Starting /dee2/code/volunteer_pipeline.sh SRR5831617 current disk space = 1548415324160 free memory = 1596130152 SRR5831617 SRAfilesize 5057af4d827162dc4da514fcfd495fd0 SRR5831617.sra SRR5831617.sra file validated SRR5831617 is paired end SRR5831617 is conventional basespace SRR5831617 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5831617_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.52725 32.0 32.0 32.0 32.0 32.0 2 31.57425 32.0 32.0 32.0 32.0 32.0 3 35.2075 37.0 37.0 37.0 32.0 37.0 4 34.062 37.0 32.0 37.0 27.0 37.0 5 36.34825 37.0 37.0 37.0 37.0 37.0 6 39.34075 42.0 37.0 42.0 32.0 42.0 7 39.80175 42.0 37.0 42.0 37.0 42.0 8 40.38275 42.0 42.0 42.0 37.0 42.0 9 39.79375 42.0 37.0 42.0 32.0 42.0 10-14 39.803 42.0 39.0 42.0 35.0 42.0 15-19 37.53 41.0 35.0 42.0 27.8 42.0 20-24 37.28574999999999 41.0 36.0 42.0 28.0 42.0 25-29 37.963350000000005 42.0 36.0 42.0 29.0 42.0 30-34 35.46705000000001 40.0 32.0 42.0 20.6 42.0 35-39 36.79735000000001 41.0 36.0 42.0 23.8 42.0 40-44 35.78785 39.0 33.0 42.0 25.8 42.0 45-49 38.17045 42.0 36.0 42.0 29.0 42.0 50-54 31.9815 35.0 22.6 40.0 17.4 42.0 55-59 35.91375000000001 39.0 34.0 42.0 21.8 42.0 60-64 37.33605 42.0 36.0 42.0 26.0 42.0 65-69 36.29350000000001 41.0 34.0 42.0 23.8 42.0 70-74 35.65335 39.0 33.0 42.0 19.6 42.0 75-79 36.0246 39.0 34.0 42.0 22.8 42.0 80-84 35.3492 39.0 33.0 42.0 20.6 42.0 85-89 36.27615000000001 40.0 35.0 42.0 23.8 42.0 90-94 38.522949999999994 42.0 37.0 42.0 31.0 42.0 95-99 34.737849999999995 38.0 31.0 42.0 18.6 42.0 100-104 34.492999999999995 38.0 32.0 42.0 13.2 42.0 105-109 34.7688 38.0 32.0 42.0 15.4 42.0 110-114 35.23855 39.0 33.0 42.0 18.6 42.0 115-119 35.98855 40.0 33.0 42.0 20.8 42.0 120-124 32.1397 36.0 26.8 40.0 15.4 42.0 125-129 31.896950000000004 35.0 25.8 40.0 17.6 42.0 130-134 34.5752 38.0 31.0 42.0 20.8 42.0 135-139 32.61355 36.0 27.0 42.0 15.4 42.0 140-144 30.89535 34.0 23.8 40.0 13.2 42.0 145-149 32.8124 35.0 28.0 42.0 15.4 42.0 150 31.862 37.0 27.0 42.0 11.0 42.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 7.0 22 3.0 23 10.0 24 29.0 25 28.0 26 60.0 27 63.0 28 74.0 29 105.0 30 146.0 31 184.0 32 215.0 33 251.0 34 355.0 35 383.0 36 443.0 37 528.0 38 405.0 39 389.0 40 263.0 41 58.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.900000000000002 9.675 14.524999999999999 43.9 2 29.025000000000002 11.924999999999999 30.275000000000002 28.775000000000002 3 25.35 16.575 23.5 34.575 4 29.825000000000003 21.45 18.4 30.325000000000003 5 30.25 24.325 20.9 24.525 6 24.3 30.0 21.8 23.9 7 18.95 24.224999999999998 34.975 21.85 8 20.825 22.45 28.9 27.825 9 22.05 20.5 31.55 25.900000000000002 10-14 24.205 25.585 23.9 26.31 15-19 25.072507250725074 25.052505250525055 23.452345234523452 26.422642264226422 20-24 25.009999999999998 24.95 24.044999999999998 25.995 25-29 24.842484248424842 23.50735073507351 24.01740174017402 27.632763276327633 30-34 24.350877192982455 24.69172932330827 23.583959899749374 27.3734335839599 35-39 24.515 