Starting /dee2/code/volunteer_pipeline.sh SRR5579258 current disk space = 1523307876352 free memory = 1559438768 SRR5579258 SRAfilesize 04ceb8ef963216ebbc33abc2b4809e18 SRR5579258.sra SRR5579258.sra file validated SRR5579258 is paired end SRR5579258 is conventional basespace SRR5579258 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579258_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.06925 34.0 33.0 34.0 32.0 34.0 2 33.27075 34.0 33.0 34.0 32.0 34.0 3 33.36425 34.0 33.0 34.0 32.0 34.0 4 33.431 34.0 34.0 34.0 33.0 34.0 5 33.444 34.0 33.0 34.0 33.0 34.0 6 37.1615 38.0 38.0 38.0 36.0 38.0 7 37.47425 38.0 38.0 38.0 37.0 38.0 8 37.567 38.0 38.0 38.0 38.0 38.0 9 37.601 38.0 38.0 38.0 38.0 38.0 10-14 37.571600000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.556250000000006 38.0 38.0 38.0 38.0 38.0 20-24 37.47915 38.0 38.0 38.0 38.0 38.0 25-29 37.3822 38.0 38.0 38.0 37.6 38.0 30-34 37.287850000000006 38.0 38.0 38.0 37.8 38.0 35-39 37.16775 38.0 38.0 38.0 37.0 38.0 40-44 37.01925000000001 38.0 38.0 38.0 36.4 38.0 45-49 37.0264 38.0 38.0 38.0 36.6 38.0 50-54 37.138650000000005 38.0 38.0 38.0 37.0 38.0 55-59 37.050799999999995 38.0 38.0 38.0 36.8 38.0 60-64 37.052200000000006 38.0 38.0 38.0 36.6 38.0 65-69 36.885549999999995 38.0 38.0 38.0 36.0 38.0 70-74 36.8545 38.0 38.0 38.0 36.0 38.0 75-79 36.338649999999994 38.0 38.0 38.0 35.4 38.0 80-84 36.2474 38.0 38.0 38.0 35.0 38.0 85-89 36.1892 38.0 38.0 38.0 35.0 38.0 90-94 36.06255 38.0 38.0 38.0 34.0 38.0 95-99 35.990700000000004 38.0 38.0 38.0 34.2 38.0 100-104 35.81085 38.0 38.0 38.0 33.8 38.0 105-109 35.6879 38.0 38.0 38.0 33.4 38.0 110-114 35.5681 38.0 37.8 38.0 32.6 38.0 115-119 35.262350000000005 38.0 37.4 38.0 31.2 38.0 120-124 35.27034999999999 38.0 37.2 38.0 31.2 38.0 125-129 35.2373 38.0 36.8 38.0 31.0 38.0 130-134 34.949149999999996 38.0 36.0 38.0 29.8 38.0 135-139 34.598549999999996 38.0 35.4 38.0 27.6 38.0 140-144 34.254850000000005 38.0 35.0 38.0 26.4 38.0 145-149 33.6261 38.0 33.8 38.0 21.6 38.0 150-151 28.628875 34.5 25.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 4.0 8 9.0 9 1.0 10 1.0 11 2.0 12 1.0 13 5.0 14 5.0 15 1.0 16 9.0 17 2.0 18 22.0 19 41.0 20 7.0 21 12.0 22 7.0 23 2.0 24 10.0 25 10.0 26 13.0 27 22.0 28 15.0 29 23.0 30 26.0 31 37.0 32 47.0 33 94.0 34 121.0 35 218.0 36 573.0 37 2659.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.03870292887029 13.807531380753138 10.87866108786611 27.27510460251046 2 24.474999999999998 17.075000000000003 32.125 26.325 3 21.224999999999998 22.95 26.6 29.225 4 25.874999999999996 27.925 23.25 22.95 5 25.775 31.775 23.0 19.45 6 21.475 32.425 24.95 21.15 7 16.650000000000002 24.7 38.6 20.05 8 19.650000000000002 23.45 29.549999999999997 27.35 9 21.8 23.05 30.525000000000002 24.625 10-14 22.525000000000002 27.750000000000004 25.014999999999997 24.709999999999997 15-19 22.17 26.605 25.869999999999997 25.355 20-24 22.581129056452824 26.491324566228315 25.556277813890695 25.371268563428174 25-29 22.83169010560032 26.90055552775136 25.31404834592863 24.953706020719686 30-34 22.48046483670607 26.482668803846927 25.370667200961734 25.666199158485277 35-39 