Starting /dee2/code/volunteer_pipeline.sh SRR5831622 current disk space = 1548269178880 free memory = 1597439164 SRR5831622 SRAfilesize 673fbd00a2c452ea078dda2421f75c40 SRR5831622.sra SRR5831622.sra file validated SRR5831622 is paired end SRR5831622 is conventional basespace SRR5831622 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5831622_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.90825 32.0 32.0 32.0 27.0 32.0 2 31.52925 32.0 32.0 32.0 32.0 32.0 3 35.88825 37.0 37.0 37.0 32.0 37.0 4 34.0535 37.0 32.0 37.0 27.0 37.0 5 35.49725 37.0 37.0 37.0 32.0 37.0 6 39.18925 42.0 37.0 42.0 32.0 42.0 7 38.38075 42.0 37.0 42.0 32.0 42.0 8 39.54075 42.0 37.0 42.0 32.0 42.0 9 39.77175 42.0 37.0 42.0 37.0 42.0 10-14 39.30795 42.0 37.0 42.0 33.0 42.0 15-19 37.28845 39.0 34.0 42.0 29.0 42.0 20-24 36.446000000000005 39.0 35.0 42.0 25.8 42.0 25-29 37.65215 42.0 37.0 42.0 30.0 42.0 30-34 35.33905 39.0 31.0 42.0 19.6 42.0 35-39 37.1528 40.0 35.0 42.0 28.0 42.0 40-44 35.93265 40.0 33.0 42.0 24.8 42.0 45-49 35.58495 39.0 32.0 42.0 19.8 42.0 50-54 34.34065 38.0 31.0 42.0 17.4 42.0 55-59 33.67505 37.0 30.0 42.0 15.4 42.0 60-64 35.563300000000005 38.0 33.0 42.0 21.8 42.0 65-69 36.07135 40.0 35.0 42.0 23.8 42.0 70-74 32.395450000000004 36.0 25.8 41.0 11.0 42.0 75-79 31.862150000000003 35.0 27.0 40.0 13.2 42.0 80-84 34.9258 37.0 32.0 42.0 18.6 42.0 85-89 35.02775 37.0 32.0 42.0 18.6 42.0 90-94 35.622949999999996 37.0 32.0 42.0 22.0 42.0 95-99 33.375 37.0 30.0 42.0 15.4 42.0 100-104 34.05480000000001 37.0 31.0 42.0 17.6 42.0 105-109 32.5195 37.0 27.0 42.0 11.0 42.0 110-114 32.56405 37.0 27.0 42.0 11.0 42.0 115-119 32.36945 37.0 28.0 42.0 13.2 42.0 120-124 33.36825 37.0 30.0 42.0 15.4 42.0 125-129 29.734500000000004 32.0 22.0 40.0 11.0 42.0 130-134 30.54135 34.0 24.0 39.0 11.0 42.0 135-139 30.64595 35.0 21.8 41.0 11.0 42.0 140-144 29.1695 32.0 20.8 37.0 11.0 42.0 145-149 27.399099999999997 31.0 15.4 37.0 11.0 42.0 150 30.44325 32.0 27.0 37.0 11.0 42.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 2.0 19 1.0 20 6.0 21 6.0 22 24.0 23 17.0 24 26.0 25 57.0 26 70.0 27 101.0 28 113.0 29 175.0 30 242.0 31 255.0 32 278.0 33 385.0 34 427.0 35 425.0 36 407.0 37 399.0 38 315.0 39 187.0 40 76.0 41 5.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.775 10.4 12.174999999999999 44.65 2 27.474999999999998 11.1 31.75 29.675 3 24.725 15.425 22.225 37.625 4 31.1 19.975 18.625 30.3 5 29.65 23.724999999999998 21.55 25.074999999999996 6 24.3 29.225 22.675 23.799999999999997 7 20.45 26.375 32.6 20.575 8 19.85 23.825 30.225 26.1 9 20.849999999999998 20.599999999999998 31.15 27.400000000000002 10-14 24.29 24.865000000000002 24.805 26.040000000000003 15-19 24.435000000000002 24.205 24.87 26.490000000000002 20-24 24.585 25.045 23.405 26.965 25-29 24.75227704934441 24.271844660194176 24.091682514262835 26.884195776198577 30-34 24.535 24.94 23.68 26.845000000000002 35-39 24.63 23.880000000000003 24.465 27.025 40-44 24.965 25.014999999999997 23.13 26.889999999999997 45-49 24.961201501877348 23.969962453066334 23.74468085106383 27.32415519399249 50-54 24.775 24.52 23.365 