24.87 23.66 26.955000000000002 40-44 24.25591516182282 25.211345105297383 23.2504627082187 27.2822770246611 45-49 24.56745674567457 24.04740474047405 23.812381238123812 27.57275727572757 50-54 24.43 24.955 22.985 27.63 55-59 25.5133727336472 23.780426725433237 23.610137233296605 27.09606330762296 60-64 25.324999999999996 23.66 23.494999999999997 27.52 65-69 24.921151439299123 24.14518147684606 23.409261576971215 27.524405506883603 70-74 25.691284564228212 24.401220061003052 22.55112755637782 27.35636781839092 75-79 24.795 23.855 23.235 28.115000000000002 80-84 25.04501800720288 24.52981192476991 23.624449779911966 26.800720288115247 85-89 25.52127606380319 22.991149557477875 23.231161558077904 28.25641282064103 90-94 25.735000000000003 23.77 23.345 27.150000000000002 95-99 24.7999599919984 24.34486897379476 23.529705941188237 27.325465093018604 100-104 24.593282274615806 24.072683586124043 23.51203884467137 27.821995294588774 105-109 25.226261313065653 23.321166058302914 23.611180559027954 27.841392069603483 110-114 25.83796783405982 24.074352422466056 23.037226313943584 27.050453429530535 115-119 25.655 23.0 23.875 27.47 120-124 25.328865102785976 24.568599009653376 22.06272195268344 28.039813934877206 125-129 25.96428035419481 24.21331732452849 22.467357046375508 27.355045274901197 130-134 25.923888583287493 23.81357203580537 22.20833124968745 28.05420813121968 135-139 25.834208814848164 24.998749312121667 22.157186452548903 27.009855420481266 140-144 25.5 24.895 21.9 27.705000000000002 145-149 26.39 24.675 21.73 27.205000000000002 150 24.325 25.124999999999996 22.3 28.249999999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.5 2 0.5 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.5 13 1.0 14 0.5 15 0.5 16 0.5 17 0.0 18 1.0 19 2.0 20 1.0 21 0.5 22 1.5 23 1.5 24 0.5 25 1.0 26 2.0 27 2.5 28 2.5 29 3.5 30 5.5 31 8.0 32 11.0 33 11.0 34 18.0 35 30.0 36 31.5 37 37.5 38 66.5 39 86.0 40 94.5 41 113.5 42 137.5 43 147.0 44 149.5 45 152.5 46 168.5 47 175.0 48 159.5 49 166.0 50 159.0 51 139.0 52 128.0 53 122.0 54 108.0 55 99.0 56 96.5 57 83.5 58 78.0 59 82.0 60 80.5 61 77.5 62 74.0 63 66.0 64 73.0 65 73.0 66 66.5 67 74.0 68 67.0 69 58.0 70 56.0 71 51.5 72 52.0 73 42.5 74 37.5 75 37.0 76 28.0 77 21.0 78 16.5 79 18.5 80 15.0 81 6.5 82 5.5 83 5.0 84 3.0 85 1.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.01 20-24 0.0 25-29 0.01 30-34 0.25 35-39 0.0 40-44 0.045 45-49 0.01 50-54 0.0 55-59 0.16999999999999998 60-64 0.0 65-69 0.125 70-74 0.005 75-79 0.0 80-84 0.04 85-89 0.005 90-94 0.0 95-99 0.02 100-104 0.11499999999999999 105-109 0.005 110-114 0.20500000000000002 115-119 0.0 120-124 0.034999999999999996 125-129 0.055 130-134 0.015 135-139 0.055 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.1 #Duplication Level Percentage of deduplicated Percentage of total 1 98.1651376146789 96.3 2 1.7584097859327217 3.45 3 0.05096839959225281 0.15 4 0.025484199796126403 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.3125 