22.98170884490103 26.4946128789777 25.14657980456026 25.37709847156101 40-44 23.04570054119062 26.03728202044498 25.636400080176386 25.280617358188014 45-49 22.973988873853557 25.79561970630983 26.076279256252192 25.154112163584426 50-54 22.745274978693537 25.62290068682007 25.718153105730185 25.9136712287562 55-59 22.866740198536046 25.94003810287777 25.854807981550188 25.338413717035994 60-64 22.973988873853557 25.715431263469153 25.95098481431364 25.359595048363655 65-69 22.695604230364395 27.181594907523433 24.685479424590245 25.43732143752193 70-74 22.992133874442608 27.210782103311786 24.560348714865473 25.23673530738013 75-79 22.797097823367526 26.58994245684263 24.828621466099573 25.78433825369027 80-84 23.732038251639715 26.240424573173787 24.723376558353777 25.30416061683272 85-89 24.066930514503284 25.35945092931216 24.783327488602776 25.790291067581784 90-94 23.54856484496318 26.033161348494716 25.156539598256778 25.26173420828533 95-99 24.561754983471904 25.56846639286788 24.31132925974156 25.558449363918662 100-104 23.712526900555527 27.08072669035584 24.25304038836895 24.953706020719686 105-109 23.270723766591537 26.90207863761583 24.04207362885049 25.785123966942148 110-114 23.909118266626542 26.38178352893971 24.149864580198617 25.559233624235127 115-119 23.881793137991487 26.756824442774857 23.806661657901326 25.554720761332334 120-124 24.365000000000002 26.424999999999997 22.919999999999998 26.290000000000003 125-129 23.155 26.71 23.150000000000002 26.985 130-134 23.84 26.479999999999997 23.549999999999997 26.13 135-139 23.405 27.29 23.669999999999998 25.635 140-144 23.78 26.655 23.815 25.75 145-149 23.52 27.58 23.165 25.735000000000003 150-151 23.6625 26.474999999999998 23.8125 26.05 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 2.0 1 2.0 2 1.5 3 0.5 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 0.5 17 0.0 18 1.5 19 1.5 20 0.0 21 1.0 22 2.0 23 1.0 24 3.0 25 3.5 26 3.5 27 5.5 28 7.0 29 10.5 30 18.5 31 27.5 32 27.0 33 36.0 34 52.5 35 73.0 36 93.0 37 97.0 38 115.0 39 127.5 40 140.0 41 142.5 42 143.0 43 150.5 44 155.5 45 162.0 46 162.0 47 170.0 48 170.0 49 151.0 50 139.0 51 137.0 52 131.5 53 129.5 54 112.0 55 110.5 56 102.5 57 93.0 58 87.5 59 74.0 60 71.0 61 54.0 62 48.5 63 49.0 64 40.5 65 37.5 66 39.0 67 38.5 68 41.0 69 41.5 70 35.5 71 27.5 72 25.0 73 22.0 74 13.5 75 11.5 76 10.0 77 5.5 78 3.5 79 3.0 80 1.0 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.3999999999999995 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.005 25-29 0.095 30-34 0.18 35-39 0.22499999999999998 40-44 0.22 45-49 0.23500000000000001 50-54 0.265 55-59 0.27 60-64 0.23500000000000001 65-69 0.245 70-74 0.20500000000000002 75-79 0.075 80-84 0.135 85-89 0.19499999999999998 90-94 0.185 95-99 0.16999999999999998 100-104 0.095 105-109 0.17500000000000002 110-114 0.31 115-119 0.17500000000000002 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 96.50106837606837 90.325 2 2.430555555555556 4.55 3 0.6143162393162394 1.725 4 0.2136752136752137 0.8 5 0.10683760683760685 0.5 6 0.02670940170940171 0.15 7 0.02670940170940171 0.17500000000000002 8 0.02670940170940171 0.2 9 