Starting /dee2/code/volunteer_pipeline.sh SRR5831620 current disk space = 1548254400512 free memory = 1597424624 SRR5831620 SRAfilesize 8f3498bab3a2fd9defd8ee9f8b84cb47 SRR5831620.sra SRR5831620.sra file validated SRR5831620 is paired end SRR5831620 is conventional basespace SRR5831620 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5831620_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.51725 32.0 32.0 32.0 32.0 32.0 2 31.5405 32.0 32.0 32.0 32.0 32.0 3 35.24225 37.0 37.0 37.0 32.0 37.0 4 33.87875 37.0 32.0 37.0 27.0 37.0 5 36.27975 37.0 37.0 37.0 37.0 37.0 6 40.10075 42.0 37.0 42.0 37.0 42.0 7 40.2495 42.0 42.0 42.0 37.0 42.0 8 40.49375 42.0 42.0 42.0 37.0 42.0 9 40.06375 42.0 42.0 42.0 37.0 42.0 10-14 40.0156 42.0 40.0 42.0 35.0 42.0 15-19 37.685050000000004 41.0 36.0 42.0 27.8 42.0 20-24 37.4963 41.0 36.0 42.0 28.0 42.0 25-29 38.1691 42.0 37.0 42.0 29.0 42.0 30-34 36.062349999999995 40.0 34.0 42.0 20.6 42.0 35-39 37.0099 41.0 36.0 42.0 24.8 42.0 40-44 36.0766 40.0 33.0 42.0 25.8 42.0 45-49 38.3475 42.0 36.0 42.0 29.0 42.0 50-54 32.44965 36.0 23.6 40.0 18.4 42.0 55-59 36.31125000000001 40.0 35.0 42.0 23.8 42.0 60-64 37.6529 42.0 36.0 42.0 28.0 42.0 65-69 36.8018 41.0 35.0 42.0 23.8 42.0 70-74 36.01775 40.0 35.0 42.0 19.6 42.0 75-79 36.6019 40.0 35.0 42.0 27.0 42.0 80-84 35.6355 40.0 34.0 42.0 20.6 42.0 85-89 36.6349 42.0 35.0 42.0 23.8 42.0 90-94 38.74679999999999 42.0 38.0 42.0 31.0 42.0 95-99 35.1722 38.0 32.0 42.0 19.6 42.0 100-104 34.89835 38.0 33.0 42.0 13.2 42.0 105-109 35.24805 38.0 33.0 42.0 18.6 42.0 110-114 35.7962 39.0 33.0 42.0 20.6 42.0 115-119 36.5662 42.0 36.0 42.0 25.0 42.0 120-124 32.514300000000006 36.0 27.8 40.0 16.4 42.0 125-129 32.4414 35.0 25.8 41.0 17.6 42.0 130-134 35.038650000000004 38.0 32.0 42.0 20.8 42.0 135-139 33.223349999999996 36.0 28.0 42.0 15.4 42.0 140-144 31.306600000000003 35.0 23.8 41.0 13.2 42.0 145-149 33.24075 36.0 29.0 42.0 17.6 42.0 150 32.29675 37.0 27.0 42.0 11.0 42.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 3.0 21 6.0 22 7.0 23 14.0 24 20.0 25 28.0 26 42.0 27 53.0 28 83.0 29 95.0 30 114.0 31 162.0 32 197.0 33 240.0 34 268.0 35 376.0 36 449.0 37 488.0 38 492.0 39 434.0 40 342.0 41 85.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.424999999999997 9.675 13.05 45.85 2 27.800000000000004 11.85 31.674999999999997 28.675 3 25.35 16.575 22.275 35.8 4 28.525 19.875 19.425 32.175 5 29.975 24.5 20.474999999999998 25.05 6 24.775 28.549999999999997 24.224999999999998 22.45 7 17.875 25.650000000000002 34.55 21.925 8 19.3 23.225 30.675 26.8 9 22.525000000000002 20.025000000000002 31.55 25.900000000000002 10-14 24.240000000000002 25.330000000000002 24.07 26.36 15-19 24.466223311165557 24.301215060753037 23.821191059552977 27.411370568528426 20-24 24.09 24.82 24.125 26.965 25-29 24.64623231161558 24.366218310915546 23.53117655882794 27.456372818640933 30-34 24.459242940116162 24.35910274384138 23.743240536751454 27.43841377929101 35-39 25.430000000000003 23.905 23.735 26.93 40-44 24.386219310965547 25.141257062853146 23.646182309115456 26.826341317065854 45-49 25.82629131456573 24.16620831041552 23.2061603080154 