Starting /dee2/code/volunteer_pipeline.sh SRR6031155 current disk space = 1523464556544 free memory = 1402330368 SRR6031155 SRAfilesize 63da7f670da5f4ba09bbf11e86dca599 SRR6031155.sra SRR6031155.sra file validated SRR6031155 is paired end SRR6031155 is conventional basespace SRR6031155 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031155_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.44025 32.0 30.0 33.0 25.0 33.0 2 32.652 33.0 33.0 33.0 31.0 33.0 3 32.9325 33.0 33.0 34.0 33.0 34.0 4 33.36925 34.0 33.0 34.0 33.0 34.0 5 33.63925 34.0 34.0 34.0 33.0 34.0 6 37.302 38.0 38.0 38.0 37.0 38.0 7 37.71325 38.0 38.0 38.0 38.0 38.0 8 37.767 38.0 38.0 38.0 38.0 38.0 9 37.81675 38.0 38.0 38.0 38.0 38.0 10-14 37.84495 38.0 38.0 38.0 38.0 38.0 15-19 37.853049999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.8308 38.0 38.0 38.0 38.0 38.0 25-29 37.794 38.0 38.0 38.0 38.0 38.0 30-34 37.78025 38.0 38.0 38.0 38.0 38.0 35-39 37.78335 38.0 38.0 38.0 38.0 38.0 40-44 37.76505 38.0 38.0 38.0 38.0 38.0 45-49 37.7517 38.0 38.0 38.0 38.0 38.0 50-54 37.7019 38.0 38.0 38.0 38.0 38.0 55-59 37.6709 38.0 38.0 38.0 38.0 38.0 60-64 37.6794 38.0 38.0 38.0 38.0 38.0 65-69 37.65365 38.0 38.0 38.0 38.0 38.0 70-74 37.62025 38.0 38.0 38.0 38.0 38.0 75-79 37.5927 38.0 38.0 38.0 38.0 38.0 80-84 37.5698 38.0 38.0 38.0 38.0 38.0 85-89 37.50135 38.0 38.0 38.0 38.0 38.0 90-94 37.48405 38.0 38.0 38.0 37.8 38.0 95-99 37.4191 38.0 38.0 38.0 37.2 38.0 100-104 37.3771 38.0 38.0 38.0 37.0 38.0 105-109 37.3208 38.0 38.0 38.0 37.0 38.0 110-114 37.289199999999994 38.0 38.0 38.0 37.0 38.0 115-119 37.200900000000004 38.0 38.0 38.0 36.4 38.0 120-124 37.1283 38.0 38.0 38.0 36.0 38.0 125-129 36.9682 38.0 38.0 38.0 35.8 38.0 130-134 36.9562 38.0 38.0 38.0 35.4 38.0 135-139 36.901300000000006 38.0 38.0 38.0 35.2 38.0 140-144 36.63305 38.0 38.0 38.0 35.0 38.0 145-149 36.4896 38.0 38.0 38.0 34.8 38.0 150-151 34.414625 37.0 35.5 38.0 27.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 0.0 17 3.0 18 0.0 19 3.0 20 0.0 21 1.0 22 1.0 23 0.0 24 2.0 25 5.0 26 6.0 27 5.0 28 1.0 29 8.0 30 10.0 31 10.0 32 21.0 33 23.0 34 50.0 35 101.0 36 316.0 37 3431.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.37593984962406 11.253132832080201 6.842105263157896 31.528822055137844 2 21.975 11.525 35.225 31.275 3 18.15 16.225 26.224999999999998 39.4 4 23.0 21.4 23.775 31.825 5 23.45 26.75 25.900000000000002 23.9 6 24.078748107016658 29.10146390711762 24.204946996466433 22.614840989399294 7 17.65 27.224999999999998 36.25 18.875 8 18.6 26.924999999999997 30.675 23.799999999999997 9 19.0 23.5 34.275 23.225 10-14 21.365000000000002 27.3 27.544999999999998 23.79 15-19 22.03 25.835 26.995 25.14 20-24 21.9 26.25 27.22 24.63 25-29 21.15 26.05 27.755000000000003 25.045 30-34 21.695 26.245 27.13 24.93 35-39 21.709999999999997 26.86 26.855 24.575 40-44 21.305 26.88 27.05 24.765 45-49 21.805 26.8 26.640000000000004 24.755 50-54 22.11 25.94 26.419999999999998 25.53 55-59 22.040000000000003 26.215 26.645000000000003 25.1 60-64 21.105 26.445 27.1 25.35 65-69 21.884999999999998 26.515 27.02 24.58 70-74 21.545 26.6 27.065 24.79 75-79 21.91 26.334999999999997 26.634999999999998 