 38.0 125-129 33.10795 38.0 33.2 38.0 16.2 38.0 130-134 33.09715 38.0 33.0 38.0 17.0 38.0 135-139 32.409000000000006 38.0 32.6 38.0 13.0 38.0 140-144 31.808699999999998 38.0 32.0 38.0 10.4 38.0 145-149 29.90025 37.6 28.8 38.0 2.0 38.0 150-151 24.168750000000003 31.0 13.5 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 8.0 4 2.0 5 2.0 6 2.0 7 2.0 8 2.0 9 0.0 10 1.0 11 6.0 12 2.0 13 1.0 14 4.0 15 10.0 16 5.0 17 9.0 18 5.0 19 12.0 20 9.0 21 14.0 22 9.0 23 25.0 24 18.0 25 30.0 26 29.0 27 35.0 28 59.0 29 60.0 30 57.0 31 103.0 32 124.0 33 149.0 34 239.0 35 350.0 36 689.0 37 1914.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.925 15.225 11.175 27.675 2 27.6 21.175 29.225 22.0 3 22.6 24.125 28.125 25.15 4 28.375 31.175000000000004 17.75 22.7 5 27.400000000000002 33.900000000000006 18.625 20.075000000000003 6 20.724999999999998 34.275 20.849999999999998 24.15 7 21.224999999999998 15.325 38.375 25.074999999999996 8 20.849999999999998 20.474999999999998 25.525 33.15 9 22.400000000000002 21.525 27.375 28.7 10-14 25.71 25.480000000000004 23.605 25.205 15-19 25.605 24.39 24.505 25.5 20-24 25.4 24.89 24.54 25.169999999999998 25-29 25.395 25.314999999999998 24.185000000000002 25.105 30-34 25.595000000000002 25.014999999999997 24.235 25.155 35-39 25.205 25.06 24.5 25.235000000000003 40-44 25.929999999999996 24.575 24.89 24.605 45-49 25.495 24.915000000000003 24.27 25.319999999999997 50-54 25.650000000000002 24.77 24.705 24.875 55-59 25.900000000000002 25.169999999999998 24.625 24.305 60-64 25.6 25.25 24.445 24.705 65-69 25.474999999999998 25.71 24.465 24.349999999999998 70-74 26.064999999999998 25.245 24.43 24.26 75-79 26.05 24.925 25.095 23.93 80-84 26.22 24.975 24.295 24.51 85-89 26.640000000000004 24.75 24.33 24.279999999999998 90-94 26.35 24.834999999999997 24.92 23.895 95-99 26.13 25.195 24.645 24.03 100-104 26.085 26.27 24.11 23.535 105-109 26.695 25.135 24.725 23.445 110-114 26.695 25.3 24.575 23.43 115-119 27.084999999999997 25.965 23.73 23.22 120-124 27.13 25.615 24.349999999999998 22.905 125-129 27.279999999999998 25.795 24.044999999999998 22.88 130-134 27.595 25.605 24.115000000000002 22.685 135-139 27.92 26.025 23.9 22.155 140-144 28.095 25.665 24.16 22.08 145-149 28.07 26.27 23.595 22.065 150-151 29.8875 26.087500000000002 22.8 21.224999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 2.0 26 2.0 27 0.0 28 1.0 29 3.5 30 6.0 31 8.5 32 11.5 33 12.0 34 15.0 35 21.5 36 33.5 37 44.5 38 56.0 39 76.0 40 107.5 41 134.5 42 150.5 43 157.5 44 154.0 45 173.0 46 187.0 47 189.5 48 208.5 49 194.0 50 161.0 51 156.0 52 157.5 53 138.5 54 123.0 55 121.5 56 109.5 57 92.5 58 89.5 59 102.0 60 97.5 61 85.5 62 87.0 63 77.5 64 70.0 65 65.0 66 60.5 67 56.0 68 42.5 69 39.5 70 34.5 71 25.5 72 16.5 73 10.0 74 6.5 75 6.5 76 6.5 77 3.0 78 2.5 79 1.