26.80134006700335 50-54 24.125 24.955 23.255 27.665 55-59 25.429157699814827 23.472298683749564 24.09789299834843 27.000650618087185 60-64 25.495 23.18 23.995 27.33 65-69 24.76233363354348 23.78665065545882 23.586510557390174 27.864505153607528 70-74 25.245 24.04 22.775000000000002 27.939999999999998 75-79 25.1 23.825 23.01 28.065 80-84 25.443816572485872 24.128619292893934 23.033455018252738 27.394109116367453 85-89 25.835 23.815 23.13 27.22 90-94 25.555 23.485 23.105 27.855 95-99 25.031251562578127 23.836191809590478 23.426171308565426 27.706385319265962 100-104 25.676689848401463 23.565317456346627 23.039975984389855 27.71801671086206 105-109 25.135 23.71 23.125 28.03 110-114 25.613297286472413 23.515570241313707 23.07499749674577 27.796134975468107 115-119 26.450000000000003 22.78 23.064999999999998 27.705000000000002 120-124 25.742574257425744 24.232423242324234 22.257225722572258 27.767776777677767 125-129 25.82161972887799 24.481016457405833 22.60017007653444 27.09719373718173 130-134 26.151307565378268 23.52117605880294 22.686134306715335 27.641382069103454 135-139 25.942971485742873 24.67233616808404 22.426213106553277 26.95847923961981 140-144 25.814999999999998 24.52 22.18 27.485 145-149 25.695 24.404999999999998 22.215 27.685 150 24.875 24.55 23.925 26.650000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 1.0 9 1.0 10 0.0 11 1.0 12 1.0 13 0.5 14 0.5 15 1.5 16 2.0 17 1.0 18 1.5 19 1.5 20 0.5 21 0.0 22 2.5 23 3.0 24 0.5 25 1.0 26 2.0 27 2.5 28 3.5 29 5.5 30 8.5 31 9.5 32 9.5 33 14.5 34 18.0 35 24.5 36 30.0 37 36.0 38 53.0 39 76.0 40 85.5 41 102.5 42 122.0 43 133.5 44 154.0 45 162.5 46 164.0 47 164.5 48 167.5 49 161.5 50 145.5 51 134.0 52 144.0 53 138.0 54 123.0 55 113.5 56 111.0 57 102.0 58 84.5 59 82.0 60 72.0 61 70.0 62 76.0 63 81.5 64 79.5 65 68.5 66 65.5 67 63.0 68 63.5 69 65.0 70 54.5 71 51.0 72 51.5 73 42.0 74 29.5 75 32.5 76 33.0 77 26.0 78 16.5 79 9.5 80 11.5 81 9.0 82 8.5 83 7.0 84 1.5 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.0 25-29 0.005 30-34 0.13999999999999999 35-39 0.0 40-44 0.005 45-49 0.005 50-54 0.0 55-59 0.095 60-64 0.0 65-69 0.06999999999999999 70-74 0.0 75-79 0.0 80-84 0.015 85-89 0.0 90-94 0.0 95-99 0.005 100-104 0.065 105-109 0.0 110-114 0.13 115-119 0.0 120-124 0.01 125-129 0.045 130-134 0.005 135-139 0.05 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.225 #Duplication Level Percentage of deduplicated Percentage of total 1 97.48007199794291 94.77499999999999 2 2.339933144767292 4.55 3 0.15428130624839292 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025713551041398816 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTAGCTTATCTCGTATGC 9 0.22499999999999998 TruSeq Adapter, Index 10 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.4125 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.7 0.0 0.0 0.0 0.0 112-113 0.8875 0.0 0.0 0.0 0.0 114-115 1.0 0.0 0.0 0.0 0.0 116-117 1.125 0.0 0.0 0.0 0.0 118-119 1.2125 0.0 0.0 0.0 0.0 120-121 1.2625000000000002 0.0 0.0 0.0 0.0 122-123 1.45 0.0 0.0 0.0 0.0 124-125 1.6 0.0 0.0 0.0 0.0 126-127 1.9625 0.0 0.0 0.0 0.0 128-129 2.375 0.0 0.0 0.0 0.0 130-131 2.7750000000000004 0.0 0.0 0.0 0.0 132-133 3.075 0.0 0.0 0.0 0.0 134-135 3.6125 0.0 0.0 0.0 0.0 136-137 4.2125 0.0 0.0 0.0 0.0 138 4.