25.119999999999997 80-84 21.515 26.169999999999998 26.8 25.515 85-89 21.93 26.32 26.474999999999998 25.275 90-94 21.75 26.27 27.015 24.965 95-99 22.009999999999998 26.16 26.87 24.959999999999997 100-104 22.14 25.624999999999996 26.69 25.545 105-109 21.58 26.529999999999998 26.91 24.98 110-114 22.055 26.424999999999997 26.68 24.84 115-119 21.47 26.06 27.435 25.035 120-124 22.145 26.295 26.150000000000002 25.41 125-129 22.13 26.015 26.5 25.355 130-134 22.37 26.13 26.68 24.82 135-139 22.395 26.105 26.400000000000002 25.1 140-144 22.1 25.195 27.515 25.19 145-149 22.259999999999998 25.814999999999998 26.965 24.959999999999997 150-151 22.237499999999997 25.112499999999997 27.4125 25.2375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.0 23 1.0 24 1.0 25 0.5 26 1.0 27 2.5 28 4.0 29 4.5 30 5.0 31 10.0 32 19.0 33 26.5 34 29.5 35 41.0 36 63.0 37 80.5 38 97.5 39 120.5 40 147.0 41 180.0 42 198.0 43 204.0 44 223.0 45 235.0 46 239.0 47 229.0 48 223.5 49 206.5 50 185.5 51 167.5 52 138.0 53 119.0 54 116.5 55 106.5 56 77.0 57 59.5 58 53.5 59 49.5 60 48.0 61 47.5 62 41.5 63 32.5 64 23.5 65 21.5 66 23.0 67 17.5 68 12.0 69 17.0 70 14.0 71 6.5 72 6.0 73 6.0 74 5.5 75 4.0 76 1.5 77 0.5 78 0.5 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.95 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.32499999999999996 0.0 0.0 0.0 0.0 118-119 0.3625 0.0 0.0 0.0 0.0 120-121 0.375 0.0 0.0 0.0 0.0 122-123 0.375 0.0 0.0 0.0 0.0 124-125 0.375 0.0 0.0 0.0 0.0 126-127 0.42500000000000004 0.0 0.0 0.0 0.0 128-129 0.4625 0.0 0.0 0.0 0.0 130-131 0.5 0.0 0.0 0.0 0.0 132-133 0.55 0.0 0.0 0.0 0.0 134-135 0.625 0.0 0.0 0.0 0.0 136-137 0.7124999999999999 0.0 0.0 0.0 0.0 138-139 0.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6031155 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031155_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.37575 34.0 33.0 34.0 33.0 34.0 2 33.433 34.0 33.0 34.0 33.0 34.0 3 33.31075 34.0 33.0 34.0 33.0 34.0 4 33.2595 34.0 33.0 34.0 33.0 34.0 5 33.28525 34.0 33.0 34.0 33.0 34.0 6 37.42425 38.0 38.0 38.0 38.0 38.0 7 37.4325 38.0 38.0 38.0 38.0 38.0 8 37.41075 38.0 38.0 38.0 38.0 38.0 9 37.451 38.0 38.0 38.0 38.0 38.0 10-14 37.36755 38.0 38.0 38.0 38.0 38.0 15-19 37.263749999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.09895 38.0 38.0 38.0 38.0 38.0 25-29 37.261750000000006 38.0 38.0 38.0 38.0 38.0 30-34 37.580600000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.59740000000001 38.0 38.0 38.0 38.0 38.0 40-44 37.58455 38.0 38.0 38.0 38.0 38.0 45-49 37.6057 38.0 38.0 38.0 38.0 38.0 50-54 37.576 38.0 38.0 38.0 38.0 38.0 55-59 37.37155 38.0 38.0 38.0 38.0 38.0 60-64 37.49935 38.0 38.0 38.0 38.0 38.0 65-69 37.454950000000004 38.0 38.0 38.0 38.0 38.0 70-74 37.266949999999994 38.0 38.0 38.0 38.0 38.0 75-79 37.43895 38.0 38.0 38.0 38.0 38.0 80-84 37.4505 38.0 38.0 38.0 38.0 38.0 85-89 37.40005 38.0 38.0 38.0 38.0 38.0 90-94 37.344750000000005 38.0 38.0 38.0 38.0 38.0 95-99 37.31135 38.0 38.0 38.0 38.0 38.0 100-104 37.26615 38.0 38.0 38.0 37.8 38.0 105-109 37.03965 38.0 38.0 38.0 37.4 38.0 110-114 36.9338 38.0 38.0 38.0 37.0 38.0 115-119 36.76975 38.0 38.0 38.0 36.0 38.0 120-124 36.82340000000001 38.0 38.0 38.0 36.0 38.0 125-129 36.9704 38.0 38.0 38.0 36.0 38.0 130-134 36.960499999999996 38.0 38.0 38.0 36.0 38.0 135-139 36.834050000000005 38.0 38.0 38.0 36.0 38.0 140-144 36.763000000000005 38.0 38.0 38.0 35.2 38.0 145-149 36.56175 38.0 38.0 38.0 35.0 38.0 150-151 34.283125 37.0 35.5 38.0 28.