Starting /dee2/code/volunteer_pipeline.sh SRR5831621 current disk space = 1548257165312 free memory = 1603130500 SRR5831621 SRAfilesize bea4ecf430ee45fd2dcc6edfe30c86b4 SRR5831621.sra SRR5831621.sra file validated SRR5831621 is paired end SRR5831621 is conventional basespace SRR5831621 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5831621_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.935 32.0 32.0 32.0 27.0 32.0 2 31.3145 32.0 32.0 32.0 27.0 32.0 3 35.4515 37.0 37.0 37.0 32.0 37.0 4 33.64825 37.0 32.0 37.0 27.0 37.0 5 35.2125 37.0 37.0 37.0 32.0 37.0 6 38.36425 42.0 37.0 42.0 32.0 42.0 7 38.26325 42.0 37.0 42.0 32.0 42.0 8 39.11475 42.0 37.0 42.0 32.0 42.0 9 39.7165 42.0 37.0 42.0 37.0 42.0 10-14 39.15745 42.0 37.0 42.0 33.0 42.0 15-19 37.00275 39.0 34.0 42.0 29.0 42.0 20-24 36.31165 38.0 35.0 42.0 24.8 42.0 25-29 37.60365 42.0 37.0 42.0 30.0 42.0 30-34 35.51175 39.0 32.0 42.0 20.6 42.0 35-39 36.9142 40.0 35.0 42.0 27.0 42.0 40-44 35.4406 38.0 32.0 42.0 22.8 42.0 45-49 35.133 39.0 31.0 42.0 19.8 42.0 50-54 33.888349999999996 38.0 31.0 42.0 17.4 42.0 55-59 33.61685 37.0 30.0 42.0 17.6 42.0 60-64 35.29055 38.0 33.0 42.0 20.6 42.0 65-69 35.916250000000005 40.0 34.0 42.0 23.8 42.0 70-74 32.3976 36.0 29.0 41.0 11.0 42.0 75-79 31.7231 35.0 26.0 40.0 13.2 42.0 80-84 34.608450000000005 37.0 32.0 42.0 17.6 42.0 85-89 34.8601 37.0 31.0 42.0 17.6 42.0 90-94 35.44969999999999 37.0 32.0 42.0 22.0 42.0 95-99 33.07765 37.0 29.0 42.0 15.4 42.0 100-104 33.88015 37.0 31.0 42.0 17.6 42.0 105-109 32.28535 37.0 27.0 42.0 11.0 42.0 110-114 32.51525 37.0 27.0 42.0 11.0 42.0 115-119 32.2996 37.0 28.0 42.0 13.2 42.0 120-124 33.21805 37.0 29.0 42.0 15.4 42.0 125-129 29.588599999999996 32.0 22.0 39.0 11.0 42.0 130-134 30.131100000000004 34.0 24.0 39.0 11.0 42.0 135-139 30.217200000000002 34.0 21.8 40.0 11.0 42.0 140-144 29.01875 32.0 20.8 37.0 11.0 42.0 145-149 27.38225 31.0 15.4 37.0 11.0 42.0 150 30.141 32.0 22.0 37.0 11.0 42.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 3.0 20 4.0 21 10.0 22 14.0 23 19.0 24 31.0 25 45.0 26 86.0 27 101.0 28 132.0 29 171.0 30 250.0 31 308.0 32 330.0 33 385.0 34 416.0 35 445.0 36 381.0 37 345.0 38 278.0 39 169.0 40 65.0 41 12.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.8 10.025 12.3 45.875 2 28.299999999999997 12.3 31.25 28.15 3 25.15 17.025000000000002 23.1 34.725 4 28.925 21.4 17.7 31.974999999999998 5 29.9 24.95 21.325 23.825 6 23.325000000000003 30.9 23.45 22.325 7 18.7 24.075 35.449999999999996 21.775 8 20.549999999999997 23.375 30.175 25.900000000000002 9 21.099999999999998 20.325 32.574999999999996 26.0 10-14 24.055 24.654999999999998 24.715 26.575 15-19 24.14 24.325 24.060000000000002 27.474999999999998 20-24 24.27 25.365 23.549999999999997 26.815 25-29 24.04746407650328 24.833525259099783 23.68197066039153 27.437040004005407 30-34 24.310000000000002 25.330000000000002 23.1 27.26 35-39 24.25 24.765 23.945 27.04 40-44 25.009999999999998 24.735 22.91 27.345000000000002 45-49 24.249862245153533 24.39513099233582 23.4934629063768 27.861543856133846 50-54 24.545 24.66 23.28 27.515 