Starting /dee2/code/volunteer_pipeline.sh SRR5831618 current disk space = 1548401180672 free memory = 1597241948 SRR5831618 SRAfilesize 9a2070e5c797c0aa20394304b34bb975 SRR5831618.sra SRR5831618.sra file validated SRR5831618 is paired end SRR5831618 is conventional basespace SRR5831618 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5831618_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.3035 32.0 32.0 32.0 32.0 32.0 2 31.379 32.0 32.0 32.0 27.0 32.0 3 35.41275 37.0 37.0 37.0 32.0 37.0 4 34.38825 37.0 37.0 37.0 27.0 37.0 5 36.22675 37.0 37.0 37.0 37.0 37.0 6 39.939 42.0 37.0 42.0 37.0 42.0 7 40.06075 42.0 37.0 42.0 37.0 42.0 8 40.3955 42.0 42.0 42.0 37.0 42.0 9 39.97425 42.0 42.0 42.0 37.0 42.0 10-14 39.9063 42.0 40.0 42.0 35.0 42.0 15-19 37.7556 41.0 36.0 42.0 27.8 42.0 20-24 37.4625 41.0 36.0 42.0 28.0 42.0 25-29 38.0652 42.0 37.0 42.0 29.0 42.0 30-34 35.6844 40.0 33.0 42.0 20.6 42.0 35-39 37.03955 41.0 36.0 42.0 24.8 42.0 40-44 35.9405 40.0 33.0 42.0 25.8 42.0 45-49 38.314949999999996 42.0 36.0 42.0 29.0 42.0 50-54 32.4221 36.0 23.6 40.0 17.4 42.0 55-59 36.24285 39.0 35.0 42.0 23.8 42.0 60-64 37.430699999999995 42.0 37.0 42.0 27.0 42.0 65-69 36.5855 41.0 34.0 42.0 24.8 42.0 70-74 35.6964 39.0 34.0 42.0 19.6 42.0 75-79 36.348 40.0 34.0 42.0 26.0 42.0 80-84 35.5175 39.0 33.0 42.0 21.6 42.0 85-89 36.51854999999999 41.0 35.0 42.0 23.8 42.0 90-94 38.579100000000004 42.0 38.0 42.0 31.0 42.0 95-99 34.967600000000004 38.0 31.0 42.0 18.6 42.0 100-104 34.782650000000004 38.0 32.0 42.0 13.2 42.0 105-109 34.91215 38.0 32.0 42.0 15.4 42.0 110-114 35.4624 39.0 33.0 42.0 19.6 42.0 115-119 36.1943 41.0 34.0 42.0 23.0 42.0 120-124 32.44325 36.0 26.8 40.0 16.4 42.0 125-129 32.2789 35.0 25.8 41.0 17.6 42.0 130-134 34.85685 38.0 32.0 42.0 20.8 42.0 135-139 33.01035 37.0 27.0 42.0 15.4 42.0 140-144 31.3376 35.0 23.8 41.0 13.2 42.0 145-149 33.0961 35.0 29.0 42.0 17.6 42.0 150 32.14225 37.0 27.0 42.0 11.0 42.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 2.0 22 8.0 23 15.0 24 25.0 25 38.0 26 50.0 27 50.0 28 77.0 29 107.0 30 134.0 31 182.0 32 194.0 33 250.0 34 287.0 35 365.0 36 437.0 37 484.0 38 431.0 39 451.0 40 337.0 41 74.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.925 9.475 13.600000000000001 44.0 2 28.725 10.95 30.775000000000002 29.549999999999997 3 25.474999999999998 15.85 23.275000000000002 35.4 4 28.95 20.7 18.95 31.4 5 29.775000000000002 24.6 21.45 24.175 6 24.075 29.675 22.6 23.65 7 18.15 26.275 34.1 21.475 8 20.25 24.375 30.475 24.9 9 21.275 21.45 30.85 26.424999999999997 10-14 24.38 26.305 23.405 25.91 15-19 24.897489748974895 23.827382738273826 24.49244924492449 26.782678267826782 20-24 24.455 24.935 24.099999999999998 26.51 25-29 24.197419741974198 24.852485248524854 23.75237523752375 27.197719771977198 30-34 24.863374279267987 25.154173978440713 22.94309350714465 27.039358235146654 35-39 24.665 24.755 23.595 26.985 40-44 24.21089490270622 25.48646891100995 23.145415436946625 27.157220749337203 45-49 25.15751575157516 23.737373737373737 23.487348734873486 27.61776177617762 50-54 24.385 25.28 23.419999999999998 26.915 55-59 25.267955524391468 23.88560552939998 23.590103175398177 27.25633577081038 60-64 