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 0.0 4 2.0 5 0.0 6 0.0 7 1.0 8 0.0 9 1.0 10 2.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 2.0 18 3.0 19 2.0 20 5.0 21 2.0 22 11.0 23 11.0 24 2.0 25 6.0 26 11.0 27 11.0 28 12.0 29 15.0 30 12.0 31 20.0 32 18.0 33 29.0 34 39.0 35 85.0 36 202.0 37 3487.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.95 22.975 9.6 23.474999999999998 2 27.62071553665249 29.02176632474356 24.64348261195897 18.714035526644984 3 22.688442211055275 28.542713567839193 27.63819095477387 21.13065326633166 4 27.149321266968325 30.392156862745097 21.794871794871796 20.66365007541478 5 25.935224704996234 31.559126286718552 21.466231483806176 21.03941752447904 6 23.204419889502763 36.66499246609744 20.793571069814163 19.337016574585636 7 23.304871923656453 22.50125565042692 33.450527373179305 20.743345052737318 8 24.107591754650578 24.157868275515334 24.61035696329814 27.124183006535947 9 23.851368315340196 22.596033140848608 27.6424805423048 25.910118001506405 10-14 25.266868076535747 27.93051359516616 23.40382678751259 23.3987915407855 15-19 25.481787912420543 26.69256381798002 24.921804056099283 22.90384421350015 20-24 25.0721921069963 26.30832362328385 25.40655554992654 23.212928719793304 25-29 25.818969861909082 26.297752242717472 25.022679165406714 22.86059872996674 30-34 24.84 26.179999999999996 25.21 23.77 35-39 24.865000000000002 26.674999999999997 25.124999999999996 23.335 40-44 25.95 25.990000000000002 24.98 23.080000000000002 45-49 25.31 26.405 25.19 23.095 50-54 25.585 25.855 25.424999999999997 23.135 55-59 25.72103306200382 26.67571098382072 24.17847452517335 23.424781429002113 60-64 25.27 26.455000000000002 25.419999999999998 22.855 65-69 25.50943774095028 26.395634106043158 25.264106543834174 22.830821609172382 70-74 25.78470824949698 25.91046277665996 25.397384305835008 22.907444668008047 75-79 25.145 26.77 24.935 23.150000000000002 80-84 24.565 26.384999999999998 26.095000000000002 22.955000000000002 85-89 25.46 26.51 24.91 23.119999999999997 90-94 25.415 26.779999999999998 25.035 22.770000000000003 95-99 25.285000000000004 26.650000000000002 25.03 23.035 100-104 25.447723861930964 26.268134067033515 24.932466233116557 23.351675837918958 105-109 25.44539506794162 26.285858077503775 25.339708102667334 22.92903875188727 110-114 25.15256972814848 26.595047157915975 24.93569375094568 23.316689362989862 115-119 25.271560652756026 26.620522406911533 25.008841509624613 23.099075430707828 120-124 25.54421597707506 26.494394449751148 25.222462420190034 22.738927152983763 125-129 25.455 26.515 25.365 22.665 130-134 25.5 26.71 24.9 22.89 135-139 25.785000000000004 26.064999999999998 25.96 22.189999999999998 140-144 25.31 26.179999999999996 25.779999999999998 22.73 145-149 25.88 26.915 24.955 22.25 150-151 25.900000000000002 25.662499999999998 25.95 