Starting /dee2/code/volunteer_pipeline.sh SRR5831619 current disk space = 1548268298240 free memory = 1594339848 SRR5831619 SRAfilesize a95e4e5cdf13744c7a5f8a08a3d7e437 SRR5831619.sra SRR5831619.sra file validated SRR5831619 is paired end SRR5831619 is conventional basespace SRR5831619 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5831619_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.46075 32.0 32.0 32.0 32.0 32.0 2 31.7215 32.0 32.0 32.0 32.0 32.0 3 35.41975 37.0 37.0 37.0 32.0 37.0 4 33.95675 37.0 32.0 37.0 27.0 37.0 5 36.1635 37.0 37.0 37.0 32.0 37.0 6 39.709 42.0 37.0 42.0 37.0 42.0 7 40.041 42.0 37.0 42.0 37.0 42.0 8 40.28425 42.0 42.0 42.0 37.0 42.0 9 39.90575 42.0 37.0 42.0 37.0 42.0 10-14 39.8304 42.0 39.0 42.0 35.0 42.0 15-19 37.7344 41.0 36.0 42.0 27.8 42.0 20-24 37.44435 41.0 36.0 42.0 28.0 42.0 25-29 38.05050000000001 42.0 37.0 42.0 29.0 42.0 30-34 35.727149999999995 40.0 32.0 42.0 20.6 42.0 35-39 37.021100000000004 41.0 36.0 42.0 24.8 42.0 40-44 36.0784 40.0 33.0 42.0 25.8 42.0 45-49 38.185249999999996 42.0 36.0 42.0 29.0 42.0 50-54 32.247249999999994 36.0 22.6 40.0 17.4 42.0 55-59 35.9996 39.0 34.0 42.0 21.8 42.0 60-64 37.54365 42.0 37.0 42.0 27.0 42.0 65-69 36.5035 41.0 34.0 42.0 23.8 42.0 70-74 35.64149999999999 39.0 33.0 42.0 19.6 42.0 75-79 36.33335000000001 40.0 34.0 42.0 26.0 42.0 80-84 35.43235000000001 39.0 34.0 42.0 20.6 42.0 85-89 36.41755 40.0 35.0 42.0 23.8 42.0 90-94 38.6588 42.0 37.0 42.0 32.0 42.0 95-99 34.95125 38.0 31.0 42.0 18.6 42.0 100-104 34.6118 38.0 32.0 42.0 13.2 42.0 105-109 34.9204 38.0 32.0 42.0 15.4 42.0 110-114 35.341449999999995 39.0 33.0 42.0 18.6 42.0 115-119 36.13525 41.0 34.0 42.0 23.0 42.0 120-124 32.3524 36.0 26.8 40.0 15.4 42.0 125-129 31.952550000000002 35.0 25.8 40.0 15.4 42.0 130-134 34.7008 38.0 31.0 42.0 19.8 42.0 135-139 32.8634 36.0 27.0 42.0 15.4 42.0 140-144 30.96 35.0 23.8 40.0 13.2 42.0 145-149 32.9277 35.0 28.0 42.0 15.4 42.0 150 32.03575 37.0 27.0 42.0 11.0 42.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 3.0 19 3.0 20 0.0 21 6.0 22 7.0 23 13.0 24 19.0 25 32.0 26 44.0 27 50.0 28 64.0 29 114.0 30 127.0 31 166.0 32 236.0 33 259.0 34 324.0 35 392.0 36 449.0 37 442.0 38 479.0 39 417.0 40 290.0 41 64.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.725 8.924999999999999 13.125 44.224999999999994 2 28.199999999999996 11.075 31.2 29.525000000000002 3 24.375 16.625 22.900000000000002 36.1 4 29.775000000000002 18.575 19.925 31.724999999999998 5 29.049999999999997 23.025000000000002 21.975 25.95 6 25.424999999999997 28.1 22.975 23.5 7 19.25 25.05 33.925 21.775 8 19.525000000000002 21.6 31.6 27.275 9 21.95 20.599999999999998 31.15 26.3 10-14 23.96 24.965 24.385 26.69 15-19 24.46 24.060000000000002 24.45 27.029999999999998 20-24 24.990000000000002 24.279999999999998 23.655 27.075 25-29 24.03 24.435000000000002 24.224999999999998 27.310000000000002 30-34 24.55999598856742 24.95111066539638 23.461866319009175 27.027027027027028 35-39 25.374999999999996 23.93 24.08 26.615 40-44 24.59 24.610000000000003 23.419999999999998 27.38 45-49 25.0 23.885 23.66 27.455000000000002 50-54 25.0 24.73 22.585 27.685 55-59 24.51044222967897 23.62397956628437 24.194921620674112 27.670656583362547 60-64 25.230000000000004 23.49 23.97 27.310000000000002 65-69 25.225315441618267 24.08872421389946 23.658121369917883 27.02783897456439 70-74 25.485000000000003 23.65 23.335 27.529999999999998 