27.339999999999996 55-59 25.0 24.664395912642757 23.337006611901423 26.99859747545582 60-64 24.67 23.695 23.575 28.060000000000002 65-69 25.21142971525797 23.414902667267175 23.50998348596307 27.863684131511786 70-74 25.07628432794758 24.64108848982042 22.655194837676955 27.627432344555046 75-79 25.419999999999998 23.775 23.185 27.62 80-84 25.185000000000002 23.79 23.31 27.715 85-89 25.674999999999997 23.755000000000003 22.96 27.61 90-94 25.869999999999997 23.48 23.465 27.185 95-99 25.39 23.035 23.305 28.27 100-104 25.869999999999997 22.745 22.855 28.53 105-109 25.569999999999997 23.685000000000002 22.755 27.99 110-114 25.779999999999998 23.39 22.67 28.16 115-119 25.569999999999997 23.16 22.925 28.345 120-124 25.635 22.965 23.075000000000003 28.325 125-129 25.705 24.12 22.17 28.005000000000003 130-134 26.040000000000003 23.74 21.85 28.37 135-139 26.056937009055886 23.58032721268825 21.719117426327113 28.64361835192875 140-144 25.915 24.104999999999997 21.825 28.155 145-149 25.278083976350334 24.626716103818016 21.645455456458564 28.449744463373083 150 25.624999999999996 22.975 22.225 29.175 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 1.5 12 1.5 13 0.5 14 0.5 15 1.0 16 1.5 17 1.5 18 1.0 19 1.0 20 2.5 21 3.0 22 1.5 23 1.5 24 1.0 25 1.0 26 1.5 27 1.0 28 3.0 29 3.0 30 3.5 31 6.5 32 8.5 33 15.5 34 20.0 35 22.5 36 31.5 37 42.0 38 59.0 39 80.5 40 97.0 41 110.5 42 126.0 43 138.0 44 142.5 45 160.0 46 160.0 47 156.0 48 165.0 49 145.5 50 130.5 51 147.0 52 144.5 53 125.0 54 123.5 55 112.5 56 106.0 57 100.5 58 93.5 59 90.0 60 84.0 61 84.5 62 79.5 63 78.0 64 78.5 65 79.5 66 74.5 67 71.5 68 65.5 69 55.0 70 52.0 71 50.5 72 51.0 73 44.0 74 32.5 75 25.0 76 27.0 77 24.0 78 17.5 79 10.0 80 4.5 81 4.0 82 2.5 83 5.0 84 4.5 85 1.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.09 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.125 50-54 0.0 55-59 0.18 60-64 0.0 65-69 0.08499999999999999 70-74 0.045 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.065 140-144 0.0 145-149 0.21 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.875 #Duplication Level Percentage of deduplicated Percentage of total 1 96.87741935483871 93.85 2 3.0193548387096776 5.8500000000000005 3 0.1032258064516129 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.32499999999999996 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.48750000000000004 0.0 0.0 0.0 0.0 102-103 0.65 0.0 0.0 0.0 0.0 104-105 0.6875 0.0 0.0 0.0 0.0 106-107 0.8625 0.0 0.0 0.0 0.0 108-109 1.0125 0.0 0.0 0.0 0.0 110-111 1.0499999999999998 0.0 0.0 0.0 0.0 112-113 1.2125 0.0 0.0 0.0 0.0 114-115 1.525 0.0 0.0 0.0 0.0 116-117 1.775 0.0 0.0 0.0 0.0 118-119 2.0 0.0 0.0 0.0 0.0 120-121 2.3875 0.0 0.0 0.0 0.0 122-123 2.7249999999999996 0.0 0.0 0.0 0.0 124-125 2.925 0.0 0.0 0.0 0.0 126-127 3.2125000000000004 0.0 0.0 0.0 0.0 128-129 3.7125000000000004 0.0 0.0 0.0 0.0 130-131 4.075 0.0 0.0 0.0 0.0 132-133 4.475 0.0 0.0 0.0 0.0 134-135 5.125 0.0 0.0 0.0 0.0 136-137 5.574999999999999 0.0 0.0 0.0 0.0 138 5.