0.0 0.0 >10 0.02670940170940171 0.27499999999999997 >50 0.02670940170940171 1.3 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAGTCAAATCTCGTATGC 52 1.3 TruSeq Adapter, Index 13 (98% over 50bp) GCCTCACTTAGTTACAGTTTTATGGATAATTGGGATATTCTTTGGTATAG 11 0.27499999999999997 No Hit GTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGAGTAGGGA 8 0.2 No Hit GGATAATTGGGATATTCTTTGGTATAGTTGGGATTTTAATATCATTAATA 7 0.17500000000000002 No Hit GGAAGCTATACTATATAGGTGGCTATCTATCCCTACCAAGGCTTATATTG 6 0.15 No Hit CTCAGACGCTGCCCTAACTGCGCAGTTAATAATTCTGGCAATTCGTCTCC 5 0.125 No Hit CTTAGTTACAGTTTTATGGATAATTGGGATATTCTTTGGTATAGTTGGGA 5 0.125 No Hit GTTATGAGTAGGGATGAGCATAAACCAACAACTCTCAAAGAAGATGGGAA 5 0.125 No Hit GGGGTTATGAGTAGGGATGAGCATAAACCAACAACTCTCAAAGAAGATGG 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.23750000000000002 0.0 0.0 0.0 0.0 74-75 0.3875 0.0 0.0 0.0 0.0 76-77 0.475 0.0 0.0 0.0 0.0 78-79 0.575 0.0 0.0 0.0 0.0 80-81 0.625 0.0 0.0 0.0 0.0 82-83 0.7125 0.0 0.0 0.0 0.0 84-85 0.8500000000000001 0.0 0.0 0.0 0.0 86-87 0.9624999999999999 0.0 0.0 0.0 0.0 88-89 1.1 0.0 0.0 0.0 0.0 90-91 1.3375 0.0 0.0 0.0 0.0 92-93 1.6124999999999998 0.0 0.0 0.0 0.0 94-95 1.9 0.0 0.0 0.0 0.0 96-97 2.325 0.0 0.0 0.0 0.0 98-99 2.775 0.0 0.0 0.0 0.0 100-101 3.3 0.0 0.0 0.0 0.0 102-103 3.75 0.0 0.0 0.0 0.0 104-105 4.3 0.0 0.0 0.0 0.0 106-107 4.949999999999999 0.0 0.0 0.0 0.0 108-109 5.65 0.0 0.0 0.0 0.0 110-111 6.1625 0.0 0.0 0.0 0.0 112-113 6.75 0.0 0.0 0.0 0.0 114-115 7.6 0.0 0.0 0.0 0.0 116-117 8.3875 0.0 0.0 0.0 0.0 118-119 9.175 0.0 0.0 0.0 0.0 120-121 9.95 0.0 0.0 0.0 0.0 122-123 10.675 0.0 0.0 0.0 0.0 124-125 11.600000000000001 0.0 0.0 0.0 0.0 126-127 12.3875 0.0 0.0 0.0 0.0 128-129 13.3875 0.0 0.0 0.0 0.0 130-131 14.4375 0.0 0.0 0.0 0.0 132-133 15.274999999999999 0.0 0.0 0.0 0.0 134-135 15.9875 0.0 0.0 0.0 0.0 136-137 16.6625 0.0 0.0 0.0 0.0 138-139 17.637500000000003 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCACA 90 0.0033314175 31.991667 9 AGAGCAC 90 0.0033314175 31.991667 8 AAGAGCA 95 0.004341915 30.307896 7 GAAAAAA 20 0.0057788463 29.156963 60-64 CCGTCTT 20 0.0057788463 29.156963 50-54 TGCTTGA 20 0.0057788463 29.156963 55-59 CTGCTTG 20 0.0057788463 29.156963 55-59 CGTCTTC 20 0.0057788463 29.156963 50-54 CGGAAGA 100 0.0055809785 28.792498 4 TCGGAAG 105 0.0070844153 27.421427 3 GAAGAGC 110 0.008891362 26.175 6 GGAAGAG 110 0.008891362 26.175 5 AAAAAAA 355 2.7011993E-9 8.213228 65-69 >>END_MODULE SRR5579258 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5579258_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.81125 33.0 33.0 34.0 32.0 34.0 2 32.82125 34.0 33.0 34.0 32.0 34.0 3 32.77625 34.0 33.0 34.0 32.0 34.0 4 32.66925 34.0 33.0 34.0 32.0 34.0 5 32.73925 34.0 33.0 34.0 32.0 34.0 6 36.668 38.0 38.0 38.0 36.0 38.0 7 36.72275 38.0 38.0 38.0 36.0 38.0 8 36.60075 38.0 38.0 38.0 36.0 38.0 9 36.70975 38.0 38.0 38.0 36.0 38.0 10-14 36.71155 38.0 38.0 38.0 36.6 38.0 15-19 36.6176 38.0 38.0 38.0 36.2 38.0 20-24 36.61795 38.0 38.0 38.0 36.6 38.0 25-29 36.5839 38.0 38.0 38.0 36.2 38.0 30-34 36.599000000000004 38.0 38.0 38.0 36.4 38.0 35-39 36.5986 38.0 38.0 38.0 36.8 38.0 40-44 