75-79 25.505 24.125 22.89 27.48 80-84 25.67128356417821 23.811190559527976 23.06615330766538 27.45137256862843 85-89 25.455 23.51 23.585 27.450000000000003 90-94 25.735000000000003 24.09 22.814999999999998 27.36 95-99 25.619999999999997 23.78 23.105 27.495000000000005 100-104 24.94868071897061 23.87222750713463 23.18129474790968 27.997797025985076 105-109 25.069999999999997 23.919999999999998 23.29 27.72 110-114 25.592702120194478 23.627888326399678 23.392311162347752 27.38709839105809 115-119 26.235000000000003 23.165 23.175 27.425 120-124 25.590000000000003 24.085 22.095000000000002 28.23 125-129 26.029316123868128 24.398419130521788 22.36730201610886 27.204962729501226 130-134 26.090000000000003 23.46 22.68 27.77 135-139 26.260756453872325 24.419651791074646 21.82309385631379 27.496497898739243 140-144 25.985000000000003 24.36 22.509999999999998 27.145000000000003 145-149 26.625 23.36 22.445 27.57 150 25.45 24.075 22.475 28.000000000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 1.0 9 1.5 10 0.5 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 1.0 20 0.5 21 0.5 22 2.0 23 2.0 24 0.5 25 0.0 26 1.5 27 3.5 28 4.5 29 3.5 30 7.0 31 10.5 32 8.5 33 11.5 34 19.5 35 22.0 36 28.5 37 47.5 38 60.5 39 77.0 40 94.5 41 103.0 42 107.5 43 127.0 44 153.0 45 157.5 46 169.5 47 169.0 48 160.0 49 158.0 50 148.5 51 148.5 52 147.0 53 133.5 54 113.0 55 105.5 56 105.0 57 96.0 58 90.5 59 89.5 60 82.0 61 79.0 62 82.0 63 81.5 64 79.5 65 82.0 66 78.5 67 73.0 68 63.0 69 50.0 70 44.5 71 45.0 72 45.0 73 42.0 74 35.0 75 31.0 76 30.0 77 22.5 78 17.0 79 12.5 80 10.0 81 5.5 82 4.0 83 4.0 84 3.0 85 1.0 86 0.0 87 0.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.28500000000000003 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.165 60-64 0.0 65-69 0.13999999999999999 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.135 105-109 0.0 110-114 0.245 115-119 0.0 120-124 0.0 125-129 0.055 130-134 0.0 135-139 0.06 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.25 #Duplication Level Percentage of deduplicated Percentage of total 1 97.30077120822622 94.625 2 2.647814910025707 5.1499999999999995 3 0.025706940874035987 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025706940874035987 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGC 6 0.15 TruSeq Adapter, Index 9 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.4875 0.0 0.0 0.0 0.0 102-103 0.5375 0.0 0.0 0.0 0.0 104-105 0.6625 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.925 0.0 0.0 0.0 0.0 110-111 1.075 0.0 0.0 0.0 0.0 112-113 1.2000000000000002 0.0 0.0 0.0 0.0 114-115 1.2875 0.0 0.0 0.0 0.0 116-117 1.4 0.0 0.0 0.0 0.0 118-119 1.525 0.0 0.0 0.0 0.0 120-121 1.65 0.0 0.0 0.0 0.0 122-123 1.8125 0.0 0.0 0.0 0.0 124-125 2.0125 0.0 0.0 0.0 0.0 126-127 2.3 0.0 0.0 0.0 0.0 128-129 2.7125000000000004 0.0 0.0 0.0 0.0 130-131 3.075 0.0 0.0 0.0 0.0 132-133 3.4625 0.0 0.0 0.0 0.0 134-135 3.7625 0.0 0.0 0.0 0.0 136-137 4.15 0.0 0.0 0.0 0.0 138 4.