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGCACT 10 0.006973645 144.0 2 TGATTAT 10 0.006973645 144.0 6 TCTCATT 10 0.006973645 144.0 2 GTTGCAC 10 0.006973645 144.0 1 >>END_MODULE SRR5831620 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5831620_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.36025 32.0 32.0 32.0 32.0 32.0 2 31.77025 32.0 32.0 32.0 32.0 37.0 3 34.9415 37.0 37.0 37.0 32.0 37.0 4 35.90775 37.0 37.0 37.0 32.0 37.0 5 36.1415 37.0 37.0 37.0 37.0 37.0 6 39.1615 42.0 37.0 42.0 32.0 42.0 7 39.534 42.0 37.0 42.0 37.0 42.0 8 39.562 42.0 37.0 42.0 32.0 42.0 9 39.8425 42.0 37.0 42.0 37.0 42.0 10-14 39.801300000000005 42.0 40.0 42.0 36.0 42.0 15-19 39.0606 42.0 37.0 42.0 33.0 42.0 20-24 38.9128 42.0 37.0 42.0 32.0 42.0 25-29 38.1423 42.0 37.0 42.0 28.0 42.0 30-34 39.18035 42.0 37.0 42.0 32.0 42.0 35-39 38.4774 42.0 37.0 42.0 31.0 42.0 40-44 38.08285 41.0 36.0 42.0 30.0 42.0 45-49 38.018600000000006 42.0 37.0 42.0 30.0 42.0 50-54 38.130849999999995 42.0 37.0 42.0 31.0 42.0 55-59 37.77925 42.0 37.0 42.0 29.0 42.0 60-64 36.4884 41.0 35.0 42.0 23.8 42.0 65-69 36.04625 40.0 35.0 42.0 23.8 42.0 70-74 37.2235 42.0 36.0 42.0 27.0 42.0 75-79 36.6947 40.0 36.0 42.0 27.0 42.0 80-84 37.4178 42.0 37.0 42.0 27.0 42.0 85-89 37.4265 42.0 37.0 42.0 28.0 42.0 90-94 37.451 42.0 37.0 42.0 28.0 42.0 95-99 36.48265 41.0 34.0 42.0 26.0 42.0 100-104 35.02115 37.0 32.0 42.0 20.8 42.0 105-109 33.77765 36.0 30.0 42.0 19.8 42.0 110-114 34.5467 37.0 31.0 42.0 19.8 42.0 115-119 33.29575 36.0 31.0 42.0 19.8 42.0 120-124 33.217549999999996 36.0 31.0 42.0 19.8 42.0 125-129 30.561899999999998 33.0 23.8 39.0 13.2 42.0 130-134 29.0305 31.0 20.8 37.0 11.0 42.0 135-139 29.344599999999996 31.0 22.8 37.0 13.2 42.0 140-144 28.438200000000002 31.0 21.8 37.0 11.0 42.0 145-149 29.278499999999998 31.0 22.8 36.0 11.0 42.0 150 29.19175 32.0 22.0 37.0 11.0 42.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 1.0 16 0.0 17 1.0 18 1.0 19 6.0 20 6.0 21 5.0 22 21.0 23 14.0 24 23.0 25 30.0 26 50.0 27 47.0 28 70.0 29 99.0 30 108.0 31 141.0 32 162.0 33 247.0 34 316.0 35 408.0 36 488.0 37 563.0 38 547.0 39 392.0 40 205.0 41 48.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.724999999999998 16.75 12.075 39.45 2 29.325000000000003 24.05 26.950000000000003 19.675 3 26.174999999999997 26.325 22.425 25.074999999999996 4 28.625 29.225 18.575 23.575 5 31.05 31.175000000000004 18.4 19.375 6 24.05 34.275 19.475 22.2 7 22.8 18.175 34.775 24.25 8 24.474999999999998 22.650000000000002 24.45 28.425 9 25.8 20.724999999999998 27.075 26.400000000000002 10-14 26.95634781739087 25.371268563428174 21.44607230361518 26.226311315565777 15-19 26.974999999999998 23.955000000000002 23.47 25.6 20-24 27.029999999999998 24.72 22.845 25.405 25-29 27.529999999999998 23.9 22.57 26.0 30-34 26.935 24.490000000000002 22.52 26.055 35-39 27.16 24.705 22.415 25.72 40-44 27.52637631881594 23.796189809490475 22.741137056852843 25.93629681484074 45-49 26.979999999999997 23.93 22.935 26.155 