Starting /dee2/code/volunteer_pipeline.sh SRR6031156 current disk space = 1523496697856 free memory = 1566560184 SRR6031156 SRAfilesize 5a27e9ba3f7aa4fc75eda1accb9e604e SRR6031156.sra SRR6031156.sra file validated SRR6031156 is paired end SRR6031156 is conventional basespace SRR6031156 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031156_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.638 32.0 18.0 33.0 18.0 33.0 2 22.49675 18.0 18.0 29.0 18.0 33.0 3 27.1395 27.0 25.0 30.0 18.0 33.0 4 30.25925 31.0 29.0 33.0 27.0 33.0 5 32.076 33.0 32.0 33.0 32.0 33.0 6 36.78225 38.0 37.0 38.0 35.0 38.0 7 37.30375 38.0 38.0 38.0 36.0 38.0 8 37.625 38.0 38.0 38.0 37.0 38.0 9 37.6445 38.0 38.0 38.0 38.0 38.0 10-14 37.733 38.0 38.0 38.0 38.0 38.0 15-19 37.7669 38.0 38.0 38.0 38.0 38.0 20-24 37.767199999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.74055 38.0 38.0 38.0 38.0 38.0 30-34 37.72355 38.0 38.0 38.0 38.0 38.0 35-39 37.73405 38.0 38.0 38.0 38.0 38.0 40-44 37.67765 38.0 38.0 38.0 38.0 38.0 45-49 37.62485 38.0 38.0 38.0 38.0 38.0 50-54 37.6015 38.0 38.0 38.0 38.0 38.0 55-59 37.5504 38.0 38.0 38.0 38.0 38.0 60-64 37.49595 38.0 38.0 38.0 37.0 38.0 65-69 37.4613 38.0 38.0 38.0 37.0 38.0 70-74 37.38805 38.0 38.0 38.0 37.0 38.0 75-79 37.341449999999995 38.0 38.0 38.0 37.0 38.0 80-84 37.3365 38.0 38.0 38.0 37.0 38.0 85-89 37.268600000000006 38.0 38.0 38.0 36.4 38.0 90-94 37.20295 38.0 38.0 38.0 36.0 38.0 95-99 37.05005 38.0 38.0 38.0 36.0 38.0 100-104 37.00320000000001 38.0 38.0 38.0 35.6 38.0 105-109 36.806 38.0 38.0 38.0 35.0 38.0 110-114 36.8301 38.0 38.0 38.0 35.0 38.0 115-119 36.623000000000005 38.0 38.0 38.0 34.6 38.0 120-124 36.4724 38.0 38.0 38.0 34.0 38.0 125-129 36.18104999999999 38.0 37.6 38.0 33.2 38.0 130-134 35.92995 38.0 36.4 38.0 32.8 38.0 135-139 35.90405 38.0 36.2 38.0 32.6 38.0 140-144 35.6668 38.0 36.0 38.0 31.8 38.0 145-149 35.1551 38.0 35.2 38.0 30.0 38.0 150-151 31.483625000000004 36.5 31.0 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 2.0 14 1.0 15 0.0 16 1.0 17 2.0 18 2.0 19 1.0 20 0.0 21 2.0 22 5.0 23 2.0 24 2.0 25 0.0 26 7.0 27 8.0 28 8.0 29 9.0 30 23.0 31 28.0 32 37.0 33 64.0 34 119.0 35 232.0 36 822.0 37 2622.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 62.71356783919598 10.025125628140703 6.105527638190955 21.155778894472363 2 29.125 8.875 35.4 26.6 3 19.2 17.925 25.3 37.574999999999996 4 23.45 23.625 23.75 29.175 5 23.5 27.474999999999998 24.275 24.75 6 22.775000000000002 30.3 23.150000000000002 23.775 7 17.4 25.45 38.3 18.85 8 20.625 23.724999999999998 30.875000000000004 24.775 9 19.575 21.575 32.475 26.375 10-14 21.85 27.6 26.265 24.285 15-19 22.56 25.615 27.505000000000003 24.32 20-24 22.245 26.669999999999998 26.13 24.955 25-29 21.695 25.580000000000002 27.445000000000004 25.28 30-34 21.25 