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5831622 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5831622_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 54 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.68825 32.0 32.0 32.0 27.0 32.0 2 30.311 32.0 32.0 32.0 27.0 32.0 3 34.007 37.0 32.0 37.0 27.0 37.0 4 34.22075 37.0 32.0 37.0 27.0 37.0 5 34.1145 37.0 37.0 37.0 27.0 37.0 6 36.40275 37.0 37.0 42.0 27.0 42.0 7 33.422 37.0 32.0 42.0 11.0 42.0 8 35.28375 37.0 32.0 42.0 27.0 42.0 9 34.94325 37.0 32.0 42.0 27.0 42.0 10-14 36.236000000000004 38.0 35.0 42.0 26.0 42.0 15-19 34.793350000000004 37.0 32.0 42.0 20.8 42.0 20-24 34.97115 37.0 33.0 42.0 23.0 42.0 25-29 35.3636 38.0 32.0 42.0 21.8 42.0 30-34 35.392700000000005 37.0 32.0 42.0 22.0 42.0 35-39 33.872 37.0 31.0 42.0 19.8 42.0 40-44 33.878600000000006 37.0 31.0 42.0 15.4 42.0 45-49 32.829100000000004 37.0 29.0 42.0 13.2 42.0 50-54 33.023 37.0 29.0 42.0 11.0 42.0 55-59 31.388099999999998 36.0 27.0 40.0 13.2 42.0 60-64 29.3719 32.0 20.8 38.0 11.0 42.0 65-69 29.834200000000003 34.0 24.0 38.0 11.0 42.0 70-74 28.127850000000002 32.0 17.6 37.0 11.0 42.0 75-79 28.40935 32.0 23.0 36.0 11.0 41.0 80-84 28.5757 32.0 19.8 37.0 11.0 42.0 85-89 28.599200000000003 32.0 19.8 37.0 11.0 42.0 90-94 29.4238 32.0 22.0 37.0 11.0 42.0 95-99 28.25015 32.0 22.0 37.0 11.0 42.0 100-104 26.8276 30.0 17.6 36.0 11.0 41.0 105-109 25.07925 27.0 11.0 32.0 11.0 37.0 110-114 23.78645 27.0 11.0 32.0 11.0 37.0 115-119 24.0475 26.0 11.0 32.0 11.0 37.0 120-124 25.101999999999997 27.0 11.0 32.0 11.0 37.0 125-129 25.65715 27.0 13.2 32.0 11.0 38.0 130-134 25.13185 27.0 11.0 32.0 11.0 38.0 135-139 25.08725 27.0 11.0 32.0 11.0 37.0 140-144 23.3116 25.0 11.0 32.0 11.0 37.0 145-149 23.022749999999995 25.0 11.0 32.0 11.0 37.0 150 21.70125 22.0 11.0 32.0 11.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 0.0 4 1.0 5 8.0 6 3.0 7 3.0 8 0.0 9 1.0 10 2.0 11 4.0 12 2.0 13 5.0 14 7.0 15 5.0 16 8.0 17 9.0 18 21.0 19 29.0 20 41.0 21 76.0 22 99.0 23 130.0 24 158.0 25 228.0 26 257.0 27 265.0 28 320.0 29 334.0 30 367.0 31 359.0 32 326.0 33 247.0 34 217.0 35 163.0 36 122.0 37 93.0 38 45.0 39 22.0 40 14.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.761723700887202 16.628643852978453 11.609632446134349 40.0 2 28.621730382293762 24.949698189134807 26.10663983903421 20.321931589537222 3 26.835379604109242 28.313705838135807 20.095214232022048 24.7557003257329 4 30.55134041476985 27.845220030349015 17.627718765806776 23.975720789074355 5 31.91704602933738 31.41122913505311 16.46433990895296 20.207384926656548 6 22.71117855336368 36.19119878603945 19.853313100657562 21.2443095599393 7 25.0886974151039 20.628484541307653 31.04409528636594 23.238722757222504 8 24.669715447154474 23.04369918699187 24.1869918699187 28.09959349593496 9 24.288617886178862 21.570121951219512 27.10873983739837 27.03252032520325 10-14 27.544516390125455 24.914002428166736 21.878794010522057 25.662687171185755 15-19 27.078600636074512 24.726134585289515 22.54025947801504 25.65500530062093 20-24 27.1497779572063 24.64170367379895 22.320347194186514 25.88817117480823 25-29 27.9172524603334 23.38320947981522 22.323759791122715 26.375778268728663 