36.524649999999994 38.0 38.0 38.0 36.2 38.0 45-49 36.42495 38.0 38.0 38.0 36.0 38.0 50-54 36.433299999999996 38.0 38.0 38.0 36.0 38.0 55-59 36.45725 38.0 38.0 38.0 36.0 38.0 60-64 36.45625 38.0 38.0 38.0 36.2 38.0 65-69 36.1709 38.0 38.0 38.0 35.2 38.0 70-74 35.60600000000001 38.0 38.0 38.0 33.6 38.0 75-79 35.55745 38.0 38.0 38.0 33.4 38.0 80-84 35.53789999999999 38.0 38.0 38.0 33.6 38.0 85-89 35.509 38.0 38.0 38.0 33.4 38.0 90-94 35.447 38.0 38.0 38.0 33.4 38.0 95-99 35.3529 38.0 38.0 38.0 33.2 38.0 100-104 35.09825 38.0 38.0 38.0 30.8 38.0 105-109 35.01389999999999 38.0 38.0 38.0 30.6 38.0 110-114 34.897 38.0 38.0 38.0 30.2 38.0 115-119 34.69215 38.0 37.2 38.0 27.8 38.0 120-124 34.227149999999995 38.0 36.0 38.0 24.2 38.0 125-129 33.76950000000001 38.0 35.6 38.0 21.4 38.0 130-134 33.5083 38.0 34.8 38.0 18.6 38.0 135-139 32.939049999999995 38.0 33.2 38.0 13.4 38.0 140-144 31.963500000000003 38.0 32.8 38.0 7.6 38.0 145-149 30.6906 38.0 31.0 38.0 2.0 38.0 150-151 25.038375000000002 32.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 30.0 3 17.0 4 8.0 5 2.0 6 7.0 7 4.0 8 5.0 9 4.0 10 3.0 11 6.0 12 4.0 13 9.0 14 10.0 15 10.0 16 19.0 17 45.0 18 13.0 19 6.0 20 0.0 21 9.0 22 8.0 23 14.0 24 15.0 25 19.0 26 15.0 27 19.0 28 37.0 29 22.0 30 43.0 31 44.0 32 71.0 33 103.0 34 151.0 35 227.0 36 601.0 37 2400.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.48687171792948 15.728932233058265 13.903475868967242 22.88072018004501 2 27.838919459729865 23.011505752876438 25.237618809404704 23.911955977988995 3 24.8062015503876 23.055763940985248 29.232308077019255 22.9057264316079 4 28.33208302075519 29.457364341085274 18.754688672168044 23.455863965991497 5 27.581895473868467 33.28332083020755 18.72968242060515 20.40510127531883 6 24.325 31.674999999999997 21.575 22.425 7 22.85 19.775000000000002 32.275 25.1 8 23.35 23.45 22.075 31.125000000000004 9 25.575 24.0 24.25 26.174999999999997 10-14 26.085 25.895000000000003 22.925 25.095 15-19 26.69 24.715 24.275 24.32 20-24 26.950000000000003 25.580000000000002 23.555 23.915 25-29 27.095000000000002 25.25 23.66 23.995 30-34 26.95134756737837 24.71623581179059 24.17620881044052 24.15620781039052 35-39 25.324999999999996 24.41 24.77 25.495 40-44 28.1 24.240000000000002 23.565 24.095 45-49 26.36 24.07 24.75 24.82 50-54 25.945 24.235 25.169999999999998 24.65 55-59 25.895000000000003 25.34 25.415 23.35 60-64 25.230000000000004 26.529999999999998 24.725 23.515 65-69 25.551277563878195 26.3863193159658 24.441222061103055 23.621181059052955 70-74 25.48254825482548 25.76757675767577 24.682468246824683 24.067406740674066 75-79 25.83 25.72 24.51 23.94 80-84 25.46 26.36 24.884999999999998 23.294999999999998 85-89 25.715 25.924999999999997 25.255 23.105 90-94 25.41 26.005 25.230000000000004 23.355 95-99 26.545 26.375 24.79 22.29 100-104 25.97 26.490000000000002 24.42 23.119999999999997 105-109 26.745 26.515 24.205 22.535 110-114 25.83 26.685 24.605 22.88 115-119 26.99 26.5 24.635 21.875 120-124 27.35 26.295 23.885 22.470000000000002 125-129 27.145000000000003 27.295 23.674999999999997 21.884999999999998 130-134 27.936396819840994 26.4063203160158 24.26621331066553 