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTCTG 10 0.006973645 144.0 5 >>END_MODULE SRR5831619 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5831619_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.451 32.0 32.0 32.0 32.0 32.0 2 31.89225 32.0 32.0 32.0 32.0 37.0 3 34.93025 37.0 37.0 37.0 32.0 37.0 4 35.95225 37.0 37.0 37.0 32.0 37.0 5 36.14175 37.0 37.0 37.0 37.0 37.0 6 39.1685 42.0 37.0 42.0 32.0 42.0 7 39.7145 42.0 37.0 42.0 32.0 42.0 8 39.7665 42.0 37.0 42.0 37.0 42.0 9 40.002 42.0 42.0 42.0 37.0 42.0 10-14 39.823 42.0 41.0 42.0 36.0 42.0 15-19 39.08845 42.0 37.0 42.0 33.0 42.0 20-24 38.8722 42.0 37.0 42.0 32.0 42.0 25-29 38.19035 42.0 37.0 42.0 29.0 42.0 30-34 39.01205 42.0 37.0 42.0 32.0 42.0 35-39 38.43555 42.0 37.0 42.0 32.0 42.0 40-44 38.20915 42.0 36.0 42.0 30.0 42.0 45-49 38.01805 42.0 37.0 42.0 30.0 42.0 50-54 38.072500000000005 42.0 37.0 42.0 32.0 42.0 55-59 37.5787 42.0 36.0 42.0 28.0 42.0 60-64 36.37995000000001 41.0 36.0 42.0 23.8 42.0 65-69 35.83985 40.0 34.0 42.0 23.8 42.0 70-74 37.102650000000004 42.0 36.0 42.0 28.0 42.0 75-79 36.62495 40.0 35.0 42.0 26.0 42.0 80-84 37.3995 42.0 37.0 42.0 29.0 42.0 85-89 37.2397 42.0 37.0 42.0 27.0 42.0 90-94 37.264849999999996 42.0 37.0 42.0 27.0 42.0 95-99 36.26989999999999 39.0 34.0 42.0 25.0 42.0 100-104 34.931 37.0 32.0 42.0 20.8 42.0 105-109 33.7592 36.0 30.0 42.0 19.8 42.0 110-114 34.404700000000005 37.0 31.0 42.0 19.8 42.0 115-119 33.216899999999995 36.0 30.0 41.0 19.8 42.0 120-124 33.14805 36.0 30.0 42.0 17.6 42.0 125-129 30.51985 33.0 22.8 39.0 13.2 42.0 130-134 28.947449999999996 31.0 21.8 37.0 11.0 42.0 135-139 29.21785 31.0 22.8 36.0 13.2 42.0 140-144 28.6418 31.0 21.8 37.0 11.0 42.0 145-149 29.167250000000003 31.0 22.8 36.0 11.0 42.0 150 29.16375 32.0 22.0 37.0 11.0 42.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 1.0 17 1.0 18 2.0 19 5.0 20 3.0 21 10.0 22 20.0 23 21.0 24 23.0 25 32.0 26 36.0 27 51.0 28 60.0 29 88.0 30 115.0 31 142.0 32 192.0 33 250.0 34 342.0 35 390.0 36 502.0 37 553.0 38 559.0 39 356.0 40 205.0 41 40.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.625000000000004 18.15 12.0 39.225 2 29.025000000000002 24.05 26.700000000000003 20.225 3 25.5 27.525 21.75 25.224999999999998 4 28.175 29.7 17.974999999999998 24.15 5 29.275000000000002 30.65 18.825 21.25 6 23.75 34.25 19.8 22.2 7 23.200000000000003 17.7 33.825 25.275 8 23.849999999999998 22.15 23.625 30.375000000000004 9 26.025 19.0 26.025 28.95 10-14 27.145000000000003 24.51 21.555 26.790000000000003 15-19 26.965 24.22 22.605 26.21 20-24 26.955000000000002 24.3 22.564999999999998 26.179999999999996 25-29 26.765 24.25 22.31 26.674999999999997 30-34 27.13 24.93 22.5 25.44 35-39 27.860000000000003 24.51 21.98 25.650000000000002 40-44 27.794999999999998 23.07 22.64 26.495 45-49 27.1 23.695 22.8 26.405 50-54 27.839999999999996 23.54 22.2 26.419999999999998 55-59 27.345469093818764 24.134826965393078 22.76455291058212 25.75515103020604 60-64 27.36 24.169999999999998 22.6 25.869999999999997 65-69 28.121400310512346 23.09310362097461 22.75254169379476 26.032954374718287 70-74 27.16166825214039 24.00741000350473 22.635558003304464 26.19536374105042 75-79 26.915 23.62 23.02 26.445 80-84 28.290067154455244 23.318632855567806 22.486719454745916 25.90458053523103 85-89 27.305 23.635 22.55 26.51 90-94 27.310000000000002 23.885 22.82 25.985000000000003 95-99 27.845 23.669999999999998 23.035 25.45 100-104 28.155 23.595 22.57 25.679999999999996 105-109 27.966144137827413 23.458706866329443 23.048029248259628 25.527119747583516 110-114 27.46 24.075 22.900000000000002 25.564999999999998 115-119 28.253141741350824 23.636909828268163 22.720672908426376 25.38927552195464 120-124 28.516290726817044 23.649122807017545 22.32581453634085 25.508771929824565 125-129 27.91 24.395 22.545 25.15 130-134 28.775826704687578 23.948171494321876 