30-34 27.01352442470731 24.72749293500202 22.537343560758984 25.721639079531695 35-39 27.523441809156097 24.188938474652762 22.00270771699343 26.284911999197714 40-44 27.28050745066452 24.179420056383407 22.25130890052356 26.288763592428516 45-49 27.62442071327826 23.801128349788435 22.778561354019747 25.79588958291356 50-54 28.00902708124373 23.706118355065193 22.63791374122367 25.6469408224674 55-59 28.331643002028393 23.77789046653144 22.053752535496958 25.836713995943207 60-64 28.480757606286524 24.76324803546242 21.942373564376386 24.813620793874673 65-69 28.616892301475044 24.110931501313395 22.130733481511417 25.14144271570014 70-74 28.739256471545545 24.355388292732545 21.35482886639882 25.550526369323094 75-79 28.09688929091914 24.096688275792754 21.98100407055631 25.825418362731796 80-84 28.14589665653495 23.986828774062815 21.980749746707193 25.886524822695034 85-89 28.27721972641462 23.71409822825703 22.078643178032404 25.930038867295945 90-94 27.52618529575469 23.2100389616961 23.417497343520722 25.84627839902849 95-99 28.327092399554697 23.241574739398846 22.356036838376685 26.075296022669768 100-104 29.105839416058394 23.39821573398216 21.811638280616382 25.684306569343068 105-109 28.10791658230411 22.980360396841466 22.499493824660863 26.41222919619356 110-114 28.854614412136538 23.25158027812895 21.881163084702905 26.012642225031605 115-119 28.873132438592048 23.347682957710813 22.06634591035705 25.712838693340085 120-124 28.828097244074506 22.47881033345176 22.727503425874232 25.965588996599504 125-129 28.523761375126387 23.417593528816987 21.53690596562184 26.521739130434785 130-134 29.24819252742808 22.68567672784266 22.12447545376409 25.941655290965166 135-139 29.654893638522562 23.21257137082512 21.767470062149464 25.365064928502857 140-144 30.049211609922665 23.857587626795222 21.115797931103746 24.977402832178367 145-149 30.50335063233738 23.20249911825465 21.212273895299038 25.081876354108935 150 30.268103232272615 26.609872212478074 19.368579303432725 23.753445251816586 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 8.0 1 5.0 2 1.0 3 0.0 4 0.0 5 0.5 6 0.5 7 1.0 8 3.0 9 2.0 10 1.0 11 3.0 12 4.0 13 4.0 14 2.0 15 1.0 16 2.5 17 1.5 18 2.0 19 3.0 20 2.5 21 3.5 22 3.0 23 2.5 24 3.0 25 2.0 26 1.5 27 2.0 28 2.0 29 3.0 30 3.0 31 3.0 32 5.5 33 10.0 34 19.0 35 23.0 36 24.5 37 41.0 38 50.0 39 60.0 40 82.5 41 93.5 42 112.0 43 123.5 44 127.0 45 141.0 46 144.0 47 149.5 48 151.0 49 148.0 50 149.0 51 144.0 52 133.5 53 125.5 54 123.0 55 115.5 56 108.0 57 99.5 58 98.0 59 100.0 60 90.0 61 92.5 62 92.0 63 84.0 64 74.0 65 80.5 66 91.0 67 76.0 68 74.0 69 71.5 70 68.0 71 58.0 72 47.0 73 50.0 74 42.5 75 28.5 76 25.5 77 19.0 78 11.5 79 13.0 80 10.0 81 8.5 82 8.0 83 5.0 84 3.0 85 1.0 86 1.0 87 1.