50-54 27.834999999999997 23.330000000000002 22.845 25.990000000000002 55-59 27.47912186828024 23.918587788168225 22.72340851127669 25.878881832274843 60-64 27.05 24.02 22.53 26.400000000000002 65-69 27.781392322706573 23.902707572193584 22.711575997197336 25.60432410790251 70-74 28.318406964526943 23.72041827187672 22.33952068844749 25.621654075148847 75-79 27.73 22.875 23.655 25.740000000000002 80-84 27.687377960246334 23.832173434136084 22.360186251439444 26.12026235417814 85-89 27.73 23.225 22.985 26.06 90-94 28.126406320316015 23.44617230861543 22.706135306765336 25.721286064303218 95-99 28.275 23.395 22.21 26.119999999999997 100-104 28.22 23.97 22.720000000000002 25.09 105-109 28.009409880374392 23.424595825616898 23.04419640622654 25.52179788778217 110-114 28.206410320516024 23.481174058702937 22.756137806890344 25.556277813890695 115-119 27.73802971931756 24.250762995947365 22.469605243408218 25.54160204132686 120-124 28.46558197747184 23.779724655819777 22.473091364205256 25.281602002503128 125-129 28.34 24.18 23.005 24.474999999999998 130-134 28.705788183500925 24.218320076041824 22.462354294862173 24.613537445595078 135-139 28.868094475580463 23.839071257005603 22.883306645316253 24.40952762209768 140-144 28.98884274778606 24.54095161855206 22.34952719267524 24.120678440986644 145-149 29.99148253920537 24.354927601583245 22.375870534595922 23.27771932461546 150 28.7 24.5 22.425 24.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.5 13 1.0 14 1.5 15 2.0 16 1.5 17 1.0 18 1.5 19 2.0 20 2.0 21 2.5 22 1.5 23 0.5 24 1.0 25 1.0 26 1.0 27 2.5 28 2.5 29 2.5 30 3.5 31 4.5 32 4.5 33 6.5 34 11.5 35 20.0 36 29.5 37 45.0 38 60.5 39 72.0 40 82.5 41 96.5 42 113.0 43 134.5 44 136.0 45 129.5 46 151.5 47 162.5 48 156.5 49 147.0 50 135.0 51 134.0 52 129.5 53 117.0 54 121.5 55 120.5 56 111.0 57 111.5 58 98.0 59 95.0 60 103.0 61 93.5 62 85.5 63 84.5 64 84.0 65 87.0 66 88.5 67 79.5 68 71.0 69 71.5 70 62.5 71 54.0 72 55.0 73 39.5 74 32.0 75 33.5 76 22.5 77 15.5 78 15.5 79 13.5 80 10.5 81 6.5 82 6.0 83 7.0 84 4.5 85 1.0 86 1.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.005 45-49 0.0 50-54 0.0 55-59 0.015 60-64 0.0 65-69 0.095 70-74 0.065 75-79 0.0 80-84 0.135 85-89 0.0 90-94 0.005 95-99 0.0 100-104 0.0 105-109 0.105 110-114 0.005 115-119 0.065 120-124 0.125 125-129 0.0 130-134 0.055 135-139 0.08 140-144 0.065 145-149 0.20500000000000002 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.39999999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 95.78092243186582 91.375 2 3.878406708595388 7.3999999999999995 3 0.3144654088050315 0.8999999999999999 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.026205450733752623 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 13 0.325 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.025 0.0 0.0 16-17 0.0 0.0 0.025 0.0 0.0 18-19 0.0 0.0 0.025 0.0 0.0 20-21 0.0 0.0 0.025 0.0 0.0 22-23 0.0 0.0 0.025 0.0 0.0 24-25 0.0 0.0 0.025 0.0 0.0 26-27 0.0 0.0 0.025 0.0 0.0 28-29 0.0 0.0 0.025 0.0 0.0 30-31 0.0 0.0 0.025 0.0 0.0 32-33 0.0 0.0 0.025 0.0 0.0 34-35 0.0 0.0 0.025 0.0 0.0 36-37 0.0 0.0 0.025 0.0 0.0 38-39 0.0 0.0 