55-59 25.169249285391903 24.050950303395016 23.113183892482823 27.66661651873025 60-64 24.95 24.07 23.57 27.41 65-69 24.981222773020882 24.63071453607731 23.459015572580242 26.929047118321563 70-74 25.156351628558564 24.595987391804673 22.39955971381398 27.848101265822784 75-79 24.79 23.845 23.285 28.08 80-84 25.569999999999997 23.66 23.215 27.555000000000003 85-89 25.424999999999997 23.82 22.91 27.845 90-94 25.509999999999998 23.315 23.215 27.96 95-99 26.005 23.810000000000002 22.56 27.625 100-104 25.374999999999996 23.845 23.005 27.775 105-109 25.069999999999997 24.015 23.115 27.800000000000004 110-114 25.740000000000002 24.075 23.0 27.185 115-119 25.874999999999996 23.405 22.455 28.265 120-124 25.345000000000002 23.7 22.825 28.13 125-129 25.840000000000003 24.32 21.425 28.415000000000003 130-134 25.955000000000002 23.630000000000003 21.83 28.585 135-139 25.809519043090933 24.187978579650668 21.42535408638206 28.57714829087633 140-144 25.485000000000003 24.285 21.37 28.860000000000003 145-149 25.880228708997894 25.087772093489818 20.62894974420704 28.403049453305247 150 25.474999999999998 24.4 23.225 26.900000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.5 20 1.5 21 0.5 22 1.0 23 1.5 24 1.0 25 0.5 26 2.5 27 5.0 28 4.5 29 4.0 30 6.5 31 6.5 32 11.0 33 14.5 34 15.0 35 28.0 36 40.5 37 51.5 38 67.0 39 78.5 40 93.0 41 115.5 42 125.5 43 134.5 44 146.0 45 151.0 46 161.0 47 166.0 48 163.5 49 160.0 50 155.5 51 147.5 52 130.5 53 115.0 54 109.0 55 109.5 56 103.0 57 86.5 58 78.5 59 75.5 60 80.0 61 86.5 62 82.0 63 75.5 64 80.5 65 81.0 66 75.0 67 79.0 68 70.0 69 59.0 70 57.5 71 49.5 72 44.5 73 37.5 74 33.0 75 30.0 76 27.0 77 19.5 78 12.0 79 13.0 80 9.5 81 8.5 82 9.5 83 4.5 84 1.5 85 1.5 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.135 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.185 50-54 0.0 55-59 0.295 60-64 0.0 65-69 0.145 70-74 0.065 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.095 140-144 0.0 145-149 0.31 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.375 #Duplication Level Percentage of deduplicated Percentage of total 1 97.53530166880616 94.975 2 2.362002567394095 4.6 3 0.07702182284980745 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025673940949935817 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGC 8 0.2 TruSeq Adapter, Index 11 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.3875 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.5874999999999999 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.85 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.2125 0.0 0.0 0.0 0.0 112-113 1.4375 0.0 0.0 0.0 0.0 114-115 1.5499999999999998 0.0 0.0 0.0 0.0 116-117 1.65 0.0 0.0 0.0 0.0 118-119 1.85 0.0 0.0 0.0 0.0 120-121 1.9625 0.0 0.0 0.0 0.0 122-123 2.225 0.0 0.0 0.0 0.0 124-125 2.5999999999999996 0.0 0.0 0.0 0.0 126-127 2.875 0.0 0.0 0.0 0.0 128-129 3.2 0.0 0.0 0.0 0.0 130-131 3.5125 0.0 0.0 0.0 0.0 132-133 4.075 0.0 0.0 0.0 0.0 134-135 4.4 0.0 0.0 0.0 0.0 136-137 4.775 0.0 0.0 0.0 0.0 138 5.