21.391069553477674 135-139 28.21423213482022 27.199079861979296 23.888583287493123 20.698104715707355 140-144 28.660000000000004 26.125 24.47 20.745 145-149 29.117911791179118 26.56265626562656 23.762376237623762 20.557055705570555 150-151 28.9125 26.4625 23.4375 21.1875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 1.0 20 1.0 21 0.0 22 0.0 23 1.0 24 1.5 25 2.5 26 3.0 27 3.5 28 4.0 29 6.0 30 11.5 31 11.5 32 19.0 33 28.5 34 33.5 35 42.5 36 58.5 37 85.0 38 102.0 39 111.5 40 123.0 41 134.5 42 126.5 43 128.5 44 142.0 45 149.5 46 161.0 47 161.5 48 160.0 49 145.5 50 139.5 51 135.0 52 132.5 53 135.5 54 143.0 55 136.5 56 116.0 57 107.0 58 103.5 59 98.5 60 79.0 61 69.0 62 70.5 63 67.0 64 55.0 65 51.0 66 52.5 67 52.0 68 50.5 69 43.5 70 40.0 71 37.0 72 29.0 73 26.0 74 21.0 75 16.0 76 13.5 77 7.0 78 3.5 79 3.5 80 3.0 81 1.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.05 3 0.025 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.005 70-74 0.01 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.005 135-139 0.015 140-144 0.0 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 96.57589646805069 89.55 2 2.291722836344028 4.25 3 0.48530601240226473 1.35 4 0.26961445133459155 1.0 5 0.13480722566729578 0.625 6 0.10784578053383662 0.6 7 0.026961445133459154 0.17500000000000002 8 0.0 0.0 9 0.026961445133459154 0.22499999999999998 >10 0.05392289026691831 0.775 >50 0.026961445133459154 1.4500000000000002 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 58 1.4500000000000002 Illumina Single End PCR Primer 1 (100% over 50bp) GCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCC 21 0.525 No Hit GAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCC 10 0.25 No Hit GGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTC 9 0.22499999999999998 No Hit GCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGG 7 0.17500000000000002 No Hit GGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTT 6 0.15 No Hit CCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCCTATGGT 6 0.15 No Hit ACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCCTATGGTTTTC 6 0.15 No Hit GGGAGGTATCCCAATAGGAGGTTTCCTCCTATGGTTTTCAAAACAATCAC 6 0.15 No Hit CTTCAATATAAGCCTTGGTAGGGATAGATAGCCACCTATATAGTATAGCT 5 0.125 No Hit TCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGC 5 0.125 No Hit TGGGAGTATTTGCACTTGTGGTAACGGTATTTGCATTATTGATGGTTTTT 5 0.125 No Hit CCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCCTCCTATGG 5 0.125 No Hit GGAATGGGAGTATTTGCACTTGTGGTAACGGTATTTGCATTATTGATGGT 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.1 0.0 0.0 0.0 0.0 2 0.1 0.0 0.0 0.0 0.0 3 0.1 0.0 0.0 0.0 0.0 4 0.1 0.0 0.0 0.0 0.0 5 0.1 0.0 0.0 0.0 0.0 6 0.1 0.0 0.0 0.0 0.0 7 0.1 0.0 0.0 0.0 0.0 8 0.1 0.0 0.0 0.0 0.0 9 0.1 0.0 0.0 0.0 0.0 10-11 0.1 0.0 0.0 0.0 0.0 12-13 0.1 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.16249999999999998 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.3625 0.0 0.0 0.0 0.0 76-77 0.475 0.0 0.0 0.0 0.0 78-79 0.6 0.0 0.0 0.0 0.0 80-81 0.65 0.0 0.0 0.0 0.0 82-83 0.7375 0.0 0.0 0.0 0.0 84-85 0.825 0.0 0.0 0.0 0.0 86-87 0.925 0.0 0.0 0.0 0.0 88-89 1.0750000000000002 