22.592425834208814 24.683575966781728 135-139 28.316722592277255 24.33515300245405 21.98126909400511 25.366855311263585 140-144 29.25595834167835 24.043661125575806 22.05587822952133 24.644502303224513 145-149 28.821552199869565 24.30140972257061 22.44519139116039 24.43184668639944 150 30.375000000000004 23.549999999999997 22.05 24.025 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.5 13 1.0 14 0.5 15 0.0 16 1.0 17 1.5 18 1.0 19 0.5 20 0.0 21 1.0 22 2.0 23 2.5 24 2.5 25 1.5 26 2.5 27 2.5 28 1.5 29 3.0 30 3.5 31 3.5 32 6.0 33 9.5 34 12.0 35 24.0 36 35.0 37 45.5 38 51.0 39 58.5 40 82.5 41 100.5 42 107.0 43 112.0 44 123.5 45 139.0 46 153.0 47 163.0 48 156.0 49 141.5 50 149.0 51 153.5 52 136.5 53 139.0 54 147.0 55 128.0 56 106.0 57 94.0 58 92.5 59 92.5 60 81.0 61 83.5 62 85.5 63 77.5 64 83.0 65 86.5 66 78.5 67 79.0 68 82.5 69 75.5 70 62.5 71 54.5 72 52.0 73 41.0 74 34.5 75 29.5 76 29.5 77 25.0 78 13.0 79 8.5 80 10.5 81 10.5 82 6.0 83 5.5 84 6.5 85 3.5 86 1.0 87 1.0 88 0.5 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.02 60-64 0.0 65-69 0.165 70-74 0.135 75-79 0.0 80-84 0.22999999999999998 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.165 110-114 0.0 115-119 0.135 120-124 0.25 125-129 0.0 130-134 0.055 135-139 0.165 140-144 0.13999999999999999 145-149 0.335 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.475 #Duplication Level Percentage of deduplicated Percentage of total 1 95.86279130662477 91.525 2 3.901544907043729 7.449999999999999 3 0.15710919088766695 0.44999999999999996 4 0.0 0.0 5 0.05236973029588898 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02618486514794449 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 13 0.325 Illumina Single End PCR Primer 1 (100% over 50bp) CTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTT 5 0.125 No Hit CGGCAACGGATATCTCGGCTCTCGCATCGATGAAGAACGTAGCGAAATGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.7125 0.0 0.0 0.0 0.0 106-107 0.85 0.0 0.0 0.0 0.0 108-109 1.0 0.0 0.0 0.0 0.0 110-111 1.15 0.0 0.0 0.0 0.0 112-113 1.275 0.0 0.0 0.0 0.0 114-115 1.375 0.0 0.0 0.0 0.0 116-117 1.5125 0.0 0.0 0.0 0.0 118-119 1.6625 0.0 0.0 0.0 0.0 120-121 1.8125 0.0 0.0 0.0 0.0 122-123 1.975 0.0 0.0 0.0 0.0 124-125 2.1375 0.0 0.0 0.0 0.0 126-127 2.4625000000000004 0.0 0.0 0.0 0.0 128-129 2.925 0.0 0.0 0.0 0.0 130-131 3.3 0.0 0.0 0.0 0.0 132-133 3.675 0.0 0.0 0.0 0.0 134-135 3.95 0.0 0.0 0.0 0.0 136-137 4.449999999999999 0.0 0.0 0.0 0.0 138 4.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1185095 spots for SRR5831619.sra Written 1185095 spots for SRR5831619.sra Read 1185095 spots for SRR5831619.sra Written 1185095 spots for SRR5831619.sra Read 1185095 spots for SRR5831619.sra Written 1185095 spots for SRR5831619.sra Read 1185095 spots for SRR5831619.sra Written 1185095 spots for SRR5831619.sra Read 1185095 spots for SRR5831619.sra Written 1185095 spots for SRR5831619.sra Read 1185095 spots for SRR5831619.sra Written 1185095 spots for SRR5831619.sra Read 1185095 spots for SRR5831619.sra Written 1185095 spots for SRR5831619.sra Read 1185095 spots for SRR5831619.sra Written 1185095 spots for SRR5831619.sra Read 1185095 spots for SRR5831619.sra Written 1185095 spots for SRR5831619.sra Read 1185095 spots for SRR5831619.sra Written 1185095 spots for SRR5831619.sra Read 1185095 spots for SRR5831619.sra Written 1185095 spots for SRR5831619.sra Read 1185095 spots for