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.375 2 0.6 3 0.22499999999999998 4 1.15 5 1.15 6 1.15 7 1.35 8 1.6 9 1.6 10-14 1.16 15-19 0.955 20-24 0.9199999999999999 25-29 0.42 30-34 0.9199999999999999 35-39 0.28500000000000003 40-44 0.6799999999999999 45-49 0.74 50-54 0.3 55-59 1.4000000000000001 60-64 0.74 65-69 1.02 70-74 1.685 75-79 0.505 80-84 1.3 85-89 0.9450000000000001 90-94 1.185 95-99 1.1900000000000002 100-104 1.3599999999999999 105-109 1.22 110-114 1.125 115-119 1.275 120-124 1.485 125-129 1.0999999999999999 130-134 1.105 135-139 1.045 140-144 0.43 145-149 0.765 150 0.22499999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.625 #Duplication Level Percentage of deduplicated Percentage of total 1 96.89521345407503 93.625 2 2.949547218628719 5.7 3 0.07761966364812418 0.22499999999999998 4 0.0258732212160414 0.1 5 0.0 0.0 6 0.0258732212160414 0.15 7 0.0 0.0 8 0.0258732212160414 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 8 0.2 Illumina Single End PCR Primer 1 (100% over 50bp) NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.32499999999999996 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.525 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.7375 0.0 0.0 0.0 0.0 108-109 0.8875 0.0 0.0 0.0 0.0 110-111 0.925 0.0 0.0 0.0 0.0 112-113 1.05 0.0 0.0 0.0 0.0 114-115 1.275 0.0 0.0 0.0 0.0 116-117 1.5125 0.0 0.0 0.0 0.0 118-119 1.75 0.0 0.0 0.0 0.0 120-121 2.0875 0.0 0.0 0.0 0.0 122-123 2.4125 0.0 0.0 0.0 0.0 124-125 2.625 0.0 0.0 0.0 0.0 126-127 2.9375 0.0 0.0 0.0 0.0 128-129 3.425 0.0 0.0 0.0 0.0 130-131 3.625 0.0 0.0 0.0 0.0 132-133 4.0375 0.0 0.0 0.0 0.0 134-135 4.6875 0.0 0.0 0.0 0.0 136-137 5.1625 0.0 0.0 0.0 0.0 138 5.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACTGAT 10 0.0068758954 144.65823 3 GAACTGA 10 0.0068758954 144.65823 2 GGAACTG 10 0.00714285 142.84999 1 >>END_MODULE Read 1632395 spots for SRR5831622.sra Written 1632395 spots for SRR5831622.sra Read 1632395 spots for SRR5831622.sra Written 1632395 spots for SRR5831622.sra Read 1632395 spots for SRR5831622.sra Written 1632395 spots for SRR5831622.sra Read 1632395 spots for SRR5831622.sra Written 1632395 spots for SRR5831622.sra Read 1632395 spots for SRR5831622.sra Written 1632395 spots for SRR5831622.sra Read 1632402 spots for SRR5831622.sra Written 1632402 spots for SRR5831622.sra Read 1632395 spots for SRR5831622.sra Written 1632395 spots for SRR5831622.sra Read 1632395 spots for SRR5831622.sra Written 1632395 spots for SRR5831622.sra Read 1632395 spots for SRR5831622.sra Written 1632395 spots for SRR5831622.sra Read 1632395 spots for SRR5831622.sra Written 1632395 spots for SRR5831622.sra Read 1632395 spots for SRR5831622.sra Written 1632395 spots for SRR5831622.sra Read 1632395 spots for SRR5831622.sra Written 1632395 spots for SRR5831622.sra Read 1632395 spots for SRR5831622.sra Written 1632395 spots for SRR5831622.sra Read 1632395 spots for SRR5831622.sra Written 1632395 spots for SRR5831622.sra Read 1632395 spots for SRR5831622.sra Written 1632395 spots for SRR5831622.sra Read 1632395 spots for SRR5831622.sra Written 1632395 spots for SRR5831622.sra Read 1632395 spots for SRR5831622.sra Written 1632395 spots for SRR5831622.sra Read 1632395 spots for SRR5831622.sra Written 1632395 spots for SRR5831622.sra Read 1632395 spots for SRR5831622.sra Written 1632395 spots for SRR5831622.sra Read 1632395 spots for SRR5831622.sra Written 1632395 spots for SRR5831622.sra SRR ids: ['SRR5831622.