Starting /dee2/code/volunteer_pipeline.sh SRR5645253 current disk space = 1524681867264 free memory = 1605745364 SRR5645253 SRAfilesize 42ccfdf80c0b16195f09f30521f99616 SRR5645253.sra SRR5645253.sra file validated SRR5645253 is single end SRR5645253 is conventional basespace SRR5645253 read1 length is 50 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5645253_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 50 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.49375 34.0 31.0 34.0 31.0 34.0 2 32.678 34.0 31.0 34.0 31.0 34.0 3 32.8015 34.0 31.0 34.0 31.0 34.0 4 36.23925 37.0 37.0 37.0 35.0 37.0 5 36.1075 37.0 35.0 37.0 35.0 37.0 6 36.02925 37.0 35.0 37.0 35.0 37.0 7 36.01825 37.0 35.0 37.0 35.0 37.0 8 36.02575 37.0 35.0 37.0 35.0 37.0 9 37.78325 39.0 38.0 39.0 35.0 39.0 10 37.796 39.0 38.0 39.0 35.0 39.0 11 37.80025 39.0 38.0 39.0 35.0 39.0 12 37.78075 39.0 38.0 39.0 35.0 39.0 13 37.683 39.0 38.0 39.0 35.0 39.0 14 39.0995 41.0 39.0 41.0 36.0 41.0 15 39.21125 41.0 39.0 41.0 36.0 41.0 16 39.1775 41.0 39.0 41.0 36.0 41.0 17 39.08175 40.0 39.0 41.0 36.0 41.0 18 39.10925 40.0 39.0 41.0 36.0 41.0 19 38.765 40.0 38.0 41.0 35.0 41.0 20 38.8615 40.0 38.0 41.0 35.0 41.0 21 38.92025 40.0 38.0 41.0 35.0 41.0 22 38.772 40.0 38.0 41.0 35.0 41.0 23 38.7255 40.0 38.0 41.0 34.0 41.0 24 38.53925 40.0 38.0 41.0 34.0 41.0 25 38.2835 40.0 38.0 41.0 33.0 41.0 26 38.16175 40.0 38.0 41.0 33.0 41.0 27 38.0365 40.0 38.0 41.0 33.0 41.0 28 38.06725 40.0 38.0 41.0 33.0 41.0 29 37.862 40.0 38.0 41.0 33.0 41.0 30 37.731 40.0 37.0 41.0 33.0 41.0 31 37.79125 40.0 37.0 41.0 33.0 41.0 32 37.75325 40.0 37.0 41.0 33.0 41.0 33 37.626 40.0 37.0 41.0 32.0 41.0 34 36.931 40.0 36.0 41.0 31.0 41.0 35 37.063 40.0 36.0 41.0 31.0 41.0 36 37.40325 40.0 37.0 41.0 32.0 41.0 37 37.44125 40.0 36.0 41.0 33.0 41.0 38 37.20625 40.0 36.0 41.0 32.0 41.0 39 37.0355 40.0 36.0 41.0 31.0 41.0 40 36.867 39.0 35.0 41.0 31.0 41.0 41 36.71525 39.0 35.0 41.0 31.0 41.0 42 36.44125 39.0 35.0 41.0 30.0 41.0 43 36.3405 39.0 35.0 41.0 30.0 41.0 44 36.19075 39.0 35.0 41.0 30.0 41.0 45 35.9505 39.0 35.0 41.0 30.0 41.0 46 35.778 38.0 35.0 41.0 29.0 41.0 47 35.55025 38.0 35.0 41.0 29.0 41.0 48 35.5285 38.0 35.0 41.0 30.0 41.0 49 35.33825 38.0 35.0 40.0 30.0 41.0 50 35.04525 37.0 34.0 40.0 29.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 3.0 14 1.0 15 6.0 16 2.0 17 4.0 18 6.0 19 8.0 20 4.0 21 9.0 22 6.0 23 10.0 24 15.0 25 18.0 26 20.0 27 32.0 28 27.0 29 42.0 30 52.0 31 68.0 32 83.0 33 104.0 34 148.0 35 213.0 36 348.0 37 486.0 38 769.0 39 1514.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.13623772349534 10.173759758247293 11.206245278267438 49.48375723998993 2 26.85 19.25 28.525 25.374999999999996 3 27.325 23.799999999999997 19.075 29.799999999999997 4 30.75 28.325 16.150000000000002 24.775 5 29.425 28.925 19.650000000000002 22.0 6 24.525 32.300000000000004 18.925 24.25 7 23.3 14.899999999999999 36.3 25.5 8 24.875 20.075000000000003 23.3 31.75 9 23.549999999999997 20.45 26.400000000000002 29.599999999999998 10 24.45 32.7 20.575 22.275 11 28.425 20.025000000000002 17.150000000000002 34.4 12 25.3 20.375 23.275000000000002 31.05 13 24.075 23.05 25.974999999999998 26.900000000000002 14 26.224999999999998 22.95 23.275000000000002 27.55 15 26.05 22.875 22.625 28.449999999999996 16 26.575 22.15 22.45 28.825 17 27.950000000000003 22.2 22.125 27.725 