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5831621 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5831621_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 54 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.548 32.0 32.0 32.0 27.0 32.0 2 29.9735 32.0 32.0 32.0 27.0 32.0 3 33.9095 37.0 32.0 37.0 27.0 37.0 4 33.79975 37.0 32.0 37.0 27.0 37.0 5 33.8475 37.0 32.0 37.0 27.0 37.0 6 36.285 37.0 37.0 42.0 27.0 42.0 7 33.0285 37.0 27.0 42.0 11.0 42.0 8 35.49425 37.0 32.0 42.0 27.0 42.0 9 34.81875 37.0 32.0 42.0 27.0 42.0 10-14 36.0863 38.0 35.0 42.0 25.0 42.0 15-19 34.57535 37.0 32.0 42.0 18.6 42.0 20-24 34.75205 37.0 31.0 42.0 20.8 42.0 25-29 35.1917 38.0 31.0 42.0 21.8 42.0 30-34 35.37235 37.0 32.0 42.0 22.0 42.0 35-39 33.4317 37.0 31.0 42.0 15.4 42.0 40-44 33.589150000000004 37.0 31.0 42.0 15.4 42.0 45-49 32.7727 37.0 29.0 42.0 13.2 42.0 50-54 32.83505 37.0 28.0 42.0 11.0 42.0 55-59 31.162650000000003 36.0 27.0 40.0 11.0 42.0 60-64 29.179650000000002 32.0 20.8 38.0 11.0 42.0 65-69 29.667449999999995 34.0 24.0 38.0 11.0 42.0 70-74 28.05635 32.0 17.6 37.0 11.0 42.0 75-79 28.0796 32.0 18.6 36.0 11.0 41.0 80-84 28.242150000000002 32.0 19.8 37.0 11.0 42.0 85-89 28.304450000000003 32.0 17.6 37.0 11.0 42.0 90-94 29.3016 32.0 22.0 37.0 11.0 42.0 95-99 28.15315 32.0 22.0 37.0 11.0 42.0 100-104 26.6115 30.0 17.6 36.0 11.0 41.0 105-109 24.918400000000002 27.0 11.0 32.0 11.0 37.0 110-114 23.46785 25.0 11.0 32.0 11.0 37.0 115-119 23.8286 26.0 11.0 32.0 11.0 37.0 120-124 25.02875 27.0 11.0 32.0 11.0 37.0 125-129 25.586350000000003 27.0 13.2 32.0 11.0 37.0 130-134 25.10925 27.0 11.0 32.0 11.0 37.0 135-139 24.99315 27.0 11.0 32.0 11.0 38.0 140-144 23.25395 25.0 11.0 32.0 11.0 37.0 145-149 22.847649999999998 25.0 11.0 32.0 11.0 37.0 150 21.71875 22.0 11.0 32.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 1.0 4 3.0 5 7.0 6 5.0 7 1.0 8 1.0 9 1.0 10 2.0 11 1.0 12 5.0 13 1.0 14 2.0 15 4.0 16 13.0 17 9.0 18 15.0 19 32.0 20 50.0 21 62.0 22 101.0 23 134.0 24 189.0 25 200.0 26 267.0 27 310.0 28 305.0 29 354.0 30 366.0 31 347.0 32 308.0 33 271.0 34 217.0 35 163.0 36 103.0 37 66.0 38 42.0 39 18.0 40 9.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.60162189559047 14.749113025848962 13.101875316776482 40.54738976178409 2 27.746975806451612 24.621975806451612 27.091733870967744 20.539314516129032 3 24.748995983935743 27.535140562248994 21.812248995983936 25.903614457831324 4 30.22255943348508 28.249873545776428 18.007081436519982 23.520485584218513 5 29.590288315629742 31.208902377339403 18.740515933232167 20.460293373798685 6 23.242286292362166 35.35660091047041 19.575113808801213 21.82599898836621 7 24.51874366767984 19.427558257345492 32.72543059777102 23.32826747720365 8 23.20568095358864 21.354298757291403 24.144052751711893 31.295967537408064 9 24.397666751204667 19.705807760588385 27.212782145574437 28.68374334263251 10-14 26.83420134499671 23.987460181018356 22.13682560550134 27.04151286848359 15-19 26.67575895337678 24.03394453705107 23.321715411425973 25.96858109814618 20-24 26.889483515928713 24.249002877770483 22.557681627707378 26.30383197859343 25-29 27.41724519569373 23.865580038233222 