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.44999999999999996 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.7 0.0 0.0 0.0 0.0 112-113 0.825 0.0 0.0 0.0 0.0 114-115 0.9 0.0 0.0 0.0 0.0 116-117 0.9875 0.0 0.0 0.0 0.0 118-119 1.1375 0.0 0.0 0.0 0.0 120-121 1.35 0.0 0.0 0.0 0.0 122-123 1.6124999999999998 0.0 0.0 0.0 0.0 124-125 1.9375 0.0 0.0 0.0 0.0 126-127 2.15 0.0 0.0 0.0 0.0 128-129 2.45 0.0 0.0 0.0 0.0 130-131 2.8875 0.0 0.0 0.0 0.0 132-133 3.1375 0.0 0.0 0.0 0.0 134-135 3.5125 0.0 0.0 0.0 0.0 136-137 3.9875 0.0 0.0 0.0 0.0 138 4.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5831617 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5831617_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.381 32.0 32.0 32.0 32.0 32.0 2 32.002 32.0 32.0 32.0 32.0 37.0 3 35.15625 37.0 37.0 37.0 32.0 37.0 4 35.941 37.0 37.0 37.0 32.0 37.0 5 36.10825 37.0 37.0 37.0 37.0 37.0 6 39.0945 42.0 37.0 42.0 32.0 42.0 7 39.6385 42.0 37.0 42.0 37.0 42.0 8 39.6165 42.0 37.0 42.0 37.0 42.0 9 40.11675 42.0 42.0 42.0 37.0 42.0 10-14 39.84475 42.0 41.0 42.0 36.0 42.0 15-19 39.04665 42.0 37.0 42.0 33.0 42.0 20-24 38.8982 42.0 37.0 42.0 32.0 42.0 25-29 38.2308 42.0 37.0 42.0 29.0 42.0 30-34 39.2639 42.0 37.0 42.0 33.0 42.0 35-39 38.64375 42.0 37.0 42.0 32.0 42.0 40-44 38.303549999999994 42.0 36.0 42.0 30.0 42.0 45-49 38.0686 42.0 37.0 42.0 30.0 42.0 50-54 38.1426 42.0 37.0 42.0 32.0 42.0 55-59 37.7868 42.0 37.0 42.0 29.0 42.0 60-64 36.4681 41.0 36.0 42.0 23.8 42.0 65-69 35.992399999999996 40.0 35.0 42.0 23.8 42.0 70-74 37.2255 42.0 37.0 42.0 28.0 42.0 75-79 36.791700000000006 40.0 36.0 42.0 27.0 42.0 80-84 37.44945 42.0 36.0 42.0 28.0 42.0 85-89 37.41695 42.0 37.0 42.0 28.0 42.0 90-94 37.54475 42.0 37.0 42.0 30.0 42.0 95-99 36.5146 41.0 34.0 42.0 26.0 42.0 100-104 35.104 37.0 32.0 42.0 20.8 42.0 105-109 33.845150000000004 36.0 30.0 42.0 19.8 42.0 110-114 34.63105 37.0 32.0 42.0 19.8 42.0 115-119 33.425799999999995 36.0 31.0 42.0 19.8 42.0 120-124 33.33385 36.0 31.0 42.0 19.8 42.0 125-129 30.798099999999998 33.0 23.8 39.0 13.2 42.0 130-134 29.18845 31.0 22.8 37.0 11.0 42.0 135-139 29.460500000000003 31.0 22.8 36.0 13.2 42.0 140-144 28.61875 31.0 21.8 37.0 11.0 42.0 145-149 29.13715 31.0 22.8 36.0 11.0 42.0 150 29.2935 32.0 22.0 37.0 11.0 42.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 0.0 17 3.0 18 2.0 19 5.0 20 3.0 21 14.0 22 12.0 23 17.0 24 20.0 25 20.0 26 35.0 27 55.0 28 63.0 29 79.0 30 111.0 31 150.0 32 197.0 33 257.0 34 298.0 35 429.0 36 479.0 37 522.0 38 558.0 39 385.0 40 225.0 41 60.