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77443609022556 99.52499999999999 2 0.20050125313283207 0.4 3 0.02506265664160401 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0125 0.0 0.0 32-33 0.0 0.0 0.025 0.0 0.0 34-35 0.0 0.0 0.025 0.0 0.0 36-37 0.0 0.0 0.025 0.0 0.0 38-39 0.0 0.0 0.025 0.0 0.0 40-41 0.0 0.0 0.025 0.0 0.0 42-43 0.0 0.0 0.025 0.0 0.0 44-45 0.0 0.0 0.025 0.0 0.0 46-47 0.0 0.0 0.025 0.0 0.0 48-49 0.0 0.0 0.025 0.0 0.0 50-51 0.0 0.0 0.025 0.0 0.0 52-53 0.0 0.0 0.025 0.0 0.0 54-55 0.0 0.0 0.025 0.0 0.0 56-57 0.0 0.0 0.025 0.0 0.0 58-59 0.0 0.0 0.025 0.0 0.0 60-61 0.0 0.0 0.025 0.0 0.0 62-63 0.0 0.0 0.025 0.0 0.0 64-65 0.0 0.0 0.025 0.0 0.0 66-67 0.0 0.0 0.025 0.0 0.0 68-69 0.025 0.0 0.025 0.0 0.0 70-71 0.025 0.0 0.025 0.0 0.0 72-73 0.07500000000000001 0.0 0.025 0.0 0.0 74-75 0.125 0.0 0.025 0.0 0.0 76-77 0.1875 0.0 0.025 0.0 0.0 78-79 0.25 0.0 0.025 0.0 0.0 80-81 0.3625 0.0 0.025 0.0 0.0 82-83 0.3875 0.0 0.025 0.0 0.0 84-85 0.525 0.0 0.025 0.0 0.0 86-87 0.575 0.0 0.025 0.0 0.0 88-89 0.6625000000000001 0.0 0.025 0.0 0.0 90-91 0.8375 0.0 0.025 0.0 0.0 92-93 1.075 0.0 0.025 0.0 0.0 94-95 1.4125 0.0 0.025 0.0 0.0 96-97 1.875 0.0 0.025 0.0 0.0 98-99 2.2125 0.0 0.025 0.0 0.0 100-101 2.55 0.0 0.025 0.0 0.0 102-103 2.975 0.0 0.025 0.0 0.0 104-105 3.3 0.0 0.025 0.0 0.0 106-107 3.8125 0.0 0.025 0.0 0.0 108-109 4.2875 0.0 0.025 0.0 0.0 110-111 4.8375 0.0 0.025 0.0 0.0 112-113 5.4875 0.0 0.025 0.0 0.0 114-115 6.0875 0.0 0.025 0.0 0.0 116-117 6.6 0.0 0.025 0.0 0.0 118-119 7.075 0.0 0.025 0.0 0.0 120-121 7.65 0.0 0.025 0.0 0.0 122-123 8.274999999999999 0.0 0.025 0.0 0.0 124-125 9.0625 0.0 0.025 0.0 0.0 126-127 9.8 0.0 0.025 0.0 0.0 128-129 10.825 0.0 0.025 0.0 0.0 130-131 11.5125 0.0 0.025 0.0 0.0 132-133 12.225 0.0 0.025 0.0 0.0 134-135 12.975000000000001 0.0 0.025 0.0 0.0 136-137 13.875 0.0 0.025 0.0 0.0 138-139 14.6875 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCACC 10 0.006830828 145.0 2 AGCACCG 10 0.006830828 145.0 3 >>END_MODULE Read 1281644 spots for SRR5579257.sra Written 1281644 spots for SRR5579257.sra Read 1281644 spots for SRR5579257.sra Written 1281644 spots for SRR5579257.sra Read 1281644 spots for SRR5579257.sra Written 1281644 spots for SRR5579257.sra Read 1281644 spots for SRR5579257.sra Written 1281644 spots for SRR5579257.sra Read 1281644 spots for SRR5579257.sra Written 1281644 spots for SRR5579257.sra Read 1281644 spots for SRR5579257.sra Written 1281644 spots for SRR5579257.sra Read 1281644 spots for SRR5579257.sra Written 1281644 spots for SRR5579257.sra Read 1281644 spots for SRR5579257.sra Written 1281644 spots for SRR5579257.sra Read 1281651 spots for SRR5579257.sra Written 1281651 spots for SRR5579257.sra Read 1281644 spots for SRR5579257.sra Written 1281644 spots for SRR5579257.sra Read 1281644 spots for SRR5579257.sra Written 1281644 spots for SRR5579257.sra Read 1281644 spots for SRR5579257.sra Written 1281644 spots for SRR5579257.sra Read 1281644 spots for SRR5579257.sra Written 1281644 spots for SRR5579257.sra Read 1281644 spots for SRR5579257.sra Written 1281644 spots for SRR5579257.sra Read 1281644 spots for SRR5579257.sra Written 1281644 spots for SRR5579257.sra Read 1281644 spots for SRR5579257.sra Written 1281644 spots for SRR5579257.sra Read 1281644 spots for SRR5579257.sra Written 1281644 spots for SRR5579257.sra Read 1281644 spots for SRR5579257.sra Written 1281644 spots for SRR5579257.sra Read 1281644 spots for SRR5579257.sra Written 1281644 spots for SRR5579257.sra Read 1281644 spots for SRR5579257.sra Written 1281644 spots for SRR5579257.sra SRR ids: ['SRR5579257.