SRR5831619.sra Written 1185095 spots for SRR5831619.sra Read 1185095 spots for SRR5831619.sra Written 1185095 spots for SRR5831619.sra Read 1185095 spots for SRR5831619.sra Written 1185095 spots for SRR5831619.sra Read 1185095 spots for SRR5831619.sra Written 1185095 spots for SRR5831619.sra Read 1185095 spots for SRR5831619.sra Written 1185095 spots for SRR5831619.sra Read 1185095 spots for SRR5831619.sra Written 1185095 spots for SRR5831619.sra Read 1185095 spots for SRR5831619.sra Written 1185095 spots for SRR5831619.sra Read 1185109 spots for SRR5831619.sra Written 1185109 spots for SRR5831619.sra Read 1185095 spots for SRR5831619.sra Written 1185095 spots for SRR5831619.sra SRR ids: ['SRR5831619.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_57xjyai6 SRR5831619.sra spots: 23701914 blocks: [[1, 1185095], [1185096, 2370190], [2370191, 3555285], [3555286, 4740380], [4740381, 5925475], [5925476, 7110570], [7110571, 8295665], [8295666, 9480760], [9480761, 10665855], [10665856, 11850950], [11850951, 13036045], [13036046, 14221140], [14221141, 15406235], [15406236, 16591330], [16591331, 17776425], [17776426, 18961520], [18961521, 20146615], [20146616, 21331710], [21331711, 22516805], [22516806, 23701914]] SRR5831619 file size 7963807 SRR5831619 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5831619 SRR5831619_1.fastq SRR5831619_2.fastq Input file: SRR5831619_1.fastq Paired file: SRR5831619_2.fastq trimmed: SRR5831619-trimmed-pair1.fastq, SRR5831619-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 01:23:40 2024 >> started Sat Dec 7 01:24:07 2024 >> done (26.098s) 23701914 read pairs processed; of these: 1653 ( 0.01%) short read pairs filtered out after trimming by size control 65533 ( 0.28%) empty read pairs filtered out after trimming by size control 23634728 (99.72%) read pairs available; of these: 2523611 (10.68%) trimmed read pairs available after processing 21111117 (89.32%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 92 0.00% 19 90 0.00% 20 79 0.00% 21 79 0.00% 22 78 0.00% 23 87 0.00% 24 99 0.00% 25 87 0.00% 26 91 0.00% 27 77 0.00% 28 71 0.00% 29 84 0.00% 30 87 0.00% 31 97 0.00% 32 80 0.00% 33 98 0.00% 34 94 0.00% 35 89 0.00% 36 106 0.00% 37 104 0.00% 38 108 0.00% 39 98 0.00% 40 140 0.00% 41 125 0.00% 42 134 0.00% 43 139 0.00% 44 136 0.00% 45 140 0.00% 46 125 0.00% 47 160 0.00% 48 135 0.00% 49 162 0.00% 50 173 0.00% 51 185 0.00% 52 184 0.00% 53 203 0.00% 54 190 0.00% 55 219 0.00% 56 180 0.00% 57 201 0.00% 58 237 0.00% 59 245 0.00% 60 236 0.00% 61 261 0.00% 62 244 0.00% 63 291 0.00% 64 363 0.00% 65 313 0.00% 66 384 0.00% 67 348 0.00% 68 380 0.00% 69 418 0.00% 70 456 0.00% 71 504 0.00% 72 528 0.00% 73 591 0.00% 74 631 0.00% 75 744 0.00% 76 815 0.00% 77 854 0.00% 78 821 0.00% 79 988 0.00% 80 1045 0.00% 81 1069 0.00% 82 1215 0.01% 83 1329 0.01% 84 1516 0.01% 85 1662 0.01% 86 1859 0.01% 87 1996 0.01% 88 2126 0.01% 89 2431 0.01% 90 2459 0.01% 91 2767 0.01% 92 2933 0.01% 93 3330 0.01% 94 3553 0.02% 95 4107 0.02% 96 4522 0.02% 97 5052 0.02% 98 5438 0.02% 99 5753 0.02% 100 6055 0.03% 101 6670 0.03% 102 7124 0.03% 103 7751 0.03% 104 8625 0.04% 105 9111 0.04% 106 10132 0.04% 107 11015 0.05% 108 12214 0.05% 109 13059 0.06% 110 13941 0.06% 111 14669 0.06% 112 15392 0.07% 113 16688 0.07% 114 17952 0.08% 115 19401 0.08% 116 21491 0.09% 117 23250 0.10% 118 24438 0.10% 119 26087 0.11% 120 27712 0.12% 121 29199 0.12% 122 30441 