25.165 23.62 23.549999999999997 27.665 65-69 25.806128580012018 24.65952333266573 22.50650911275786 27.02783897456439 70-74 25.03625181259063 24.17120856042802 23.35116755837792 27.44137206860343 75-79 24.89 24.19 23.455000000000002 27.465 80-84 25.809033161606564 23.943380183064072 23.178112339318762 27.069474316010606 85-89 25.85129256462823 23.60118005900295 23.316165808290414 27.231361568078405 90-94 26.11 23.185 23.585 27.12 95-99 25.712713814144244 24.087226167850357 22.371711513454038 27.828348504551364 100-104 25.93371382797637 23.5606288174627 23.08000400520677 27.425653349354164 105-109 25.43627181359068 23.201160058002902 23.34116705835292 28.021401070053503 110-114 26.085430662789534 23.668906046325077 22.997092148801766 27.248571142083627 115-119 25.919999999999998 23.31 23.04 27.73 120-124 25.508928124843695 24.453558745560947 21.87265542940029 28.164857700195068 125-129 25.781758142792814 24.425876819932956 22.504628008205334 27.287737029068893 130-134 26.27656914228557 24.656164041010253 22.1505376344086 26.916729182295573 135-139 25.62665732726272 24.81613048481513 21.724120678440986 27.83309150948116 140-144 25.840000000000003 25.03 21.85 27.279999999999998 145-149 25.745 25.045 21.605 27.605 150 26.05 24.5 22.25 27.200000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 1.0 3 1.0 4 0.5 5 0.0 6 0.0 7 0.5 8 1.0 9 1.0 10 0.5 11 1.0 12 1.0 13 1.0 14 1.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 1.0 24 0.5 25 2.5 26 4.5 27 5.0 28 2.5 29 2.0 30 5.0 31 9.0 32 16.5 33 18.5 34 19.0 35 26.5 36 38.5 37 53.0 38 63.5 39 76.5 40 107.5 41 118.5 42 130.0 43 143.5 44 154.5 45 161.0 46 161.5 47 168.0 48 167.0 49 159.0 50 143.5 51 137.5 52 127.0 53 121.0 54 112.5 55 102.0 56 90.5 57 70.5 58 66.5 59 75.0 60 75.0 61 79.5 62 76.5 63 67.5 64 66.5 65 64.0 66 65.0 67 68.5 68 68.5 69 65.0 70 50.0 71 43.5 72 54.5 73 51.5 74 43.5 75 37.5 76 34.0 77 27.0 78 20.5 79 20.5 80 18.0 81 13.0 82 5.0 83 4.0 84 4.0 85 1.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.01 20-24 0.0 25-29 0.01 30-34 0.27499999999999997 35-39 0.0 40-44 0.045 45-49 0.01 50-54 0.0 55-59 0.16999999999999998 60-64 0.0 65-69 0.13999999999999999 70-74 0.005 75-79 0.0 80-84 0.034999999999999996 85-89 0.005 90-94 0.0 95-99 0.03 100-104 0.13 105-109 0.005 110-114 0.27 115-119 0.0 120-124 0.034999999999999996 125-129 0.065 130-134 0.025 135-139 0.065 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.7185337093053 95.3 2 2.230197385285824 4.35 3 0.02563445270443476 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02563445270443476 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACTTGAATCTCGTATGC 11 0.27499999999999997 TruSeq Adapter, Index 8 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.025 4 0.0 0.0 0.0 0.0 0.025 5 0.0 0.0 0.0 0.0 0.025 6 0.0 0.0 0.0 0.0 0.025 7 0.0 0.0 0.0 0.0 0.025 8 0.0 0.0 0.0 0.0 0.025 9 0.0 0.0 0.0 0.0 0.025 10-11 0.0 0.0 0.0 0.0 0.025 12-13 0.0 0.0 0.0 0.0 0.025 14-15 0.0 0.0 0.0 0.0 0.025 16-17 0.0 0.0 0.0 0.0 0.025 18-19 0.0 0.0 0.0 0.0 0.025 20-21 0.0 0.0 0.0 0.0 0.025 22-23 0.0 0.0 0.0 0.0 0.025 24-25 0.0 0.0 0.0 0.0 0.025 26-27 0.0 0.0 0.0 0.0 0.025 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.0 