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mu8_10pk SRR5579257.sra spots: 25632887 blocks: [[1, 1281644], [1281645, 2563288], [2563289, 3844932], [3844933, 5126576], [5126577, 6408220], [6408221, 7689864], [7689865, 8971508], [8971509, 10253152], [10253153, 11534796], [11534797, 12816440], [12816441, 14098084], [14098085, 15379728], [15379729, 16661372], [16661373, 17943016], [17943017, 19224660], [19224661, 20506304], [20506305, 21787948], [21787949, 23069592], [23069593, 24351236], [24351237, 25632887]] SRR5579257 file size 8664443 SRR5579257 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579257 SRR5579257_1.fastq SRR5579257_2.fastq Input file: SRR5579257_1.fastq Paired file: SRR5579257_2.fastq trimmed: SRR5579257-trimmed-pair1.fastq, SRR5579257-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 23:45:51 2024 >> started Mon Dec 9 23:46:26 2024 >> done (34.638s) 25632887 read pairs processed; of these: 47249 ( 0.18%) short read pairs filtered out after trimming by size control 63638 ( 0.25%) empty read pairs filtered out after trimming by size control 25522000 (99.57%) read pairs available; of these: 15405001 (60.36%) trimmed read pairs available after processing 10116999 (39.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 16 0.00% 20 13 0.00% 21 17 0.00% 22 16 0.00% 23 22 0.00% 24 20 0.00% 25 25 0.00% 26 21 0.00% 27 19 0.00% 28 26 0.00% 29 21 0.00% 30 30 0.00% 31 42 0.00% 32 46 0.00% 33 37 0.00% 34 42 0.00% 35 66 0.00% 36 59 0.00% 37 90 0.00% 38 90 0.00% 39 85 0.00% 40 119 0.00% 41 92 0.00% 42 128 0.00% 43 130 0.00% 44 153 0.00% 45 183 0.00% 46 217 0.00% 47 268 0.00% 48 322 0.00% 49 375 0.00% 50 394 0.00% 51 492 0.00% 52 487 0.00% 53 537 0.00% 54 565 0.00% 55 702 0.00% 56 806 0.00% 57 966 0.00% 58 1049 0.00% 59 1268 0.00% 60 1400 0.01% 61 1574 0.01% 62 1824 0.01% 63 2161 0.01% 64 2224 0.01% 65 2464 0.01% 66 2925 0.01% 67 3281 0.01% 68 3849 0.02% 69 4992 0.02% 70 5395 0.02% 71 5762 0.02% 72 6696 0.03% 73 7369 0.03% 74 8019 0.03% 75 8887 0.03% 76 9529 0.04% 77 10610 0.04% 78 11938 0.05% 79 13575 0.05% 80 15233 0.06% 81 17456 0.07% 82 19694 0.08% 83 21630 0.08% 84 24827 0.10% 85 27102 0.11% 86 27970 0.11% 87 29918 0.12% 88 31340 0.12% 89 33424 0.13% 90 36169 0.14% 91 39054 0.15% 92 41817 0.16% 93 45300 0.18% 94 47224 0.19% 95 48239 0.19% 96 50267 0.20% 97 51351 0.20% 98 53062 0.21% 99 56508 0.22% 100 59541 0.23% 101 62108 0.24% 102 65325 0.26% 103 68353 0.27% 104 70488 0.28% 105 73119 0.29% 106 73620 0.29% 107 74423 0.29% 108 76439 0.30% 109 78071 0.31% 110 80591 0.32% 111 84789 0.33% 112 88062 0.35% 113 89705 0.35% 114 93857 0.37% 115 95968 0.38% 116 96761 0.38% 117 97520 0.38% 118 97704 0.38% 119 100038 0.39% 120 103187 0.40% 121 106614 0.42% 122 109249 0.43% 123 114082 0.45% 124 117297 0.46% 125 120346 0.47% 126 122170 0.48% 127 123654 0.48% 128 124402 0.49% 129 127099 0.50% 130 128677 0.50% 131 132416 0.52% 132 139467 0.55% 133 143936 0.56% 134 148611 0.58% 135 156904 0.61% 136 162795 0.64% 137 167014 0.65% 138 175518 0.69% 139 181536 0.71% 140 192498 0.75% 141 208254 0.82% 142 232291 0.91% 143 243465 0.95% 144 277761 