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pzgomr6b SRR5831622.sra spots: 32647907 blocks: [[1, 1632395], [1632396, 3264790], [3264791, 4897185], [4897186, 6529580], [6529581, 8161975], [8161976, 9794370], [9794371, 11426765], [11426766, 13059160], [13059161, 14691555], [14691556, 16323950], [16323951, 17956345], [17956346, 19588740], [19588741, 21221135], [21221136, 22853530], [22853531, 24485925], [24485926, 26118320], [26118321, 27750715], [27750716, 29383110], [29383111, 31015505], [31015506, 32647907]] SRR5831622 file size 10977838 SRR5831622 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5831622 SRR5831622_1.fastq SRR5831622_2.fastq Input file: SRR5831622_1.fastq Paired file: SRR5831622_2.fastq trimmed: SRR5831622-trimmed-pair1.fastq, SRR5831622-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 01:26:15 2024 >> started Sat Dec 7 01:26:56 2024 >> done (40.406s) 32647907 read pairs processed; of these: 2704 ( 0.01%) short read pairs filtered out after trimming by size control 101402 ( 0.31%) empty read pairs filtered out after trimming by size control 32543801 (99.68%) read pairs available; of these: 7206951 (22.15%) trimmed read pairs available after processing 25336850 (77.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 177 0.00% 19 140 0.00% 20 161 0.00% 21 148 0.00% 22 194 0.00% 23 137 0.00% 24 185 0.00% 25 169 0.00% 26 183 0.00% 27 152 0.00% 28 166 0.00% 29 191 0.00% 30 193 0.00% 31 186 0.00% 32 211 0.00% 33 180 0.00% 34 179 0.00% 35 204 0.00% 36 218 0.00% 37 179 0.00% 38 251 0.00% 39 205 0.00% 40 256 0.00% 41 215 0.00% 42 234 0.00% 43 257 0.00% 44 246 0.00% 45 250 0.00% 46 213 0.00% 47 291 0.00% 48 288 0.00% 49 266 0.00% 50 279 0.00% 51 335 0.00% 52 311 0.00% 53 395 0.00% 54 341 0.00% 55 360 0.00% 56 342 0.00% 57 370 0.00% 58 379 0.00% 59 409 0.00% 60 417 0.00% 61 476 0.00% 62 554 0.00% 63 547 0.00% 64 575 0.00% 65 670 0.00% 66 650 0.00% 67 713 0.00% 68 766 0.00% 69 756 0.00% 70 796 0.00% 71 846 0.00% 72 920 0.00% 73 1158 0.00% 74 1132 0.00% 75 1284 0.00% 76 1409 0.00% 77 1492 0.00% 78 1629 0.01% 79 1860 0.01% 80 1878 0.01% 81 2031 0.01% 82 2250 0.01% 83 2498 0.01% 84 2708 0.01% 85 3228 0.01% 86 3575 0.01% 87 3775 0.01% 88 4217 0.01% 89 4471 0.01% 90 4909 0.02% 91 5446 0.02% 92 5866 0.02% 93 6249 0.02% 94 7025 0.02% 95 7818 0.02% 96 8890 0.03% 97 9383 0.03% 98 10570 0.03% 99 11618 0.04% 100 12360 0.04% 101 13002 0.04% 102 13952 0.04% 103 15084 0.05% 104 16963 0.05% 105 18121 0.06% 106 19886 0.06% 107 22018 0.07% 108 23236 0.07% 109 25166 0.08% 110 27081 0.08% 111 28461 0.09% 112 30354 0.09% 113 32515 0.10% 114 34473 0.11% 115 37040 0.11% 116 41271 0.13% 117 45121 0.14% 118 46976 0.14% 119 50318 0.15% 120 52734 0.16% 121 55761 0.17% 122 58239 0.18% 123 62787 0.19% 124 67131 0.21% 125 67924 0.21% 126 71756 0.22% 127 75563 0.23% 128 81552 0.25% 129 85611 0.26% 130 92837 0.29% 131 99377 0.31% 132 101912 0.31% 133 105408 0.32% 134 107961 0.33% 135 108668 0.33% 136 113312 0.35% 137 119728 0.37% 138 125795 0.39% 139 129638 0.40% 140 132267 0.41% 141 136655 0.42% 142 136947 