18 26.650000000000002 22.575 22.15 28.625 19 25.900000000000002 23.150000000000002 23.375 27.575 20 27.3 22.2 22.525000000000002 27.975 21 26.950000000000003 22.725 21.85 28.475 22 27.400000000000002 22.725 22.175 27.700000000000003 23 29.075 22.45 21.6 26.875 24 26.325 22.925 22.025 28.725 25 26.900000000000002 23.225 21.725 28.15 26 28.599999999999998 22.35 21.55 27.500000000000004 27 26.974999999999998 23.05 23.075000000000003 26.900000000000002 28 26.825 22.45 22.525000000000002 28.199999999999996 29 25.650000000000002 23.45 22.225 28.675 30 27.0 22.1 21.625 29.275000000000002 31 27.025 22.275 21.8 28.9 32 28.025 22.275 21.475 28.225 33 26.5 23.5 20.9 29.099999999999998 34 28.025 21.85 21.275 28.849999999999998 35 26.588294147073537 23.58679339669835 21.410705352676338 28.414207103551774 36 26.863431715857928 22.536268134067033 22.411205602801402 28.189094547273637 37 26.7017017017017 23.423423423423422 22.047047047047048 27.82782782782783 38 27.691537305958942 22.408612919379067 22.283425137706562 27.616424636955433 39 27.39794640621087 22.389181066867017 21.98847983971951 28.224392687202602 40 26.57973921765296 21.940822467402207 21.840521564694082 29.638916750250754 41 28.679055750878955 21.898543445504774 21.747865394274235 27.674535409342038 42 26.785714285714285 22.308853118712275 21.906438631790746 28.9989939637827 43 28.88159555667761 22.16611966675082 20.727089118909365 28.225195657662205 44 27.770700636942674 22.012738853503187 22.089171974522294 28.127388535031848 45 27.40040858018386 22.03779366700715 22.548518896833503 28.013278855975486 46 27.997927997927995 20.953120953120955 21.80782180782181 29.241129241129244 47 28.478437754271766 18.76864659614863 21.616490371575807 31.1364252780038 48 29.939460649422124 18.354430379746837 21.518987341772153 30.18712162905889 49 29.338842975206614 16.883116883116884 20.454545454545457 33.32349468713105 50 34.201141226818834 0.0 27.888730385164052 37.910128388017114 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 2.0 21 1.5 22 1.0 23 2.0 24 3.0 25 4.0 26 5.0 27 8.0 28 11.0 29 21.0 30 31.0 31 30.5 32 30.0 33 43.0 34 56.0 35 72.0 36 88.0 37 103.5 38 119.0 39 137.5 40 156.0 41 177.0 42 198.0 43 193.5 44 189.0 45 207.5 46 226.0 47 241.0 48 256.0 49 264.0 50 272.0 51 245.0 52 218.0 53 220.0 54 222.0 55 209.0 56 196.0 57 212.5 58 229.0 59 210.0 60 191.0 61 191.0 62 191.0 63 180.5 64 170.0 65 167.5 66 165.0 67 163.0 68 161.0 69 151.0 70 141.0 71 136.5 72 132.0 73 123.0 74 114.0 75 101.0 76 88.0 77 76.5 78 65.0 79 51.0 80 37.0 81 27.0 82 17.0 83 12.5 84 8.0 85 7.5 86 7.0 87 4.5 88 2.0 89 2.5 90 3.0 91 1.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.7250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.05 36 0.05 37 0.1 38 0.15 39 0.17500000000000002 40 0.3 41 0.44999999999999996 42 0.6 43 0.975 44 1.875 45 2.1 46 3.4750000000000005 47 7.825 48 9.15 49 15.299999999999999 50 29.9 >>END_MODULE >>Sequence Length Distribution pass #Length Count 50 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.975 #Duplication Level Percentage of deduplicated Percentage of total 1 98.41796376626691 96.42500000000001 2 1.2758356723653992 2.5 3 0.17861699413115592 0.525 4 0.07655014034192395 0.3 5 0.05103342689461597 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGAAACCTGGGATGCGCAAGGAAGCTGACGAGCGGGAGGCCCTCACGGG 5 0.125 No Hit