0.0 0.0 0.0 0.0 90-91 1.3125 0.0 0.0 0.0 0.0 92-93 1.5625 0.0 0.0 0.0 0.0 94-95 1.85 0.0 0.0 0.0 0.0 96-97 2.225 0.0 0.0 0.0 0.0 98-99 2.6375 0.0 0.0 0.0 0.0 100-101 3.2375 0.0 0.0 0.0 0.0 102-103 3.6875 0.0 0.0 0.0 0.0 104-105 4.2125 0.0 0.0 0.0 0.0 106-107 4.875 0.0 0.0 0.0 0.0 108-109 5.5625 0.0 0.0 0.0 0.0 110-111 6.112500000000001 0.0 0.0 0.0 0.0 112-113 6.775 0.0 0.0 0.0 0.0 114-115 7.612500000000001 0.0 0.0 0.0 0.0 116-117 8.3875 0.0 0.0 0.0 0.0 118-119 9.0875 0.0 0.0 0.0 0.0 120-121 9.8625 0.0 0.0 0.0 0.0 122-123 10.6125 0.0 0.0 0.0 0.0 124-125 11.4875 0.0 0.0 0.0 0.0 126-127 12.350000000000001 0.0 0.0 0.0 0.0 128-129 13.2625 0.0 0.0 0.0 0.0 130-131 14.2625 0.0 0.0 0.0 0.0 132-133 15.0875 0.0 0.0 0.0 0.0 134-135 15.7375 0.0 0.0 0.0 0.0 136-137 16.4125 0.0 0.0 0.0 0.0 138-139 17.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGCGTC 85 0.002429728 34.11765 9 AGAGCGT 85 0.002429728 34.11765 8 AAGAGCG 100 0.005388326 29.0 7 GTATCAT 20 0.00593511 29.0 50-54 CATTAAA 20 0.00593511 29.0 50-54 CGGAAGA 100 0.005388326 29.0 4 CGTATCA 20 0.00593511 29.0 45-49 TATCATT 20 0.00593511 29.0 50-54 TCATTAA 20 0.00593511 29.0 50-54 GAAGAGC 105 0.0068401312 27.619047 6 TCGGAAG 105 0.0068401312 27.619047 3 TTTTTTT 65 0.0076375785 13.384615 50-54 AAAAAAA 300 1.0913936E-11 10.150001 60-64 >>END_MODULE Read 659098 spots for SRR5579258.sra Written 659098 spots for SRR5579258.sra Read 659098 spots for SRR5579258.sra Written 659098 spots for SRR5579258.sra Read 659098 spots for SRR5579258.sra Written 659098 spots for SRR5579258.sra Read 659098 spots for SRR5579258.sra Written 659098 spots for SRR5579258.sra Read 659098 spots for SRR5579258.sra Written 659098 spots for SRR5579258.sra Read 659098 spots for SRR5579258.sra Written 659098 spots for SRR5579258.sra Read 659098 spots for SRR5579258.sra Written 659098 spots for SRR5579258.sra Read 659098 spots for SRR5579258.sra Written 659098 spots for SRR5579258.sra Read 659098 spots for SRR5579258.sra Written 659098 spots for SRR5579258.sra Read 659098 spots for SRR5579258.sra Written 659098 spots for SRR5579258.sra Read 659098 spots for SRR5579258.sra Written 659098 spots for SRR5579258.sra Read 659098 spots for SRR5579258.sra Written 659098 spots for SRR5579258.sra Read 659098 spots for SRR5579258.sra Written 659098 spots for SRR5579258.sra Read 659110 spots for SRR5579258.sra Read 659098 spots for SRR5579258.sra Written 659110 spots for SRR5579258.sra Written 659098 spots for SRR5579258.sra Read 659098 spots for SRR5579258.sra Written 659098 spots for SRR5579258.sra Read 659098 spots for SRR5579258.sra Written 659098 spots for SRR5579258.sra Read 659098 spots for SRR5579258.sra Written 659098 spots for SRR5579258.sra Read 659098 spots for SRR5579258.sra Written 659098 spots for SRR5579258.sra Read 659098 spots for SRR5579258.sra Written 659098 spots for SRR5579258.sra SRR ids: ['SRR5579258.