22.10987020827045 26.607304557802596 30-34 26.729972724517626 24.012526517830086 23.0427315890494 26.214769168602892 35-39 27.457678203646957 24.01667755061034 22.238408599989953 26.287235645752748 40-44 28.32099138582439 23.706614276358874 21.888066092388293 26.08432824542844 45-49 27.564296520423596 23.46444780635401 22.48108925869894 26.490166414523447 50-54 27.810710338591377 23.535617401788407 22.676579925650557 25.977092333969658 55-59 27.92441359744668 23.37504432848675 22.564466285019506 26.136075789047062 60-64 28.344511118955175 24.441530936412686 21.915183298875498 25.298774645756644 65-69 27.809783707297353 24.30260764099454 22.26096624216697 25.626642409541134 70-74 28.682327870516005 23.15185955654777 22.431376528489523 25.734436044446703 75-79 27.98086606243706 23.89728096676737 22.079556898288015 26.042296072507554 80-84 27.749088699878495 24.053260429323615 22.34710409072499 25.850546780072904 85-89 28.566377045867853 23.70175793089513 21.903414831279047 25.82845019195797 90-94 28.069199251353126 22.980423895998786 22.833729576609844 26.11664727603824 95-99 28.25339000202388 23.436551305403764 22.374013357619916 25.93604533495244 100-104 29.233962837324697 23.695002784669132 21.431826236646245 25.63920814135993 105-109 28.311911749822894 23.691934014775832 22.60398745066289 25.392166784738386 110-114 29.292469529155916 23.506802205027057 22.156476002629848 25.044252263187172 115-119 29.209274071074216 23.499038169484663 22.34484155107826 24.946846208362864 120-124 28.275966948851828 23.080042581233844 22.294317432959904 26.349673036954428 125-129 28.46814964610718 23.559150657229523 21.90596562184024 26.066734074823056 130-134 29.035194174757283 22.5121359223301 22.658778317152102 25.79389158576052 135-139 29.12434945177101 23.20246576726795 22.33338386135112 25.33980091960992 140-144 29.320056326694832 22.64131965399316 22.11828605914303 25.920337960168983 145-149 29.61972967520678 23.547508573734113 21.535202743594915 25.297559007464194 150 30.431510286001 26.04114400401405 20.22077270446563 23.30657300551932 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 12.0 1 8.0 2 2.0 3 0.5 4 0.5 5 0.0 6 1.0 7 2.0 8 2.0 9 1.0 10 1.5 11 4.0 12 3.0 13 1.5 14 1.0 15 0.5 16 1.0 17 1.0 18 1.0 19 1.0 20 1.5 21 1.0 22 0.5 23 1.5 24 1.5 25 3.0 26 4.5 27 2.0 28 2.0 29 4.5 30 4.5 31 5.0 32 8.0 33 14.0 34 17.0 35 24.5 36 35.5 37 38.0 38 45.5 39 65.0 40 80.0 41 100.5 42 113.0 43 121.5 44 138.0 45 145.0 46 143.0 47 149.0 48 151.5 49 144.5 50 138.5 51 133.5 52 127.0 53 117.0 54 112.0 55 109.0 56 99.5 57 87.5 58 97.0 59 108.5 60 100.5 61 92.0 62 93.5 63 86.0 64 76.0 65 79.5 66 84.0 67 83.0 68 77.5 69 71.5 70 65.0 71 57.0 72 54.5 73 54.5 74 43.0 75 28.0 76 22.5 77 22.5 78 21.0 79 16.5 80 12.0 81 5.0 82 5.0 83 6.0 84 2.0 85 0.0 86 1.5 87 2.5 88 2.0 89 1.