CCGCGATAGTAATTCAACCTAGTACGAGAGGAACCGTTGATTCACACNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10 0.05 0.0 0.0 0.0 0.0 11 0.05 0.0 0.0 0.0 0.025 12 0.075 0.0 0.0 0.0 0.025 13 0.075 0.0 0.0 0.0 0.025 14 0.075 0.0 0.0 0.0 0.025 15 0.075 0.0 0.0 0.0 0.025 16 0.075 0.0 0.0 0.0 0.025 17 0.1 0.0 0.0 0.0 0.025 18 0.1 0.0 0.0 0.0 0.025 19 0.1 0.0 0.0 0.0 0.025 20 0.1 0.0 0.0 0.0 0.025 21 0.1 0.0 0.0 0.0 0.025 22 0.1 0.0 0.0 0.0 0.025 23 0.1 0.0 0.0 0.0 0.025 24 0.1 0.0 0.0 0.0 0.025 25 0.1 0.0 0.0 0.0 0.025 26 0.125 0.0 0.0 0.0 0.025 27 0.125 0.0 0.0 0.0 0.025 28 0.125 0.0 0.0 0.0 0.025 29 0.125 0.0 0.0 0.0 0.025 30 0.125 0.0 0.0 0.0 0.025 31 0.125 0.0 0.0 0.0 0.025 32 0.125 0.0 0.0 0.0 0.025 33 0.125 0.0 0.0 0.0 0.025 34 0.125 0.0 0.0 0.0 0.025 35 0.125 0.0 0.0 0.0 0.025 36 0.125 0.0 0.0 0.0 0.025 37 0.125 0.0 0.0 0.0 0.025 38 0.125 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 21827906 spots for SRR5645253.sra Written 21827906 spots for SRR5645253.sra Read 21827906 spots for SRR5645253.sra Written 21827906 spots for SRR5645253.sra Read 21827906 spots for SRR5645253.sra Written 21827906 spots for SRR5645253.sra Read 21827906 spots for SRR5645253.sra Written 21827906 spots for SRR5645253.sra Read 21827906 spots for SRR5645253.sra Written 21827906 spots for SRR5645253.sra Read 21827923 spots for SRR5645253.sra Written 21827923 spots for SRR5645253.sra Read 21827906 spots for SRR5645253.sra Written 21827906 spots for SRR5645253.sra Read 21827906 spots for SRR5645253.sra Written 21827906 spots for SRR5645253.sra Read 21827906 spots for SRR5645253.sra Written 21827906 spots for SRR5645253.sra Read 21827906 spots for SRR5645253.sra Written 21827906 spots for SRR5645253.sra Read 21827906 spots for SRR5645253.sra Written 21827906 spots for SRR5645253.sra Read 21827906 spots for SRR5645253.sra Written 21827906 spots for SRR5645253.sra Read 21827906 spots for SRR5645253.sra Written 21827906 spots for SRR5645253.sra Read 21827906 spots for SRR5645253.sra Written 21827906 spots for SRR5645253.sra Read 21827906 spots for SRR5645253.sra Written 21827906 spots for SRR5645253.sra Read 21827906 spots for SRR5645253.sra Written 21827906 spots for SRR5645253.sra Read 21827906 spots for SRR5645253.sra Written 21827906 spots for SRR5645253.sra Read 21827906 spots for SRR5645253.sra Written 21827906 spots for SRR5645253.sra Read 21827906 spots for SRR5645253.sra Written 21827906 spots for SRR5645253.sra Read 21827906 spots for SRR5645253.sra Written 21827906 spots for SRR5645253.sra SRR ids: ['SRR5645253.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_msj01dy2 SRR5645253.sra spots: 436558137 blocks: [[1, 21827906], [21827907, 43655812], [43655813, 65483718], [65483719, 87311624], [87311625, 109139530], [109139531, 130967436], [130967437, 152795342], [152795343, 174623248], [174623249, 196451154], [196451155, 218279060], [218279061, 240106966], [240106967, 261934872], [261934873, 283762778], [283762779, 305590684], [305590685, 327418590], [327418591, 349246496], [349246497, 371074402], [371074403, 392902308], [392902309, 414730214], [414730215, 436558137]] SRR5645253 file size 75985241 SRR5645253 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5645253 SRR5645253_1.fastq Input file: SRR5645253_1.fastq trimmed: SRR5645253-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 14:50:56 2024 >> started Mon Dec 9 