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jgpocnk6 SRR5579258.sra spots: 13181972 blocks: [[1, 659098], [659099, 1318196], [1318197, 1977294], [1977295, 2636392], [2636393, 3295490], [3295491, 3954588], [3954589, 4613686], [4613687, 5272784], [5272785, 5931882], [5931883, 6590980], [6590981, 7250078], [7250079, 7909176], [7909177, 8568274], [8568275, 9227372], [9227373, 9886470], [9886471, 10545568], [10545569, 11204666], [11204667, 11863764], [11863765, 12522862], [12522863, 13181972]] SRR5579258 file size 4445237 SRR5579258 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5579258 SRR5579258_1.fastq SRR5579258_2.fastq Input file: SRR5579258_1.fastq Paired file: SRR5579258_2.fastq trimmed: SRR5579258-trimmed-pair1.fastq, SRR5579258-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Mon Dec 9 23:44:37 2024 >> started Mon Dec 9 23:44:53 2024 >> done (15.898s) 13181972 read pairs processed; of these: 50352 ( 0.38%) short read pairs filtered out after trimming by size control 237353 ( 1.80%) empty read pairs filtered out after trimming by size control 12894267 (97.82%) read pairs available; of these: 7845963 (60.85%) trimmed read pairs available after processing 5048304 (39.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 13 0.00% 20 16 0.00% 21 29 0.00% 22 22 0.00% 23 22 0.00% 24 27 0.00% 25 36 0.00% 26 42 0.00% 27 40 0.00% 28 39 0.00% 29 47 0.00% 30 53 0.00% 31 46 0.00% 32 43 0.00% 33 46 0.00% 34 55 0.00% 35 88 0.00% 36 61 0.00% 37 72 0.00% 38 104 0.00% 39 121 0.00% 40 438 0.00% 41 129 0.00% 42 123 0.00% 43 271 0.00% 44 184 0.00% 45 244 0.00% 46 227 0.00% 47 223 0.00% 48 297 0.00% 49 284 0.00% 50 340 0.00% 51 357 0.00% 52 401 0.00% 53 448 0.00% 54 486 0.00% 55 514 0.00% 56 563 0.00% 57 682 0.01% 58 760 0.01% 59 818 0.01% 60 904 0.01% 61 1013 0.01% 62 1120 0.01% 63 1300 0.01% 64 1426 0.01% 65 1782 0.01% 66 2127 0.02% 67 2788 0.02% 68 4454 0.03% 69 10410 0.08% 70 17539 0.14% 71 18150 0.14% 72 13253 0.10% 73 9141 0.07% 74 7530 0.06% 75 7194 0.06% 76 7228 0.06% 77 7572 0.06% 78 7901 0.06% 79 8351 0.06% 80 9140 0.07% 81 10703 0.08% 82 11710 0.09% 83 12789 0.10% 84 15925 0.12% 85 18044 0.14% 86 18563 0.14% 87 19983 0.15% 88 21238 0.16% 89 22988 0.18% 90 24590 0.19% 91 25252 0.20% 92 26838 0.21% 93 28079 0.22% 94 30215 0.23% 95 31662 0.25% 96 32512 0.25% 97 32705 0.25% 98 34017 0.26% 99 35902 0.28% 100 37926 0.29% 101 39641 0.31% 102 41968 0.33% 103 44671 0.35% 104 46143 0.36% 105 47577 0.37% 106 48596 0.38% 107 48576 0.38% 108 48967 0.38% 109 49934 0.39% 110 51436 0.40% 111 53915 0.42% 112 56642 0.44% 113 60223 0.47% 114 61552 0.48% 115 62316 0.48% 116 63340 0.49% 117 62663 0.49% 118 61387 0.48% 119 62522 0.48% 120 63720 0.49% 121 65810 0.51% 122 67905 0.53% 123 72159 0.56% 124 73118 0.57% 125 74836 0.58% 126 74848 0.58% 127 73430 0.57% 128 73425 0.57% 129 74451 0.58% 130 75032 0.58% 131 76539 0.59% 132 80961 0.63% 133 83119 0.64% 134 84329 0.65% 135 86337 0.67% 136 89122 0.69% 137 89250 0.69% 138 90911 0.71% 139 94025 0.73% 140 93338 0.72% 141 97417 0.76% 142 103838 0.81% 143 110691 0.86% 144 120325 0.93% 145 134456 1.04% 146 156412 1.21% 147 194158 1.51% 148 272407 2.11% 149 522402 4.05% 150 2824336 21.90% 151 5048304 39.15% 12894267 reads passed initial QC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=21 prefix-density=0.91 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=11.86 