0.025 0.0 0.0 40-41 0.0 0.0 0.025 0.0 0.0 42-43 0.0 0.0 0.025 0.0 0.0 44-45 0.0 0.0 0.025 0.0 0.0 46-47 0.0 0.0 0.025 0.0 0.0 48-49 0.0 0.0 0.025 0.0 0.0 50-51 0.0 0.0 0.025 0.0 0.0 52-53 0.0 0.0 0.025 0.0 0.0 54-55 0.0 0.0 0.025 0.0 0.0 56-57 0.0 0.0 0.025 0.0 0.0 58-59 0.0 0.0 0.025 0.0 0.0 60-61 0.0 0.0 0.025 0.0 0.0 62-63 0.0 0.0 0.025 0.0 0.0 64-65 0.0 0.0 0.025 0.0 0.0 66-67 0.0 0.0 0.025 0.0 0.0 68-69 0.0 0.0 0.025 0.0 0.0 70-71 0.0125 0.0 0.025 0.0 0.0 72-73 0.025 0.0 0.025 0.0 0.0 74-75 0.025 0.0 0.025 0.0 0.0 76-77 0.025 0.0 0.025 0.0 0.0 78-79 0.025 0.0 0.025 0.0 0.0 80-81 0.025 0.0 0.025 0.0 0.0 82-83 0.025 0.0 0.025 0.0 0.0 84-85 0.025 0.0 0.025 0.0 0.0 86-87 0.025 0.0 0.025 0.0 0.0 88-89 0.025 0.0 0.025 0.0 0.0 90-91 0.025 0.0 0.025 0.0 0.0 92-93 0.037500000000000006 0.0 0.025 0.0 0.0 94-95 0.05 0.0 0.025 0.0 0.0 96-97 0.1 0.0 0.025 0.0 0.0 98-99 0.125 0.0 0.025 0.0 0.0 100-101 0.125 0.0 0.025 0.0 0.0 102-103 0.21250000000000002 0.0 0.025 0.0 0.0 104-105 0.32499999999999996 0.0 0.025 0.0 0.0 106-107 0.375 0.0 0.025 0.0 0.0 108-109 0.475 0.0 0.025 0.0 0.0 110-111 0.675 0.0 0.025 0.0 0.0 112-113 0.9125 0.0 0.025 0.0 0.0 114-115 1.1124999999999998 0.0 0.025 0.0 0.0 116-117 1.3875000000000002 0.0 0.025 0.0 0.0 118-119 1.5750000000000002 0.0 0.025 0.0 0.0 120-121 1.7125 0.0 0.025 0.0 0.0 122-123 2.0 0.0 0.025 0.0 0.0 124-125 2.225 0.0 0.025 0.0 0.0 126-127 2.5125 0.0 0.025 0.0 0.0 128-129 2.8875 0.0 0.025 0.0 0.0 130-131 3.2 0.0 0.025 0.0 0.0 132-133 3.6125 0.0 0.025 0.0 0.0 134-135 4.1625 0.0 0.025 0.0 0.0 136-137 4.7125 0.0 0.025 0.0 0.0 138 4.95 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1143969 spots for SRR5831620.sra Written 1143969 spots for SRR5831620.sra Read 1143969 spots for SRR5831620.sra Written 1143969 spots for SRR5831620.sra Read 1143969 spots for SRR5831620.sra Written 1143969 spots for SRR5831620.sra Read 1143969 spots for SRR5831620.sra Written 1143969 spots for SRR5831620.sra Read 1143969 spots for SRR5831620.sra Written 1143969 spots for SRR5831620.sra Read 1143969 spots for SRR5831620.sra Written 1143969 spots for SRR5831620.sra Read 1143969 spots for SRR5831620.sra Written 1143969 spots for SRR5831620.sra Read 1143969 spots for SRR5831620.sra Written 1143969 spots for SRR5831620.sra Read 1143969 spots for SRR5831620.sra Written 1143969 spots for SRR5831620.sra Read 1143983 spots for SRR5831620.sra Written 1143983 spots for SRR5831620.sra Read 1143969 spots for SRR5831620.sra Written 1143969 spots for SRR5831620.sra Read 1143969 spots for SRR5831620.sra Written 1143969 spots for SRR5831620.sra Read 1143969 spots for SRR5831620.sra Written 1143969 spots for SRR5831620.sra Read 1143969 spots for SRR5831620.sra Written 1143969 spots for SRR5831620.sra Read 1143969 spots for SRR5831620.sra Written 1143969 spots for SRR5831620.sra Read 1143969 spots for SRR5831620.sra Written 1143969 spots for SRR5831620.sra Read 1143969 spots for SRR5831620.sra Written 1143969 spots for SRR5831620.sra Read 1143969 spots for SRR5831620.sra Written 1143969 spots for SRR5831620.sra Read 1143969 spots for SRR5831620.sra Written 1143969 spots for SRR5831620.sra Read 1143969 spots for SRR5831620.sra Written 1143969 spots for SRR5831620.sra SRR ids: ['SRR5831620.