22.4875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 2.0 24 1.5 25 2.0 26 2.5 27 2.0 28 3.5 29 5.0 30 7.5 31 12.5 32 19.5 33 22.5 34 26.0 35 32.0 36 46.0 37 70.0 38 104.5 39 127.5 40 146.0 41 170.5 42 195.0 43 216.0 44 213.5 45 198.0 46 203.5 47 203.5 48 193.5 49 190.0 50 173.0 51 143.0 52 119.5 53 113.5 54 96.0 55 78.5 56 72.0 57 72.5 58 65.5 59 65.5 60 65.0 61 50.0 62 53.0 63 60.5 64 54.0 65 45.0 66 41.5 67 42.5 68 43.0 69 32.0 70 21.5 71 22.0 72 16.5 73 10.5 74 8.5 75 7.0 76 5.5 77 1.5 78 0.0 79 0.0 80 0.5 81 1.5 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.5 4 0.5499999999999999 5 0.42500000000000004 6 0.44999999999999996 7 0.44999999999999996 8 0.5499999999999999 9 0.42500000000000004 10-14 0.7000000000000001 15-19 0.89 20-24 1.3050000000000002 25-29 0.79 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.49 60-64 0.0 65-69 0.135 70-74 0.6 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.05 105-109 0.65 110-114 0.865 115-119 1.035 120-124 0.545 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.0875 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.1375 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.2625 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.32499999999999996 0.0 0.0 0.0 0.0 118-119 0.3625 0.0 0.0 0.0 0.0 120-121 0.375 0.0 0.0 0.0 0.0 122-123 0.375 0.0 0.0 0.0 0.0 124-125 0.375 0.0 0.0 0.0 0.0 126-127 0.42500000000000004 0.0 0.0 0.0 0.0 128-129 0.4625 0.0 0.0 0.0 0.0 130-131 0.5 0.0 0.0 0.0 0.0 132-133 0.55 0.0 0.0 0.0 0.0 134-135 0.625 0.0 0.0 0.0 0.0 136-137 0.7124999999999999 0.0 0.0 0.0 0.0 138-139 0.7375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAGAGT 10 0.006711264 145.83545 1 AAGAGTT 10 0.006711264 145.83545 2 AGAGTTG 10 0.006711264 145.83545 3 >>END_MODULE Read 704363 spots for SRR6031155.sra Written 704363 spots for SRR6031155.sra Read 704363 spots for SRR6031155.sra Written 704363 spots for SRR6031155.sra Read 704363 spots for SRR6031155.sra Written 704363 spots for SRR6031155.sra Read 704363 spots for SRR6031155.sra Written 704363 spots for SRR6031155.sra Read 704363 spots for SRR6031155.sra Written 704363 spots for SRR6031155.sra Read 704363 spots for SRR6031155.sra Written 704363 spots for SRR6031155.sra Read 704363 spots for SRR6031155.sra Written 704363 spots for SRR6031155.sra Read 704363 spots for SRR6031155.sra Written 704363 spots for SRR6031155.sra Read 704363 spots for SRR6031155.sra Written 704363 spots for SRR6031155.sra Read 704363 spots for SRR6031155.sra Written 704363 spots for SRR6031155.sra Read 704363 spots for SRR6031155.sra Written 704363 spots for SRR6031155.sra Read 704363 spots for SRR6031155.sra Written 704363 spots for SRR6031155.sra Read 704363 spots for SRR6031155.sra Written 704363 spots for SRR6031155.sra Read 704363 spots for SRR6031155.sra Written 704363 spots for SRR6031155.sra Read 704363 spots for SRR6031155.sra Written 704363 spots for SRR6031155.sra Read 704363 spots for SRR6031155.sra Written 704363 spots for SRR6031155.sra Read 704363 spots for SRR6031155.sra Written 704363 spots for SRR6031155.sra Read 704363 spots for SRR6031155.sra Written 704363 spots for SRR6031155.sra Read 704363 spots for SRR6031155.sra Written 704363 spots for SRR6031155.sra Read 704371 spots for SRR6031155.sra Written 704371 spots for SRR6031155.sra SRR ids: ['SRR6031155.