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.900000000000006 15.325 11.875 38.9 2 28.975 23.45 27.500000000000004 20.075000000000003 3 26.8 26.775 21.45 24.975 4 28.999999999999996 29.099999999999998 17.275 24.625 5 30.25 31.175000000000004 19.5 19.075 6 23.425 36.35 18.2 22.025 7 24.325 18.3 32.725 24.65 8 23.599999999999998 22.475 24.7 29.225 9 24.875 20.724999999999998 25.275 29.125 10-14 26.63766376637664 25.227522752275227 21.752175217521753 26.38263826382638 15-19 26.642664266426642 23.882388238823882 23.142314231423143 26.332633263326333 20-24 27.245 24.83 22.53 25.395 25-29 27.295 24.36 22.195 26.150000000000002 30-34 27.169999999999998 24.345 22.455 26.029999999999998 35-39 27.005000000000003 24.16 22.295 26.540000000000003 40-44 27.07270727072707 24.127412741274128 22.517251725172517 26.282628262826286 45-49 27.279999999999998 23.46 22.935 26.325 50-54 27.229999999999997 23.745 23.235 25.790000000000003 55-59 27.798339501850556 23.066920076022807 23.15694708412524 25.977793338001398 60-64 27.134999999999998 23.91 23.005 25.95 65-69 27.30778863010268 23.37089907337841 23.45604808414726 25.865264212371653 70-74 28.172398257996694 22.841267457576212 22.976422886319266 26.00991139810783 75-79 26.902690269026902 23.937393739373938 23.37233723372337 25.78757875787579 80-84 27.062243159266313 23.729578029467778 22.962814473288564 26.24536433797735 85-89 27.765 23.45 23.185 25.6 90-94 28.11562312462493 23.234646929385878 22.904580916183235 25.745149029805965 95-99 27.925 24.46 22.46 25.155 100-104 27.92639631981599 23.52617630881544 23.166158307915396 25.38126906345317 105-109 27.746330711816864 24.064519360817513 22.356359264639583 25.83279066272604 110-114 27.4977497749775 23.77737773777378 22.922292229222922 25.802580258025802 115-119 27.756920458527308 24.007608750062573 22.82124443109576 25.414226360314363 120-124 27.816195630386854 23.441571457205853 23.37141711765885 25.370815794748445 125-129 27.725 24.19 23.01 25.074999999999996 130-134 28.830947853067762 24.286858172355117 22.315083575217695 24.567110399359425 135-139 28.273824427863186 24.20251389653964 22.8504181481296 24.673243527467577 140-144 28.866082603254068 24.440550688360453 22.072590738423028 24.62077596996245 145-149 29.56255643623959 24.786796428213105 22.268486003812583 23.382161131734726 150 28.275 24.75 22.95 24.025 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 2.0 20 2.0 21 1.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 2.5 28 2.5 29 2.0 30 1.5 31 6.0 32 9.5 33 9.5 34 18.0 35 29.5 36 28.0 37 35.5 38 48.5 39 61.0 40 85.0 41 108.0 42 119.5 43 126.0 44 141.0 45 156.0 46 154.0 47 160.5 48 172.5 49 164.0 50 141.5 51 128.5 52 123.0 53 112.5 54 111.5 55 107.5 56 108.0 57 114.0 58 103.0 59 81.5 60 91.0 61 96.0 62 83.0 63 83.0 64 80.5 65 79.0 66 82.0 67 74.5 68 68.0 69 66.5 70 65.0 71 58.5 72 53.0 73 52.0 74 47.5 75 39.5 76 24.5 77 14.5 78 14.0 79 14.0 80 9.0 81 8.0 82 5.5 83 2.5 84 1.5 85 0.5 86 0.5 87 0.0 88 0.5 89 0.5 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.01 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.01 45-49 0.0 50-54 0.0 55-59 0.03 60-64 0.0 65-69 0.17500000000000002 70-74 0.11499999999999999 75-79 0.01 80-84 0.22999999999999998 85-89 0.0 90-94 0.02 95-99 0.0 100-104 0.005 105-109 0.185 110-114 0.01 115-119 0.11499999999999999 120-124 0.22 125-129 0.0 130-134 0.09 135-139 0.155 140-144 0.125 