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.35 2 0.8 3 0.4 4 1.15 5 1.15 6 1.15 7 1.3 8 1.425 9 1.425 10-14 1.115 15-19 1.015 20-24 0.9650000000000001 25-29 0.61 30-34 1.01 35-39 0.46499999999999997 40-44 0.745 45-49 0.8500000000000001 50-54 0.47000000000000003 55-59 1.3050000000000002 60-64 0.845 65-69 1.06 70-74 1.455 75-79 0.7000000000000001 80-84 1.24 85-89 1.02 90-94 1.155 95-99 1.18 100-104 1.2449999999999999 105-109 1.1900000000000002 110-114 1.135 115-119 1.23 120-124 1.365 125-129 1.0999999999999999 130-134 1.1199999999999999 135-139 1.045 140-144 0.58 145-149 0.86 150 0.35000000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 97.7914740626605 95.19999999999999 2 2.054442732408834 4.0 3 0.07704160246533129 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.05136106831022085 0.35000000000000003 8 0.0 0.0 9 0.025680534155110426 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 9 0.22499999999999998 Illumina Single End PCR Primer 1 (100% over 50bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNN 7 0.17500000000000002 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.425 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.6 0.0 0.0 0.0 0.0 108-109 0.775 0.0 0.0 0.0 0.0 110-111 0.9375 0.0 0.0 0.0 0.0 112-113 1.125 0.0 0.0 0.0 0.0 114-115 1.225 0.0 0.0 0.0 0.0 116-117 1.3375 0.0 0.0 0.0 0.0 118-119 1.55 0.0 0.0 0.0 0.0 120-121 1.6875 0.0 0.0 0.0 0.0 122-123 2.025 0.0 0.0 0.0 0.0 124-125 2.3375 0.0 0.0 0.0 0.0 126-127 2.6625 0.0 0.0 0.0 0.0 128-129 3.0125 0.0 0.0 0.0 0.0 130-131 3.2625 0.0 0.0 0.0 0.0 132-133 3.75 0.0 0.0 0.0 0.0 134-135 4.0375 0.0 0.0 0.0 0.0 136-137 4.375 0.0 0.0 0.0 0.0 138 4.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCAAGA 10 0.0068830964 144.60759 1 >>END_MODULE Read 1647376 spots for SRR5831621.sra Written 1647376 spots for SRR5831621.sra Read 1647376 spots for SRR5831621.sra Written 1647376 spots for SRR5831621.sra Read 1647376 spots for SRR5831621.sra Written 1647376 spots for SRR5831621.sra Read 1647376 spots for SRR5831621.sra Written 1647376 spots for SRR5831621.sra Read 1647376 spots for SRR5831621.sra Written 1647376 spots for SRR5831621.sra Read 1647380 spots for SRR5831621.sra Written 1647380 spots for SRR5831621.sra Read 1647376 spots for SRR5831621.sra Written 1647376 spots for SRR5831621.sra Read 1647376 spots for SRR5831621.sra Written 1647376 spots for SRR5831621.sra Read 1647376 spots for SRR5831621.sra Written 1647376 spots for SRR5831621.sra Read 1647376 spots for SRR5831621.sra Written 1647376 spots for SRR5831621.sra Read 1647376 spots for SRR5831621.sra Written 1647376 spots for SRR5831621.sra Read 1647376 spots for SRR5831621.sra Written 1647376 spots for SRR5831621.sra Read 1647376 spots for SRR5831621.sra Written 1647376 spots for SRR5831621.sra Read 1647376 spots for SRR5831621.sra Written 1647376 spots for SRR5831621.sra Read 1647376 spots for SRR5831621.sra Written 1647376 spots for SRR5831621.sra Read 1647376 spots for SRR5831621.sra Written 1647376 spots for SRR5831621.sra Read 1647376 spots for SRR5831621.sra Written 1647376 spots for SRR5831621.sra Read 1647376 spots for SRR5831621.sra Written 1647376 spots for SRR5831621.sra Read 1647376 spots for SRR5831621.sra Written 1647376 spots for SRR5831621.sra Read 1647376 spots for SRR5831621.sra Written 1647376 spots for SRR5831621.sra SRR ids: ['SRR5831621.