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e27agrce SRR6031155.sra spots: 14087268 blocks: [[1, 704363], [704364, 1408726], [1408727, 2113089], [2113090, 2817452], [2817453, 3521815], [3521816, 4226178], [4226179, 4930541], [4930542, 5634904], [5634905, 6339267], [6339268, 7043630], [7043631, 7747993], [7747994, 8452356], [8452357, 9156719], [9156720, 9861082], [9861083, 10565445], [10565446, 11269808], [11269809, 11974171], [11974172, 12678534], [12678535, 13382897], [13382898, 14087268]] SRR6031155 file size 4752012 SRR6031155 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031155 SRR6031155_1.fastq SRR6031155_2.fastq Input file: SRR6031155_1.fastq Paired file: SRR6031155_2.fastq trimmed: SRR6031155-trimmed-pair1.fastq, SRR6031155-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:33:06 2024 >> started Tue Dec 10 00:33:24 2024 >> done (17.447s) 14087268 read pairs processed; of these: 10926 ( 0.08%) short read pairs filtered out after trimming by size control 14146 ( 0.10%) empty read pairs filtered out after trimming by size control 14062196 (99.82%) read pairs available; of these: 3328145 (23.67%) trimmed read pairs available after processing 10734051 (76.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 7 0.00% 20 11 0.00% 21 9 0.00% 22 9 0.00% 23 7 0.00% 24 8 0.00% 25 7 0.00% 26 9 0.00% 27 5 0.00% 28 2 0.00% 29 5 0.00% 30 9 0.00% 31 10 0.00% 32 10 0.00% 33 6 0.00% 34 9 0.00% 35 4 0.00% 36 9 0.00% 37 11 0.00% 38 14 0.00% 39 6 0.00% 40 11 0.00% 41 13 0.00% 42 15 0.00% 43 8 0.00% 44 14 0.00% 45 12 0.00% 46 14 0.00% 47 21 0.00% 48 13 0.00% 49 20 0.00% 50 21 0.00% 51 22 0.00% 52 36 0.00% 53 35 0.00% 54 40 0.00% 55 45 0.00% 56 38 0.00% 57 45 0.00% 58 51 0.00% 59 67 0.00% 60 75 0.00% 61 69 0.00% 62 69 0.00% 63 66 0.00% 64 88 0.00% 65 97 0.00% 66 114 0.00% 67 133 0.00% 68 141 0.00% 69 130 0.00% 70 157 0.00% 71 177 0.00% 72 182 0.00% 73 209 0.00% 74 235 0.00% 75 249 0.00% 76 303 0.00% 77 361 0.00% 78 317 0.00% 79 331 0.00% 80 392 0.00% 81 389 0.00% 82 519 0.00% 83 530 0.00% 84 1024 0.01% 85 1432 0.01% 86 1468 0.01% 87 1640 0.01% 88 1833 0.01% 89 1890 0.01% 90 1888 0.01% 91 1778 0.01% 92 1761 0.01% 93 1774 0.01% 94 1731 0.01% 95 1796 0.01% 96 1859 0.01% 97 1869 0.01% 98 1876 0.01% 99 1912 0.01% 100 1980 0.01% 101 2028 0.01% 102 2205 0.02% 103 2284 0.02% 104 2323 0.02% 105 2436 0.02% 106 2592 0.02% 107 2714 0.02% 108 2820 0.02% 109 3074 0.02% 110 3322 0.02% 111 3488 0.02% 112 3687 0.03% 113 4069 0.03% 114 4845 0.03% 115 5697 0.04% 116 5929 0.04% 117 5526 0.04% 118 5016 0.04% 119 5032 0.04% 120 5114 0.04% 121 5299 0.04% 122 5614 0.04% 123 5693 0.04% 124 5960 0.04% 125 6094 0.04% 126 6467 0.05% 127 6762 0.05% 128 7245 0.05% 129 7538 0.05% 130 7713 0.05% 131 8206 0.06% 132 8822 0.06% 133 9485 0.07% 134 10183 0.07% 135 10885 0.08% 136 11936 0.08% 137 12829 0.09% 138 14051 0.10% 139 15184 0.11% 140 16688 0.12% 141 18844 0.13% 142 21434 0.15% 143 24496 0.17% 144 29494 0.21% 145 37034 0.26% 146 48906 0.35% 147 70487 0.50% 148 119560 0.85% 149 291640 2.07% 150 2373838 16.88% 151 10734051 76.33% 14062196 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=3.48 fanout-score-rank=20 prefix-density=0.49 prefix-fanout=3.