14:59:47 2024 >> done (530.636s) 436558137 reads processed; of these: 456084 ( 0.10%) short reads filtered out after trimming by size control 113575 ( 0.03%) empty reads filtered out after trimming by size control 435988478 (99.87%) reads available; of these: 14458811 ( 3.32%) trimmed reads available after processing 421529667 (96.68%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 48834 0.01% 19 34574 0.01% 20 47251 0.01% 21 64853 0.01% 22 85577 0.02% 23 119339 0.03% 24 147648 0.03% 25 186346 0.04% 26 193152 0.04% 27 199808 0.05% 28 215499 0.05% 29 223527 0.05% 30 226929 0.05% 31 242048 0.06% 32 246915 0.06% 33 253717 0.06% 34 262427 0.06% 35 266573 0.06% 36 288133 0.07% 37 336220 0.08% 38 372838 0.09% 39 409902 0.09% 40 456686 0.10% 41 517584 0.12% 42 601151 0.14% 43 688771 0.16% 44 798614 0.18% 45 959243 0.22% 46 1201542 0.28% 47 1523254 0.35% 48 1794528 0.41% 49 1445328 0.33% 50 421529667 96.68% 435988478 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=108.88 fanout-score-rank=10 prefix-density=0.84 prefix-fanout=17.8 sequence=CGCCGCCGCCGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=11 fanout-score=233.92 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=17.8 sequence=CGCCGCCGCCGTC Started job on | Dec 09 15:02:05 Started mapping on | Dec 09 15:02:18 Finished on | Dec 09 15:08:18 Mapping speed, Million of reads per hour | 4359.88 Number of input reads | 435988478 Average input read length | 49 UNIQUE READS: Uniquely mapped reads number | 375683600 Uniquely mapped reads % | 86.17% Average mapped length | 48.84 Number of splices: Total | 52054731 Number of splices: Annotated (sjdb) | 49319302 Number of splices: GT/AG | 51343701 Number of splices: GC/AG | 601672 Number of splices: AT/AC | 34814 Number of splices: Non-canonical | 74544 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 18503163 % of reads mapped to multiple loci | 4.24% Number of reads mapped to too many loci | 36203227 % of reads mapped to too many loci | 8.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.07% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 41801715 41801715 41801715 N_multimapping 18503163 18503163 18503163 N_noFeature 12959461 192251572 192169736 N_ambiguous 4741865 323950 226115 UnstrandedReadsAssigned:357982274 PositiveStrandReadsAssigned:183108078 NegativeStrandReadsAssigned:183287749 Dataset is classified unstranded MeadianReadLen=50 20thPercentileLength=50 echo kmer=45 SRR5645253 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: SRR5645253-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 435,988,478 reads, 366,544,069 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,327 rounds 52973 SRR5645253.ke.tsv 35125 SRR5645253.se.tsv 88098 total ==> SRR5645253.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 48.6471 0.244416 PNS24247 1044 945 351.948 1.56619 PNS24249 1928 1829 4863.67 11.1827 PNS24246 1044 945 351.948 1.56619 PNS24248 1044 945 351.948 1.56619 PNS24244 1471 1372 105.837 0.324399 PNS24243 293 194 70 1.51738 KQK14069 1603 1504 25069.7 70.0969 KQK14071 474 375 11456.2 128.471 ==> SRR5645253.se.tsv <== BRADI_1g14170v3 38832 BRADI_1g53295v3 656 BRADI_1g59795v3 4034 BRADI_1g07683v3 0 BRADI_1g00485v3 1927 BRADI_1g20270v3 84347 BRADI_1g74790v3 2374 BRADI_1g09890v3 5 BRADI_1g77505v3 7705 BRADI_1g48960v3 4 SRR5645253 completed mapping pipeline successfully