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=3.9 sequence=TTTTTTTTTACGTTTCATCAATGGCACTCTCTCACAGCCAATAACTTCAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTGCCACCGAATATTCAGTCCTTTAAGAAATCGAACAGCATACCCAACATAGTAAAAACCATCAATAATGCAAATACCGTTACCACAAGTGCAAATACTCCCATTCCTACCTCTCCAAAGTTAGAG criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=3.30 fanout-score-rank=12 prefix-density=0.82 prefix-fanout=2.8 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=45.20 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=1.9 sequence=TGCTCATCATCTTGTTTAATACCAAAGCTCTTCATATTCTCCTCCTTGATTTCATCAGCTTGAGGTTAGAGAGATTTGGAAGATGTCTTGCAGCTGTGGATCAAGCTGCAACTGTGGCTCAAACTGCACTTGCGGGAAGATGTACCCAGACCTGGCAGAGCAGGCCAGCACCACCAGCAGCACCCAGGCCCAGGTGCTGGTTCTCGGCATGGCGCCGGAGAAGAAACA SRR5579258 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 09 23:46:08 Started mapping on | Dec 09 23:46:08 Finished on | Dec 09 23:55:49 Mapping speed, Million of reads per hour | 79.90 Number of input reads | 12894267 Average input read length | 282 UNIQUE READS: Uniquely mapped reads number | 9470668 Uniquely mapped reads % | 73.45% Average mapped length | 282.41 Number of splices: Total | 8024020 Number of splices: Annotated (sjdb) | 7463205 Number of splices: GT/AG | 7916141 Number of splices: GC/AG | 96622 Number of splices: AT/AC | 3782 Number of splices: Non-canonical | 7475 Mismatch rate per base, % | 0.11% Deletion rate per base | 0.00% Deletion average length | 1.36 Insertion rate per base | 0.00% Insertion average length | 1.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 208765 % of reads mapped to multiple loci | 1.62% Number of reads mapped to too many loci | 31566 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 23.36% % of reads unmapped: other | 1.33% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3239367 3239367 3239367 N_multimapping 208765 208765 208765 N_noFeature 323146 9130710 428728 N_ambiguous 284088 1628 49857 UnstrandedReadsAssigned:8863434 PositiveStrandReadsAssigned:338330 NegativeStrandReadsAssigned:8992083 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=134 echo kmer=129 SRR5579258 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5579258-trimmed-pair1.fastq SRR5579258-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,894,267 reads, 9,125,975 reads pseudoaligned [quant] estimated average fragment length: 202.323 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,041 rounds 52973 SRR5579258.ke.tsv 35125 SRR5579258.se.tsv 88098 total ==> SRR5579258.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 734.828 6.90002 1.16471 PNS24247 1044 842.677 5.20898 0.766733 PNS24249 1928 1726.68 14.0499 1.00928 PNS24246 1044 842.677 5.20898 0.766733 PNS24248 1044 842.677 5.20898 0.766733 PNS24244 1471 1269.68 73.4232 7.17286 PNS24243 293 119.029 0 0 KQK14069 1603 1401.68 3072.41 271.883 KQK14071 474 279.3 77.3401 34.3468 ==> SRR5579258.se.tsv <== BRADI_1g14170v3 3361 BRADI_1g53295v3 17 BRADI_1g59795v3 147 BRADI_1g07683v3 0 BRADI_1g00485v3 14 BRADI_1g20270v3 1564 BRADI_1g74790v3 208 BRADI_1g09890v3 9 BRADI_1g77505v3 289 BRADI_1g48960v3 0 SRR5579258 completed mapping pipeline successfully