0.0 0.0 0.0 0.025 36-37 0.0 0.0 0.0 0.0 0.025 38-39 0.0 0.0 0.0 0.0 0.025 40-41 0.0 0.0 0.0 0.0 0.025 42-43 0.0 0.0 0.0 0.0 0.025 44-45 0.0 0.0 0.0 0.0 0.025 46-47 0.0 0.0 0.0 0.0 0.025 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0 0.0 0.0 0.0 0.025 60-61 0.0 0.0 0.0 0.0 0.025 62-63 0.0 0.0 0.0 0.0 0.025 64-65 0.0 0.0 0.0 0.0 0.025 66-67 0.0 0.0 0.0 0.0 0.025 68-69 0.0 0.0 0.0 0.0 0.025 70-71 0.0 0.0 0.0 0.0 0.025 72-73 0.0 0.0 0.0 0.0 0.025 74-75 0.0125 0.0 0.0 0.0 0.025 76-77 0.05 0.0 0.0 0.0 0.025 78-79 0.0625 0.0 0.0 0.0 0.025 80-81 0.0875 0.0 0.0 0.0 0.025 82-83 0.1 0.0 0.0 0.0 0.025 84-85 0.1 0.0 0.0 0.0 0.025 86-87 0.1 0.0 0.0 0.0 0.025 88-89 0.1 0.0 0.0 0.0 0.025 90-91 0.1125 0.0 0.0 0.0 0.025 92-93 0.2 0.0 0.0 0.0 0.025 94-95 0.2625 0.0 0.0 0.0 0.025 96-97 0.30000000000000004 0.0 0.0 0.0 0.025 98-99 0.35 0.0 0.0 0.0 0.025 100-101 0.4 0.0 0.0 0.0 0.025 102-103 0.48750000000000004 0.0 0.0 0.0 0.025 104-105 0.6375 0.0 0.0 0.0 0.025 106-107 0.8500000000000001 0.0 0.0 0.0 0.025 108-109 1.0375 0.0 0.0 0.0 0.025 110-111 1.325 0.0 0.0 0.0 0.025 112-113 1.6 0.0 0.0 0.0 0.025 114-115 1.7625 0.0 0.0 0.0 0.025 116-117 1.9874999999999998 0.0 0.0 0.0 0.025 118-119 2.125 0.0 0.0 0.0 0.025 120-121 2.4000000000000004 0.0 0.0 0.0 0.025 122-123 2.725 0.0 0.0 0.0 0.025 124-125 3.0875000000000004 0.0 0.0 0.0 0.025 126-127 3.575 0.0 0.0 0.0 0.025 128-129 3.9375 0.0 0.0 0.0 0.025 130-131 4.612500000000001 0.0 0.0 0.0 0.025 132-133 5.125 0.0 0.0 0.0 0.025 134-135 5.7875 0.0 0.0 0.0 0.025 136-137 6.4125 0.0 0.0 0.0 0.025 138 6.925 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTGCCG 10 0.006973645 144.0 7 >>END_MODULE SRR5831618 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5831618_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.373 32.0 32.0 32.0 32.0 32.0 2 31.343 32.0 32.0 32.0 27.0 37.0 3 35.11475 37.0 37.0 37.0 32.0 37.0 4 35.92925 37.0 37.0 37.0 32.0 37.0 5 36.0845 37.0 37.0 37.0 32.0 37.0 6 39.1105 42.0 37.0 42.0 32.0 42.0 7 39.6345 42.0 37.0 42.0 37.0 42.0 8 39.677 42.0 37.0 42.0 37.0 42.0 9 39.97075 42.0 42.0 42.0 37.0 42.0 10-14 39.82295 42.0 40.0 42.0 36.0 42.0 15-19 39.03555 42.0 37.0 42.0 32.0 42.0 20-24 38.8485 42.0 37.0 42.0 32.0 42.0 25-29 38.221000000000004 42.0 37.0 42.0 29.0 42.0 30-34 39.1549 42.0 37.0 42.0 32.0 42.0 35-39 38.48715 42.0 37.0 42.0 31.0 42.0 40-44 38.1219 42.0 36.0 42.0 30.0 42.0 45-49 37.94625 42.0 37.0 42.0 29.0 42.0 50-54 38.144600000000004 42.0 37.0 42.0 32.0 42.0 55-59 37.706100000000006 42.0 37.0 42.0 29.0 42.0 60-64 36.331900000000005 41.0 35.0 42.0 23.8 42.0 65-69 35.846199999999996 40.0 35.0 42.0 22.8 42.0 70-74 37.14175 42.0 36.0 42.0 28.0 42.0 75-79 36.7195 40.0 36.0 42.0 27.0 42.0 80-84 37.230999999999995 42.0 36.0 42.0 27.0 42.0 85-89 37.2755 42.0 37.0 42.0 28.0 42.0 90-94 37.2158 42.0 37.0 42.0 28.0 42.0 95-99 36.348299999999995 40.0 34.0 42.0 24.0 42.0 100-104 34.8274 37.0 32.0 42.0 20.8 42.0 105-109 33.66629999999999 36.0 29.0 42.0 19.8 42.0 110-114 34.3409 37.0 31.0 42.0 19.8 42.0 115-119 33.1304 36.0 30.0 42.0 19.8 42.0 120-124 33.07095 36.0 29.0 42.0 19.8 42.0 125-129 30.3328 33.0 22.8 39.0 11.0 42.0 130-134 28.9587 31.0 22.8 37.0 11.0 42.0 135-139 29.211350000000003 30.0 22.8 37.0 11.0 42.0 140-144 28.3161 30.0 21.8 37.0 11.0 42.0 145-149 28.9706 31.0 22.8 36.0 11.0 42.0 150 28.892 32.0 22.0 37.0 11.0 42.