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fgtrf1ie SRR5831621.sra spots: 32947524 blocks: [[1, 1647376], [1647377, 3294752], [3294753, 4942128], [4942129, 6589504], [6589505, 8236880], [8236881, 9884256], [9884257, 11531632], [11531633, 13179008], [13179009, 14826384], [14826385, 16473760], [16473761, 18121136], [18121137, 19768512], [19768513, 21415888], [21415889, 23063264], [23063265, 24710640], [24710641, 26358016], [26358017, 28005392], [28005393, 29652768], [29652769, 31300144], [31300145, 32947524]] SRR5831621 file size 11078783 SRR5831621 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5831621 SRR5831621_1.fastq SRR5831621_2.fastq Input file: SRR5831621_1.fastq Paired file: SRR5831621_2.fastq trimmed: SRR5831621-trimmed-pair1.fastq, SRR5831621-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 01:27:33 2024 >> started Sat Dec 7 01:28:09 2024 >> done (35.907s) 32947524 read pairs processed; of these: 1964 ( 0.01%) short read pairs filtered out after trimming by size control 66783 ( 0.20%) empty read pairs filtered out after trimming by size control 32878777 (99.79%) read pairs available; of these: 6777456 (20.61%) trimmed read pairs available after processing 26101321 (79.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 112 0.00% 19 77 0.00% 20 94 0.00% 21 103 0.00% 22 83 0.00% 23 91 0.00% 24 109 0.00% 25 98 0.00% 26 94 0.00% 27 111 0.00% 28 123 0.00% 29 109 0.00% 30 142 0.00% 31 133 0.00% 32 129 0.00% 33 152 0.00% 34 145 0.00% 35 158 0.00% 36 134 0.00% 37 138 0.00% 38 147 0.00% 39 179 0.00% 40 157 0.00% 41 168 0.00% 42 189 0.00% 43 173 0.00% 44 182 0.00% 45 199 0.00% 46 207 0.00% 47 197 0.00% 48 193 0.00% 49 201 0.00% 50 205 0.00% 51 214 0.00% 52 211 0.00% 53 258 0.00% 54 227 0.00% 55 262 0.00% 56 278 0.00% 57 258 0.00% 58 272 0.00% 59 295 0.00% 60 316 0.00% 61 336 0.00% 62 379 0.00% 63 386 0.00% 64 406 0.00% 65 432 0.00% 66 447 0.00% 67 513 0.00% 68 502 0.00% 69 574 0.00% 70 566 0.00% 71 641 0.00% 72 671 0.00% 73 720 0.00% 74 816 0.00% 75 905 0.00% 76 940 0.00% 77 1106 0.00% 78 1118 0.00% 79 1248 0.00% 80 1300 0.00% 81 1484 0.00% 82 1598 0.00% 83 1766 0.01% 84 1943 0.01% 85 2238 0.01% 86 2528 0.01% 87 2815 0.01% 88 2991 0.01% 89 3279 0.01% 90 3500 0.01% 91 3779 0.01% 92 4156 0.01% 93 4609 0.01% 94 5160 0.02% 95 5766 0.02% 96 6441 0.02% 97 7125 0.02% 98 7665 0.02% 99 8337 0.03% 100 8822 0.03% 101 9718 0.03% 102 10607 0.03% 103 11387 0.03% 104 12547 0.04% 105 13873 0.04% 106 15175 0.05% 107 16542 0.05% 108 17964 0.05% 109 19625 0.06% 110 20773 0.06% 111 22353 0.07% 112 23965 0.07% 113 25431 0.08% 114 27275 0.08% 115 29983 0.09% 116 31959 0.10% 117 34664 0.11% 118 36958 0.11% 119 39611 0.12% 120 41816 0.13% 121 44366 0.13% 122 46831 0.14% 123 49082 0.15% 124 51456 0.16% 125 54320 0.17% 126 57506 0.17% 127 61512 0.19% 128 64809 0.20% 129 68200 0.21% 130 71614 0.22% 131 75175 0.23% 132 77972 0.24% 133 81026 0.25% 134 84887 0.26% 135 87021 0.26% 136 90930 0.28% 137 95242 0.29% 138 98642 0.30% 139 104263 0.32% 140 108477 0.33% 141 112239 0.34% 142 117951 0.36% 143 121770 0.37% 144 122754 0.37% 