145-149 0.33 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.475 #Duplication Level Percentage of deduplicated Percentage of total 1 96.60533817051049 93.2 2 3.2910080331692146 6.35 3 0.07774034724021767 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025913449080072558 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 9 0.22499999999999998 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.175 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2125 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.625 0.0 0.0 0.0 0.0 110-111 0.7749999999999999 0.0 0.0 0.0 0.0 112-113 0.9375 0.0 0.0 0.0 0.0 114-115 1.0499999999999998 0.0 0.0 0.0 0.0 116-117 1.1625 0.0 0.0 0.0 0.0 118-119 1.3375 0.0 0.0 0.0 0.0 120-121 1.6375000000000002 0.0 0.0 0.0 0.0 122-123 1.925 0.0 0.0 0.0 0.0 124-125 2.2875 0.0 0.0 0.0 0.0 126-127 2.5375 0.0 0.0 0.0 0.0 128-129 2.8499999999999996 0.0 0.0 0.0 0.0 130-131 3.2874999999999996 0.0 0.0 0.0 0.0 132-133 3.625 0.0 0.0 0.0 0.0 134-135 4.0875 0.0 0.0 0.0 0.0 136-137 4.5875 0.0 0.0 0.0 0.0 138 4.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGACCG 10 0.0069845165 143.925 5 >>END_MODULE Read 1320035 spots for SRR5831617.sra Written 1320035 spots for SRR5831617.sra Read 1320037 spots for SRR5831617.sra Written 1320037 spots for SRR5831617.sra Read 1320035 spots for SRR5831617.sra Written 1320035 spots for SRR5831617.sra Read 1320035 spots for SRR5831617.sra Written 1320035 spots for SRR5831617.sra Read 1320035 spots for SRR5831617.sra Written 1320035 spots for SRR5831617.sra Read 1320035 spots for SRR5831617.sra Written 1320035 spots for SRR5831617.sra Read 1320035 spots for SRR5831617.sra Written 1320035 spots for SRR5831617.sra Read 1320035 spots for SRR5831617.sra Written 1320035 spots for SRR5831617.sra Read 1320035 spots for SRR5831617.sra Written 1320035 spots for SRR5831617.sra Read 1320035 spots for SRR5831617.sra Written 1320035 spots for SRR5831617.sra Read 1320035 spots for SRR5831617.sra Written 1320035 spots for SRR5831617.sra Read 1320035 spots for SRR5831617.sra Written 1320035 spots for SRR5831617.sra Read 1320035 spots for SRR5831617.sra Written 1320035 spots for SRR5831617.sra Read 1320035 spots for SRR5831617.sra Written 1320035 spots for SRR5831617.sra Read 1320035 spots for SRR5831617.sra Written 1320035 spots for SRR5831617.sra Read 1320035 spots for SRR5831617.sra Written 1320035 spots for SRR5831617.sra Read 1320035 spots for SRR5831617.sra Written 1320035 spots for SRR5831617.sra Read 1320035 spots for SRR5831617.sra Written 1320035 spots for SRR5831617.sra Read 1320035 spots for SRR5831617.sra Written 1320035 spots for SRR5831617.sra Read 1320035 spots for SRR5831617.sra Written 1320035 spots for SRR5831617.sra SRR ids: ['SRR5831617.