0.13% 123 32452 0.14% 124 34006 0.14% 125 35662 0.15% 126 37880 0.16% 127 40330 0.17% 128 43993 0.19% 129 46006 0.19% 130 49760 0.21% 131 52256 0.22% 132 53844 0.23% 133 55493 0.23% 134 57371 0.24% 135 58634 0.25% 136 61451 0.26% 137 64541 0.27% 138 68332 0.29% 139 70828 0.30% 140 73329 0.31% 141 76476 0.32% 142 78302 0.33% 143 80874 0.34% 144 84056 0.36% 145 86003 0.36% 146 88453 0.37% 147 92919 0.39% 148 112194 0.47% 149 444029 1.88% 150 21111117 89.32% 23634728 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=10.79 fanout-score-rank=13 prefix-density=0.51 prefix-fanout=6.0 sequence=CTCCAGCTCCTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=16 fanout-score=342.45 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=34.2 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=12.17 fanout-score-rank=17 prefix-density=0.43 prefix-fanout=7.4 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.12 sequence-density-rank=14 fanout-score=232.47 fanout-score-rank=1 prefix-density=1.14 prefix-fanout=23.9 sequence=CGCCGCCGCCGTCG SRR5831619 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 01:24:47 Started mapping on | Dec 07 01:24:47 Finished on | Dec 07 01:28:39 Mapping speed, Million of reads per hour | 366.75 Number of input reads | 23634728 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 21263975 Uniquely mapped reads % | 89.97% Average mapped length | 294.93 Number of splices: Total | 21455353 Number of splices: Annotated (sjdb) | 20365357 Number of splices: GT/AG | 21155736 Number of splices: GC/AG | 257482 Number of splices: AT/AC | 13213 Number of splices: Non-canonical | 28922 Mismatch rate per base, % | 0.57% Deletion rate per base | 0.01% Deletion average length | 2.23 Insertion rate per base | 0.01% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 355231 % of reads mapped to multiple loci | 1.50% Number of reads mapped to too many loci | 149125 % of reads mapped to too many loci | 0.63% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.59% % of reads unmapped: other | 5.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2015522 2015522 2015522 N_multimapping 355231 355231 355231 N_noFeature 405414 20642741 690352 N_ambiguous 407473 2389 75278 UnstrandedReadsAssigned:20451088 PositiveStrandReadsAssigned:618845 NegativeStrandReadsAssigned:20498345 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR5831619 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5831619-trimmed-pair1.fastq SRR5831619-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,634,728 reads, 20,886,009 reads pseudoaligned [quant] estimated average fragment length: 217.211 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,159 rounds 52973 SRR5831619.ke.tsv 35125 SRR5831619.se.tsv 88098 total ==> SRR5831619.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 720.025 0 0 PNS24247 1044 827.789 35.6222 2.43083 PNS24249 1928 1711.79 105.267 3.47374 PNS24246 1044 827.789 35.6222 2.43083 PNS24248 1044 827.789 35.6222 2.43083 PNS24244 1471 1254.79 47.8663 2.15483 PNS24243 293 90.974 4 2.48369 KQK14069 1603 1386.79 7347.32 299.276 KQK14071 474 260.472 341.519 74.0639 ==> SRR5831619.se.tsv <== BRADI_1g14170v3 7870 BRADI_1g53295v3 25 BRADI_1g59795v3 118 BRADI_1g07683v3 0 BRADI_1g00485v3 14 BRADI_1g20270v3 1422 BRADI_1g74790v3 1331 BRADI_1g09890v3 0 BRADI_1g77505v3 371 BRADI_1g48960v3 0 SRR5831619 completed mapping pipeline successfully