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 1.0 18 5.0 19 1.0 20 7.0 21 7.0 22 13.0 23 17.0 24 21.0 25 32.0 26 50.0 27 55.0 28 75.0 29 87.0 30 108.0 31 168.0 32 186.0 33 253.0 34 332.0 35 415.0 36 490.0 37 485.0 38 534.0 39 411.0 40 200.0 41 45.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.4 15.275 11.700000000000001 40.625 2 28.000000000000004 23.549999999999997 27.450000000000003 21.0 3 25.6 27.474999999999998 22.325 24.6 4 30.025000000000002 29.099999999999998 16.25 24.625 5 30.025000000000002 30.55 19.325 20.1 6 23.175 35.5 19.45 21.875 7 23.625 18.2 33.925 24.25 8 23.799999999999997 21.675 24.3 30.225 9 25.474999999999998 20.7 26.575 27.250000000000004 10-14 26.842684268426844 23.977397739773977 22.022202220222024 27.157715771577156 15-19 26.997699769976997 24.132413241324134 22.662266226622663 26.207620762076207 20-24 27.141357067853395 24.636231811590577 22.571128556427823 25.65128256412821 25-29 27.165 23.905 22.29 26.640000000000004 30-34 27.595 23.799999999999997 22.689999999999998 25.915 35-39 27.22 23.7 22.38 26.700000000000003 40-44 28.16281628162816 23.7023702370237 21.937193719371937 26.1976197619762 45-49 27.08 24.16 22.675 26.085 50-54 27.810000000000002 23.849999999999998 22.21 26.13 55-59 27.95198799699925 23.740935233808454 22.90072518129532 25.406351587896975 60-64 26.99 23.76 22.89 26.36 65-69 28.13204428192155 23.408305364925113 22.772128437609577 25.687521915543755 70-74 27.826174026234103 23.16511464904376 22.894763192149796 26.113948132572347 75-79 27.482748274827486 23.02730273027303 23.2023202320232 26.287628762876285 80-84 27.561660316823744 23.4008421896932 22.79927812312011 26.23821937036294 85-89 27.815 23.625 22.98 25.580000000000002 90-94 27.103130939281783 23.367010103030907 23.091927578273484 26.437931379413826 95-99 27.794999999999998 23.474999999999998 22.665 26.064999999999998 100-104 28.312831283128315 23.77237723772377 22.932293229322934 24.98249824982498 105-109 27.68259693417493 23.75513475603647 22.793307283839294 25.768961025949306 110-114 27.972797279727974 23.37233723372337 23.192319231923193 25.46254625462546 115-119 28.026434364674074 23.745869630519675 22.974867327525782 25.252828677280466 120-124 28.703889334402565 23.711908580593423 22.709502806736168 24.87469927826784 125-129 28.59 24.41 22.6 24.4 130-134 28.693693693693696 24.434434434434436 22.912912912912915 23.95895895895896 135-139 29.126602564102566 24.80969551282051 22.46594551282051 23.59775641025641 140-144 28.561414050373042 24.500525762355416 22.97331130138701 23.964748885884532 145-149 30.099864505444874 24.83063180609224 21.704220404476338 23.365283283986553 150 30.349999999999998 25.55 22.0 22.1 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.5 11 1.0 12 0.5 13 1.5 14 2.5 15 1.5 16 0.5 17 0.0 18 1.0 19 1.0 20 1.0 21 1.0 22 0.0 23 0.0 24 1.0 25 2.0 26 2.5 27 2.5 28 3.0 29 2.5 30 3.5 31 6.0 32 6.0 33 11.5 34 16.5 35 21.0 36 27.5 37 39.0 38 55.5 39 73.5 40 84.0 41 93.5 42 114.5 43 129.5 44 136.0 45 146.5 46 159.5 47 164.0 48 161.5 49 155.0 