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0h675h51 SRR5831617.sra spots: 26400702 blocks: [[1, 1320035], [1320036, 2640070], [2640071, 3960105], [3960106, 5280140], [5280141, 6600175], [6600176, 7920210], [7920211, 9240245], [9240246, 10560280], [10560281, 11880315], [11880316, 13200350], [13200351, 14520385], [14520386, 15840420], [15840421, 17160455], [17160456, 18480490], [18480491, 19800525], [19800526, 21120560], [21120561, 22440595], [22440596, 23760630], [23760631, 25080665], [25080666, 26400702]] SRR5831617 file size 8873067 SRR5831617 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5831617 SRR5831617_1.fastq SRR5831617_2.fastq Input file: SRR5831617_1.fastq Paired file: SRR5831617_2.fastq trimmed: SRR5831617-trimmed-pair1.fastq, SRR5831617-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 01:15:12 2024 >> started Sat Dec 7 01:15:40 2024 >> done (28.189s) 26400702 read pairs processed; of these: 1823 ( 0.01%) short read pairs filtered out after trimming by size control 76611 ( 0.29%) empty read pairs filtered out after trimming by size control 26322268 (99.70%) read pairs available; of these: 3044234 (11.57%) trimmed read pairs available after processing 23278034 (88.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 101 0.00% 19 91 0.00% 20 103 0.00% 21 102 0.00% 22 95 0.00% 23 90 0.00% 24 110 0.00% 25 104 0.00% 26 121 0.00% 27 101 0.00% 28 105 0.00% 29 105 0.00% 30 128 0.00% 31 105 0.00% 32 127 0.00% 33 113 0.00% 34 123 0.00% 35 139 0.00% 36 143 0.00% 37 112 0.00% 38 134 0.00% 39 135 0.00% 40 127 0.00% 41 149 0.00% 42 172 0.00% 43 186 0.00% 44 176 0.00% 45 208 0.00% 46 178 0.00% 47 181 0.00% 48 174 0.00% 49 166 0.00% 50 162 0.00% 51 204 0.00% 52 206 0.00% 53 215 0.00% 54 222 0.00% 55 252 0.00% 56 218 0.00% 57 274 0.00% 58 237 0.00% 59 265 0.00% 60 295 0.00% 61 313 0.00% 62 377 0.00% 63 356 0.00% 64 420 0.00% 65 424 0.00% 66 405 0.00% 67 401 0.00% 68 466 0.00% 69 513 0.00% 70 510 0.00% 71 546 0.00% 72 640 0.00% 73 686 0.00% 74 757 0.00% 75 851 0.00% 76 894 0.00% 77 952 0.00% 78 1026 0.00% 79 1027 0.00% 80 1072 0.00% 81 1160 0.00% 82 1345 0.01% 83 1443 0.01% 84 1665 0.01% 85 1870 0.01% 86 2096 0.01% 87 2168 0.01% 88 2299 0.01% 89 2626 0.01% 90 2659 0.01% 91 2954 0.01% 92 3207 0.01% 93 3547 0.01% 94 4088 0.02% 95 4665 0.02% 96 4979 0.02% 97 5507 0.02% 98 6021 0.02% 99 6461 0.02% 100 7000 0.03% 101 7364 0.03% 102 7855 0.03% 103 8811 0.03% 104 9583 0.04% 105 10446 0.04% 106 11662 0.04% 107 12996 0.05% 108 13956 0.05% 109 15161 0.06% 110 15846 0.06% 111 17038 0.06% 112 18542 0.07% 113 19883 0.08% 114 21284 0.08% 115 23346 0.09% 116 25255 0.10% 117 27277 0.10% 118 29488 0.11% 119 31530 0.12% 120 33364 0.13% 121 35430 0.13% 122 36745 0.14% 123 39060 0.15% 124 41796 0.16% 125 44154 0.17% 126 46771 0.18% 127 49902 0.19% 128 53616 0.20% 129 56555 0.21% 130 60095 0.23% 131 62487 0.24% 132 65233 0.25% 133 67807 0.26% 134 70187 0.27% 135 72683 0.28% 136 76938 0.29% 137 80055 0.30% 138 83504 0.32% 139 88987 0.34% 140 92915 0.35% 141 95122 0.36% 142 99113 0.38% 143 102264 0.39% 144 104407 0.40% 145 107198 0.41% 146 111154 0.42% 147 116939 0.44% 148 139593 0.53% 149 495687 1.88% 150 23278034 88.43% 26322268 