1.09% 145 320498 1.26% 146 382891 1.50% 147 511453 2.00% 148 702900 2.75% 149 1318709 5.17% 150 5840699 22.88% 151 10116999 39.64% 25522000 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=5.25 fanout-score-rank=25 prefix-density=0.17 prefix-fanout=4.1 sequence=GTGATGGTCTTGCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=1069.45 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=30.2 sequence=CAGCAGCAGTCGGACATGGGTTCACGAAACTAAACGATGAGACGACGAAACGGAGGGCATTGACGCCGGCCGAACGAACTCGGAAGCAGAAGCAGCTTGCATCGATCTGCTTAGTAGTCGGTGGTGGGGAGCTGCTCATGG criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=32 prefix-density=0.36 prefix-fanout=2.3 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=612.18 fanout-score-rank=1 prefix-density=0.62 prefix-fanout=19.8 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR5579257 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 23:47:47 Started mapping on | Dec 09 23:47:47 Finished on | Dec 10 00:00:40 Mapping speed, Million of reads per hour | 118.86 Number of input reads | 25522000 Average input read length | 286 UNIQUE READS: Uniquely mapped reads number | 21495437 Uniquely mapped reads % | 84.22% Average mapped length | 286.09 Number of splices: Total | 22418456 Number of splices: Annotated (sjdb) | 21182674 Number of splices: GT/AG | 22125455 Number of splices: GC/AG | 259841 Number of splices: AT/AC | 16383 Number of splices: Non-canonical | 16777 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.01% Deletion average length | 1.33 Insertion rate per base | 0.00% Insertion average length | 1.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 255406 % of reads mapped to multiple loci | 1.00% Number of reads mapped to too many loci | 11897 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 14.50% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3801607 3801607 3801607 N_multimapping 255406 255406 255406 N_noFeature 639384 20837404 923467 N_ambiguous 419660 2707 47510 UnstrandedReadsAssigned:20436393 PositiveStrandReadsAssigned:655326 NegativeStrandReadsAssigned:20524460 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=143 echo kmer=139 SRR5579257 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579257-trimmed-pair1.fastq SRR5579257-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,522,000 reads, 20,763,763 reads pseudoaligned [quant] estimated average fragment length: 238.196 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,209 rounds 52973 SRR5579257.ke.tsv 35125 SRR5579257.se.tsv 88098 total ==> SRR5579257.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 699.464 28.1298 2.90276 PNS24247 1044 806.804 71.666 6.41141 PNS24249 1928 1690.8 86.5749 3.69579 PNS24246 1044 806.804 71.666 6.41141 PNS24248 1044 806.804 71.666 6.41141 PNS24244 1471 1233.8 239.297 13.9991 PNS24243 293 111.093 0 0 KQK14069 1603 1365.8 5710.52 301.784 KQK14071 474 256.423 141.246 39.7583 ==> SRR5579257.se.tsv <== BRADI_1g14170v3 6467 BRADI_1g53295v3 72 BRADI_1g59795v3 429 BRADI_1g07683v3 0 BRADI_1g00485v3 64 BRADI_1g20270v3 1279 BRADI_1g74790v3 30 BRADI_1g09890v3 2 BRADI_1g77505v3 154 BRADI_1g48960v3 1 SRR5579257 completed mapping pipeline successfully