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_47884h8z SRR5831620.sra spots: 22879394 blocks: [[1, 1143969], [1143970, 2287938], [2287939, 3431907], [3431908, 4575876], [4575877, 5719845], [5719846, 6863814], [6863815, 8007783], [8007784, 9151752], [9151753, 10295721], [10295722, 11439690], [11439691, 12583659], [12583660, 13727628], [13727629, 14871597], [14871598, 16015566], [16015567, 17159535], [17159536, 18303504], [18303505, 19447473], [19447474, 20591442], [20591443, 21735411], [21735412, 22879394]] SRR5831620 file size 7686689 SRR5831620 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5831620 SRR5831620_1.fastq SRR5831620_2.fastq Input file: SRR5831620_1.fastq Paired file: SRR5831620_2.fastq trimmed: SRR5831620-trimmed-pair1.fastq, SRR5831620-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 01:25:05 2024 >> started Sat Dec 7 01:25:29 2024 >> done (23.600s) 22879394 read pairs processed; of these: 1411 ( 0.01%) short read pairs filtered out after trimming by size control 73887 ( 0.32%) empty read pairs filtered out after trimming by size control 22804096 (99.67%) read pairs available; of these: 2700616 (11.84%) trimmed read pairs available after processing 20103480 (88.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 100 0.00% 19 78 0.00% 20 75 0.00% 21 78 0.00% 22 71 0.00% 23 67 0.00% 24 95 0.00% 25 87 0.00% 26 89 0.00% 27 89 0.00% 28 87 0.00% 29 78 0.00% 30 73 0.00% 31 81 0.00% 32 88 0.00% 33 94 0.00% 34 85 0.00% 35 88 0.00% 36 92 0.00% 37 83 0.00% 38 85 0.00% 39 103 0.00% 40 110 0.00% 41 131 0.00% 42 116 0.00% 43 111 0.00% 44 95 0.00% 45 143 0.00% 46 139 0.00% 47 147 0.00% 48 114 0.00% 49 142 0.00% 50 151 0.00% 51 140 0.00% 52 147 0.00% 53 185 0.00% 54 188 0.00% 55 188 0.00% 56 177 0.00% 57 179 0.00% 58 202 0.00% 59 191 0.00% 60 216 0.00% 61 217 0.00% 62 213 0.00% 63 256 0.00% 64 280 0.00% 65 267 0.00% 66 264 0.00% 67 310 0.00% 68 336 0.00% 69 361 0.00% 70 373 0.00% 71 370 0.00% 72 471 0.00% 73 493 0.00% 74 556 0.00% 75 628 0.00% 76 687 0.00% 77 669 0.00% 78 707 0.00% 79 833 0.00% 80 888 0.00% 81 910 0.00% 82 1022 0.00% 83 1134 0.00% 84 1391 0.01% 85 1463 0.01% 86 1601 0.01% 87 1801 0.01% 88 1925 0.01% 89 2136 0.01% 90 2110 0.01% 91 2502 0.01% 92 2750 0.01% 93 2982 0.01% 94 3353 0.01% 95 3818 0.02% 96 4392 0.02% 97 4692 0.02% 98 5014 0.02% 99 5527 0.02% 100 5921 0.03% 101 6457 0.03% 102 7142 0.03% 103 7697 0.03% 104 8356 0.04% 105 9184 0.04% 106 10149 0.04% 107 11381 0.05% 108 12239 0.05% 109 13150 0.06% 110 14307 0.06% 111 15252 0.07% 112 16178 0.07% 113 17341 0.08% 114 18673 0.08% 115 20372 0.09% 116 22412 0.10% 117 24824 0.11% 118 26110 0.11% 119 27669 0.12% 120 29428 0.13% 121 31430 0.14% 122 32736 0.14% 123 35428 0.16% 124 38073 0.17% 125 38392 0.17% 126 41509 0.18% 127 43684 0.19% 128 48492 0.21% 129 50370 0.22% 130 54655 0.24% 131 58548 0.26% 132 60491 0.27% 133 62533 0.27% 134 64121 0.28% 135 65555 0.29% 136 67837 0.30% 137 71895 0.32% 138 76531 0.34% 139 78670 0.34% 140 82358 0.36% 141 86526 0.38% 142 86541 0.38% 143 