0.42% 143 142899 0.44% 144 146710 0.45% 145 153852 0.47% 146 169059 0.52% 147 240717 0.74% 148 582121 1.79% 149 2891531 8.89% 150 25336850 77.85% 32543801 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.67 fanout-score-rank=31 prefix-density=0.24 prefix-fanout=2.4 sequence=TTTCCTCTGGCT criterion=fanout-score sequence-density=0.12 sequence-density-rank=11 fanout-score=272.23 fanout-score-rank=1 prefix-density=1.03 prefix-fanout=32.9 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.84 fanout-score-rank=33 prefix-density=0.15 prefix-fanout=2.6 sequence=GTCCGCATCATCGGCTTCGACAACACCCGGCAGGTGCAGTGCATCAGCTTCATCGCCTTCAAGCC criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=282.86 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=29.5 sequence=CGGCGGCGGCGCC SRR5831622 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 01:27:48 Started mapping on | Dec 07 01:27:48 Finished on | Dec 07 01:38:18 Mapping speed, Million of reads per hour | 185.96 Number of input reads | 32543801 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 26481992 Uniquely mapped reads % | 81.37% Average mapped length | 280.51 Number of splices: Total | 23099575 Number of splices: Annotated (sjdb) | 21867688 Number of splices: GT/AG | 22801047 Number of splices: GC/AG | 247717 Number of splices: AT/AC | 14396 Number of splices: Non-canonical | 36415 Mismatch rate per base, % | 2.00% Deletion rate per base | 0.01% Deletion average length | 2.06 Insertion rate per base | 0.01% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 593539 % of reads mapped to multiple loci | 1.82% Number of reads mapped to too many loci | 105621 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.67% % of reads unmapped: other | 4.81% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5468388 5468388 5468388 N_multimapping 593539 593539 593539 N_noFeature 571640 25202127 1392902 N_ambiguous 567639 5178 112364 UnstrandedReadsAssigned:25342713 PositiveStrandReadsAssigned:1274687 NegativeStrandReadsAssigned:24976726 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR5831622 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR5831622-trimmed-pair1.fastq SRR5831622-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,543,801 reads, 28,114,990 reads pseudoaligned [quant] estimated average fragment length: 206.885 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,205 rounds 52973 SRR5831622.ke.tsv 35125 SRR5831622.se.tsv 88098 total ==> SRR5831622.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 730.487 0 0 PNS24247 1044 838.115 34.3505 1.64445 PNS24249 1928 1722.12 170.085 3.96274 PNS24246 1044 838.115 34.3505 1.64445 PNS24248 1044 838.115 34.3505 1.64445 PNS24244 1471 1265.12 51.8636 1.64484 PNS24243 293 97.0073 1 0.413607 KQK14069 1603 1397.12 20649.6 593.022 KQK14071 474 270.38 1669.05 247.678 ==> SRR5831622.se.tsv <== BRADI_1g14170v3 19937 BRADI_1g53295v3 53 BRADI_1g59795v3 150 BRADI_1g07683v3 0 BRADI_1g00485v3 23 BRADI_1g20270v3 1300 BRADI_1g74790v3 1902 BRADI_1g09890v3 0 BRADI_1g77505v3 523 BRADI_1g48960v3 0 SRR5831622 completed mapping pipeline successfully