50 146.5 51 136.5 52 118.5 53 110.5 54 112.0 55 102.0 56 83.5 57 78.5 58 92.5 59 87.5 60 89.0 61 88.5 62 78.0 63 90.0 64 90.0 65 83.5 66 83.5 67 80.5 68 84.0 69 78.0 70 70.5 71 63.0 72 51.5 73 50.0 74 46.5 75 41.5 76 31.5 77 24.5 78 21.0 79 12.5 80 10.0 81 11.0 82 7.0 83 3.5 84 3.0 85 2.5 86 1.5 87 0.5 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.01 15-19 0.01 20-24 0.005 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.01 45-49 0.0 50-54 0.0 55-59 0.025 60-64 0.0 65-69 0.185 70-74 0.13 75-79 0.01 80-84 0.26 85-89 0.0 90-94 0.03 95-99 0.0 100-104 0.01 105-109 0.19 110-114 0.01 115-119 0.13 120-124 0.24 125-129 0.0 130-134 0.1 135-139 0.16 140-144 0.145 145-149 0.365 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.25 #Duplication Level Percentage of deduplicated Percentage of total 1 96.57142857142857 92.95 2 3.324675324675325 6.4 3 0.05194805194805195 0.15 4 0.025974025974025976 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025974025974025976 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 16 0.4 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.30000000000000004 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.425 0.0 0.0 0.0 0.0 100-101 0.45 0.0 0.0 0.0 0.0 102-103 0.5875 0.0 0.0 0.0 0.0 104-105 0.7375 0.0 0.0 0.0 0.0 106-107 0.9375 0.0 0.0 0.0 0.0 108-109 1.1125 0.0 0.0 0.0 0.0 110-111 1.425 0.0 0.0 0.0 0.0 112-113 1.7875 0.0 0.0 0.0 0.0 114-115 2.05 0.0 0.0 0.0 0.0 116-117 2.3375 0.0 0.0 0.0 0.0 118-119 2.5125 0.0 0.0 0.0 0.0 120-121 2.8 0.0 0.0 0.0 0.0 122-123 3.225 0.0 0.0 0.0 0.0 124-125 3.6375 0.0 0.0 0.0 0.0 126-127 4.25 0.0 0.0 0.0 0.0 128-129 4.725 0.0 0.0 0.0 0.0 130-131 5.425 0.0 0.0 0.0 0.0 132-133 5.95 0.0 0.0 0.0 0.0 134-135 6.625 0.0 0.0 0.0 0.0 136-137 7.4 0.0 0.0 0.0 0.0 138 7.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1142495 spots for SRR5831618.sra Written 1142495 spots for SRR5831618.sra Read 1142495 spots for SRR5831618.sra Written 1142495 spots for SRR5831618.sra Read 1142495 spots for SRR5831618.sra Written 1142495 spots for SRR5831618.sra Read 1142495 spots for SRR5831618.sra Written 1142495 spots for SRR5831618.sra Read 1142495 spots for SRR5831618.sra Written 1142495 spots for SRR5831618.sra Read 1142495 spots for SRR5831618.sra Written 1142495 spots for SRR5831618.sra Read 1142495 spots for SRR5831618.sra Written 1142495 spots for SRR5831618.sra Read 1142495 spots for SRR5831618.sra Written 1142495 spots for SRR5831618.sra Read 1142495 spots for SRR5831618.sra Written 1142495 spots for SRR5831618.sra Read 1142495 spots for SRR5831618.sra Written 1142495 spots for SRR5831618.sra Read 1142499 spots for SRR5831618.sra Written 1142499 spots for SRR5831618.sra Read 1142495 spots for SRR5831618.sra Written 1142495 spots for SRR5831618.sra Read 1142495 spots for SRR5831618.sra Written 1142495 spots for SRR5831618.sra Read 1142495 spots for SRR5831618.sra Written 1142495 spots for SRR5831618.sra Read 1142495 spots for SRR5831618.sra Written 1142495 spots for SRR5831618.sra Read 1142495 spots for SRR5831618.sra Written 1142495 spots for SRR5831618.sra Read 1142495 spots for SRR5831618.sra Written 1142495 spots for SRR5831618.sra Read 1142495 spots for SRR5831618.sra Written 1142495 spots for SRR5831618.sra Read 1142495 spots for SRR5831618.sra Written 1142495 spots for SRR5831618.sra Read 1142495 spots for SRR5831618.sra Written 1142495 spots for SRR5831618.sra SRR ids: ['SRR5831618.