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=11.72 fanout-score-rank=14 prefix-density=0.53 prefix-fanout=6.4 sequence=CTCCAGCTCCTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=13 fanout-score=323.47 fanout-score-rank=1 prefix-density=1.01 prefix-fanout=34.1 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=12.75 fanout-score-rank=23 prefix-density=0.44 prefix-fanout=7.5 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.11 sequence-density-rank=21 fanout-score=246.43 fanout-score-rank=1 prefix-density=1.09 prefix-fanout=25.1 sequence=CGCCGCCGCCGTCG SRR5831617 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 01:17:01 Started mapping on | Dec 07 01:17:02 Finished on | Dec 07 01:20:27 Mapping speed, Million of reads per hour | 462.24 Number of input reads | 26322268 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 23220565 Uniquely mapped reads % | 88.22% Average mapped length | 291.15 Number of splices: Total | 23687173 Number of splices: Annotated (sjdb) | 22483857 Number of splices: GT/AG | 23357035 Number of splices: GC/AG | 281435 Number of splices: AT/AC | 14871 Number of splices: Non-canonical | 33832 Mismatch rate per base, % | 0.58% Deletion rate per base | 0.01% Deletion average length | 2.25 Insertion rate per base | 0.01% Insertion average length | 2.48 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 329499 % of reads mapped to multiple loci | 1.25% Number of reads mapped to too many loci | 46137 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.06% % of reads unmapped: other | 1.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2772204 2772204 2772204 N_multimapping 329499 329499 329499 N_noFeature 399701 22191008 1058740 N_ambiguous 485774 7040 116153 UnstrandedReadsAssigned:22335090 PositiveStrandReadsAssigned:1022517 NegativeStrandReadsAssigned:22045672 Dataset is classified negative stranded MeadianReadLen=146 20thPercentileLength=146 echo kmer=141 SRR5831617 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5831617-trimmed-pair1.fastq SRR5831617-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,322,268 reads, 24,007,477 reads pseudoaligned [quant] estimated average fragment length: 211.079 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,206 rounds 52973 SRR5831617.ke.tsv 35125 SRR5831617.se.tsv 88098 total ==> SRR5831617.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 726.287 0 0 PNS24247 1044 833.921 25.6526 1.51731 PNS24249 1928 1717.92 161.629 4.64071 PNS24246 1044 833.921 25.6526 1.51731 PNS24248 1044 833.921 25.6526 1.51731 PNS24244 1471 1260.92 46.4138 1.81564 PNS24243 293 97.7705 0 0 KQK14069 1603 1392.92 8233.54 291.561 KQK14071 474 267.866 221.002 40.6956 ==> SRR5831617.se.tsv <== BRADI_1g14170v3 8252 BRADI_1g53295v3 31 BRADI_1g59795v3 105 BRADI_1g07683v3 0 BRADI_1g00485v3 13 BRADI_1g20270v3 1495 BRADI_1g74790v3 1582 BRADI_1g09890v3 0 BRADI_1g77505v3 409 BRADI_1g48960v3 0 SRR5831617 completed mapping pipeline successfully