145 131564 0.40% 146 151750 0.46% 147 233748 0.71% 148 620389 1.89% 149 3122403 9.50% 150 26101321 79.39% 32878777 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=60.59 fanout-score-rank=3 prefix-density=0.92 prefix-fanout=12.8 sequence=GGCGGCGGCGGCCTCG criterion=fanout-score sequence-density=0.13 sequence-density-rank=11 fanout-score=282.73 fanout-score-rank=1 prefix-density=1.10 prefix-fanout=33.5 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=3.15 fanout-score-rank=32 prefix-density=0.17 prefix-fanout=2.8 sequence=GTCCGCATCATCGGCTTCGACAACACCCGGCAGGTGCAGTGCATCAGCTTCATCGCCTTCAAGCC criterion=fanout-score sequence-density=0.07 sequence-density-rank=24 fanout-score=284.52 fanout-score-rank=1 prefix-density=0.73 prefix-fanout=29.0 sequence=CGGCGGCGGCGCC SRR5831621 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 01:29:01 Started mapping on | Dec 07 01:29:01 Finished on | Dec 07 01:39:16 Mapping speed, Million of reads per hour | 192.46 Number of input reads | 32878777 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 27751943 Uniquely mapped reads % | 84.41% Average mapped length | 279.59 Number of splices: Total | 23934249 Number of splices: Annotated (sjdb) | 22671794 Number of splices: GT/AG | 23626534 Number of splices: GC/AG | 255512 Number of splices: AT/AC | 14574 Number of splices: Non-canonical | 37629 Mismatch rate per base, % | 2.13% Deletion rate per base | 0.01% Deletion average length | 2.09 Insertion rate per base | 0.01% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 531424 % of reads mapped to multiple loci | 1.62% Number of reads mapped to too many loci | 4606 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.48% % of reads unmapped: other | 0.48% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4595526 4595526 4595526 N_multimapping 531424 531424 531424 N_noFeature 539420 26696141 1116636 N_ambiguous 590688 4131 116457 UnstrandedReadsAssigned:26621835 PositiveStrandReadsAssigned:1051671 NegativeStrandReadsAssigned:26518850 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR5831621 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5831621-trimmed-pair1.fastq SRR5831621-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,878,777 reads, 30,467,188 reads pseudoaligned [quant] estimated average fragment length: 209.89 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,215 rounds 52973 SRR5831621.ke.tsv 35125 SRR5831621.se.tsv 88098 total ==> SRR5831621.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 727.512 0 0 PNS24247 1044 835.11 34.8088 1.54848 PNS24249 1928 1719.11 157.674 3.40736 PNS24246 1044 835.11 34.8088 1.54848 PNS24248 1044 835.11 34.8088 1.54848 PNS24244 1471 1262.11 62.8992 1.85144 PNS24243 293 94.39 1 0.393582 KQK14069 1603 1394.11 22716.8 605.356 KQK14071 474 267.726 1987.38 275.772 ==> SRR5831621.se.tsv <== BRADI_1g14170v3 21459 BRADI_1g53295v3 48 BRADI_1g59795v3 179 BRADI_1g07683v3 0 BRADI_1g00485v3 22 BRADI_1g20270v3 1390 BRADI_1g74790v3 1902 BRADI_1g09890v3 0 BRADI_1g77505v3 623 BRADI_1g48960v3 0 SRR5831621 completed mapping pipeline successfully