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_grih5j36 SRR5831618.sra spots: 22849904 blocks: [[1, 1142495], [1142496, 2284990], [2284991, 3427485], [3427486, 4569980], [4569981, 5712475], [5712476, 6854970], [6854971, 7997465], [7997466, 9139960], [9139961, 10282455], [10282456, 11424950], [11424951, 12567445], [12567446, 13709940], [13709941, 14852435], [14852436, 15994930], [15994931, 17137425], [17137426, 18279920], [18279921, 19422415], [19422416, 20564910], [20564911, 21707405], [21707406, 22849904]] SRR5831618 file size 7676753 SRR5831618 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5831618 SRR5831618_1.fastq SRR5831618_2.fastq Input file: SRR5831618_1.fastq Paired file: SRR5831618_2.fastq trimmed: SRR5831618-trimmed-pair1.fastq, SRR5831618-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 01:15:30 2024 >> started Sat Dec 7 01:15:56 2024 >> done (26.602s) 22849904 read pairs processed; of these: 1738 ( 0.01%) short read pairs filtered out after trimming by size control 82761 ( 0.36%) empty read pairs filtered out after trimming by size control 22765405 (99.63%) read pairs available; of these: 3818756 (16.77%) trimmed read pairs available after processing 18946649 (83.23%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 117 0.00% 19 137 0.00% 20 102 0.00% 21 83 0.00% 22 108 0.00% 23 101 0.00% 24 93 0.00% 25 91 0.00% 26 93 0.00% 27 102 0.00% 28 82 0.00% 29 106 0.00% 30 103 0.00% 31 109 0.00% 32 77 0.00% 33 90 0.00% 34 96 0.00% 35 97 0.00% 36 103 0.00% 37 102 0.00% 38 88 0.00% 39 119 0.00% 40 111 0.00% 41 136 0.00% 42 150 0.00% 43 148 0.00% 44 150 0.00% 45 148 0.00% 46 125 0.00% 47 167 0.00% 48 181 0.00% 49 158 0.00% 50 188 0.00% 51 186 0.00% 52 176 0.00% 53 213 0.00% 54 224 0.00% 55 238 0.00% 56 237 0.00% 57 255 0.00% 58 244 0.00% 59 257 0.00% 60 295 0.00% 61 266 0.00% 62 330 0.00% 63 321 0.00% 64 421 0.00% 65 422 0.00% 66 432 0.00% 67 497 0.00% 68 442 0.00% 69 496 0.00% 70 577 0.00% 71 599 0.00% 72 675 0.00% 73 779 0.00% 74 810 0.00% 75 978 0.00% 76 1044 0.00% 77 1097 0.00% 78 1175 0.01% 79 1341 0.01% 80 1325 0.01% 81 1486 0.01% 82 1660 0.01% 83 1819 0.01% 84 2179 0.01% 85 2474 0.01% 86 2626 0.01% 87 2850 0.01% 88 3130 0.01% 89 3438 0.02% 90 3741 0.02% 91 4136 0.02% 92 4494 0.02% 93 4958 0.02% 94 5628 0.02% 95 6461 0.03% 96 7073 0.03% 97 8032 0.04% 98 8661 0.04% 99 9183 0.04% 100 10162 0.04% 101 10706 0.05% 102 11739 0.05% 103 12932 0.06% 104 14343 0.06% 105 15853 0.07% 106 17487 0.08% 107 19281 0.08% 108 21005 0.09% 109 22835 0.10% 110 24177 0.11% 111 25889 0.11% 112 27399 0.12% 113 29494 0.13% 114 31576 0.14% 115 34010 0.15% 116 36940 0.16% 117 40081 0.18% 118 43374 0.19% 119 47050 0.21% 120 48649 0.21% 121 51455 0.23% 122 54362 0.24% 123 56437 0.25% 124 59636 0.26% 125 63427 0.28% 126 66407 0.29% 127 70461 0.31% 128 74606 0.33% 129 78735 0.35% 130 83073 0.36% 131 85373 0.38% 132 88479 0.39% 133 91387 0.40% 134 93512 0.41% 135 96859 0.43% 136 101132 0.44% 137 