90356 0.40% 144 94256 0.41% 145 95554 0.42% 146 97609 0.43% 147 102560 0.45% 148 120679 0.53% 149 434205 1.90% 150 20103480 88.16% 22804096 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=52.82 fanout-score-rank=3 prefix-density=1.13 prefix-fanout=8.2 sequence=GGCGGCGGCGGCCTCG criterion=fanout-score sequence-density=0.13 sequence-density-rank=11 fanout-score=263.32 fanout-score-rank=1 prefix-density=1.02 prefix-fanout=33.0 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=8.27 fanout-score-rank=17 prefix-density=0.44 prefix-fanout=4.1 sequence=CTGCAAGTGCGGCA criterion=fanout-score sequence-density=0.11 sequence-density-rank=23 fanout-score=239.70 fanout-score-rank=1 prefix-density=1.08 prefix-fanout=24.1 sequence=CGCCGCCGCCGTCG SRR5831620 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 01:26:23 Started mapping on | Dec 07 01:26:23 Finished on | Dec 07 01:30:38 Mapping speed, Million of reads per hour | 321.94 Number of input reads | 22804096 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 20413822 Uniquely mapped reads % | 89.52% Average mapped length | 294.68 Number of splices: Total | 20045917 Number of splices: Annotated (sjdb) | 18927774 Number of splices: GT/AG | 19781990 Number of splices: GC/AG | 223290 Number of splices: AT/AC | 13078 Number of splices: Non-canonical | 27559 Mismatch rate per base, % | 0.58% Deletion rate per base | 0.01% Deletion average length | 2.16 Insertion rate per base | 0.01% Insertion average length | 2.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 369307 % of reads mapped to multiple loci | 1.62% Number of reads mapped to too many loci | 157561 % of reads mapped to too many loci | 0.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.27% % of reads unmapped: other | 4.90% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2020967 2020967 2020967 N_multimapping 369307 369307 369307 N_noFeature 442805 19662636 841128 N_ambiguous 436764 2928 87100 UnstrandedReadsAssigned:19534253 PositiveStrandReadsAssigned:748258 NegativeStrandReadsAssigned:19485594 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR5831620 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5831620-trimmed-pair1.fastq SRR5831620-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,804,096 reads, 19,866,320 reads pseudoaligned [quant] estimated average fragment length: 210.168 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,171 rounds 52973 SRR5831620.ke.tsv 35125 SRR5831620.se.tsv 88098 total ==> SRR5831620.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 727.26 0 0 PNS24247 1044 834.832 46.3428 3.15639 PNS24249 1928 1718.83 88.3078 2.92128 PNS24246 1044 834.832 46.3428 3.15639 PNS24248 1044 834.832 46.3428 3.15639 PNS24244 1471 1261.83 47.6638 2.1478 PNS24243 293 94.9098 0 0 KQK14069 1603 1393.83 15286.3 623.591 KQK14071 474 267.669 592.368 125.835 ==> SRR5831620.se.tsv <== BRADI_1g14170v3 16211 BRADI_1g53295v3 49 BRADI_1g59795v3 141 BRADI_1g07683v3 0 BRADI_1g00485v3 12 BRADI_1g20270v3 1019 BRADI_1g74790v3 1523 BRADI_1g09890v3 0 BRADI_1g77505v3 391 BRADI_1g48960v3 0 SRR5831620 completed mapping pipeline successfully