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGAC criterion=fanout-score sequence-density=0.05 sequence-density-rank=28 fanout-score=150.97 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=19.3 sequence=ATCATCTTCACGATACCAGCATCACCGTTCTTCAAGAACTTGGGCTCCTTCTCCAGCTCCT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=4.08 fanout-score-rank=22 prefix-density=0.24 prefix-fanout=3.6 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=16 fanout-score=161.54 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=24.1 sequence=CAAGAAGAAGGTGCAGACCGAGTGCGCCTCCATGCCTTTCGATGACCAATGCGCCGTCTTGGAAAAGGAGGCCGTGAACGTGTCCCTCGAGAACCTCAAGACCTACC SRR6031155 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:34:13 Started mapping on | Dec 10 00:34:13 Finished on | Dec 10 00:35:44 Mapping speed, Million of reads per hour | 556.31 Number of input reads | 14062196 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 13434457 Uniquely mapped reads % | 95.54% Average mapped length | 299.92 Number of splices: Total | 15593360 Number of splices: Annotated (sjdb) | 14827770 Number of splices: GT/AG | 15395489 Number of splices: GC/AG | 180295 Number of splices: AT/AC | 8581 Number of splices: Non-canonical | 8995 Mismatch rate per base, % | 0.07% Deletion rate per base | 0.00% Deletion average length | 1.36 Insertion rate per base | 0.00% Insertion average length | 1.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 132220 % of reads mapped to multiple loci | 0.94% Number of reads mapped to too many loci | 7008 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.11% % of reads unmapped: other | 0.37% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 503350 503350 503350 N_multimapping 132220 132220 132220 N_noFeature 466654 13057761 554630 N_ambiguous 348732 3022 61409 UnstrandedReadsAssigned:12619071 PositiveStrandReadsAssigned:373674 NegativeStrandReadsAssigned:12818418 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6031155 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6031155-trimmed-pair1.fastq SRR6031155-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,062,196 reads, 12,853,277 reads pseudoaligned [quant] estimated average fragment length: 436.152 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,093 rounds 52973 SRR6031155.ke.tsv 35125 SRR6031155.se.tsv 88098 total ==> SRR6031155.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 502.213 0 0 PNS24247 1044 608.848 95.4666 17.3457 PNS24249 1928 1492.85 18.002 1.334 PNS24246 1044 608.848 95.4666 17.3457 PNS24248 1044 608.848 95.4666 17.3457 PNS24244 1471 1035.85 61.5981 6.57841 PNS24243 293 63.9915 0 0 KQK14069 1603 1167.85 3529.43 334.324 KQK14071 474 130.278 19.9707 16.9579 ==> SRR6031155.se.tsv <== BRADI_1g14170v3 4058 BRADI_1g53295v3 45 BRADI_1g59795v3 474 BRADI_1g07683v3 0 BRADI_1g00485v3 23 BRADI_1g20270v3 1076 BRADI_1g74790v3 133 BRADI_1g09890v3 0 BRADI_1g77505v3 200 BRADI_1g48960v3 0 SRR6031155 completed mapping pipeline successfully