104959 0.46% 138 108559 0.48% 139 114790 0.50% 140 118404 0.52% 141 122011 0.54% 142 125511 0.55% 143 128881 0.57% 144 129676 0.57% 145 132685 0.58% 146 135468 0.60% 147 140968 0.62% 148 159078 0.70% 149 433201 1.90% 150 18946649 83.23% 22765405 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=4.05 fanout-score-rank=29 prefix-density=0.21 prefix-fanout=3.4 sequence=TGCCGCACTTGCAGGATGACCCGCAGTTGCAGTTTCCTCCGCAGCAAGACATCT criterion=fanout-score sequence-density=0.11 sequence-density-rank=15 fanout-score=347.61 fanout-score-rank=1 prefix-density=1.09 prefix-fanout=34.4 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=13.45 fanout-score-rank=18 prefix-density=0.49 prefix-fanout=7.8 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.12 sequence-density-rank=16 fanout-score=224.67 fanout-score-rank=1 prefix-density=1.08 prefix-fanout=25.3 sequence=GCGGCGGCGGCG SRR5831618 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 01:17:00 Started mapping on | Dec 07 01:17:00 Finished on | Dec 07 01:21:45 Mapping speed, Million of reads per hour | 287.56 Number of input reads | 22765405 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 21749016 Uniquely mapped reads % | 95.54% Average mapped length | 292.74 Number of splices: Total | 21614200 Number of splices: Annotated (sjdb) | 20462842 Number of splices: GT/AG | 21314482 Number of splices: GC/AG | 254074 Number of splices: AT/AC | 14086 Number of splices: Non-canonical | 31558 Mismatch rate per base, % | 0.53% Deletion rate per base | 0.01% Deletion average length | 2.23 Insertion rate per base | 0.01% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 298541 % of reads mapped to multiple loci | 1.31% Number of reads mapped to too many loci | 8722 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.76% % of reads unmapped: other | 0.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 717848 717848 717848 N_multimapping 298541 298541 298541 N_noFeature 383442 21070917 711829 N_ambiguous 416855 2287 71025 UnstrandedReadsAssigned:20948719 PositiveStrandReadsAssigned:675812 NegativeStrandReadsAssigned:20966162 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR5831618 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5831618-trimmed-pair1.fastq SRR5831618-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,765,405 reads, 21,328,320 reads pseudoaligned [quant] estimated average fragment length: 199.992 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,166 rounds 52973 SRR5831618.ke.tsv 35125 SRR5831618.se.tsv 88098 total ==> SRR5831618.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 737.191 0 0 PNS24247 1044 845.008 21.0549 1.37605 PNS24249 1928 1729.01 121.22 3.87184 PNS24246 1044 845.008 21.0549 1.37605 PNS24248 1044 845.008 21.0549 1.37605 PNS24244 1471 1272.01 53.6153 2.32776 PNS24243 293 104.668 3 1.58288 KQK14069 1603 1404.01 8127.7 319.697 KQK14071 474 277.595 280.944 55.8918 ==> SRR5831618.se.tsv <== BRADI_1g14170v3 8604 BRADI_1g53295v3 31 BRADI_1g59795v3 116 BRADI_1g07683v3 0 BRADI_1g00485v3 21 BRADI_1g20270v3 1348 BRADI_1g74790v3 1432 BRADI_1g09890v3 0 BRADI_1g77505v3 441 BRADI_1g48960v3 0 SRR5831618 completed mapping pipeline successfully