26.135 26.490000000000002 26.125 35-39 21.975 25.979999999999997 26.63 25.415 40-44 22.12 25.97 27.02 24.89 45-49 21.625 25.52 27.005000000000003 25.85 50-54 21.61 26.645000000000003 26.31 25.435000000000002 55-59 21.895 25.77 26.085 26.25 60-64 21.19 26.384999999999998 27.224999999999998 25.2 65-69 21.345 25.355 27.76 25.540000000000003 70-74 22.11 25.905 26.655 25.330000000000002 75-79 22.645 26.064999999999998 26.150000000000002 25.14 80-84 20.995 25.655 27.05 26.3 85-89 22.375 24.995 27.245 25.385 90-94 22.040000000000003 26.174999999999997 26.685 25.1 95-99 21.36 26.025 26.99 25.624999999999996 100-104 22.45 25.89 26.26 25.4 105-109 21.73 25.75 27.32 25.2 110-114 22.400000000000002 25.674999999999997 26.424999999999997 25.5 115-119 22.259999999999998 25.735000000000003 27.05 24.955 120-124 21.84 26.235000000000003 26.815 25.11 125-129 22.435 25.740000000000002 25.81 26.015 130-134 22.02 25.825 26.640000000000004 25.515 135-139 22.195 26.21 26.025 25.569999999999997 140-144 21.985 26.035000000000004 26.015 25.965 145-149 23.04 25.729999999999997 25.669999999999998 25.56 150-151 22.175 25.587500000000002 27.3 24.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 1.0 4 1.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 1.0 28 5.5 29 9.5 30 12.5 31 15.5 32 22.5 33 25.5 34 27.5 35 39.5 36 50.0 37 63.5 38 87.0 39 114.0 40 129.0 41 150.5 42 164.5 43 177.0 44 204.0 45 218.5 46 220.5 47 227.5 48 228.0 49 213.0 50 193.0 51 180.0 52 171.0 53 138.5 54 122.5 55 122.5 56 104.5 57 92.5 58 84.5 59 63.0 60 49.0 61 40.0 62 36.0 63 33.0 64 23.5 65 19.0 66 18.0 67 20.0 68 17.5 69 11.5 70 9.5 71 8.5 72 7.0 73 8.0 74 4.5 75 1.5 76 2.5 77 2.5 78 1.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.525 #Duplication Level Percentage of deduplicated Percentage of total 1 97.06883014917561 92.72500000000001 2 1.884323475529966 3.5999999999999996 3 0.7066213033237372 2.025 4 0.20936927505888508 0.8 5 0.05234231876472127 0.25 6 0.026171159382360636 0.15 7 0.0 0.0 8 0.0 0.0 9 0.05234231876472127 0.44999999999999996 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTT 9 0.22499999999999998 No Hit GCCACGCTTTCACGGTTCGTATTCGTACTGGAAATCAGAATCAAACGAGC 9 0.22499999999999998 No Hit GCCGCAGGCTCCACGCCTGGTGGTGCCCTTCCGTCAATTCCTTTAAGTTT 6 0.15 No Hit GTGTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTA 5 0.125 No Hit GTCGCTATGAACGCTTGGCTGCCACAAGCCAGTTATCCCTGTGGTAACTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.2375 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.3125 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.4125 0.0 0.0 0.0 0.0 122-123 0.425 0.0 0.0 0.0 0.0 124-125 0.45 0.0 0.0 0.0 0.0 126-127 0.45 0.0 0.0 0.0 0.0 128-129 0.4625 0.0 0.0 0.0 0.0 130-131 0.55 0.0 0.0 0.0 0.0 132-133 0.5874999999999999 0.0 0.0 0.0 0.0 134-135 0.65 0.0 0.0 0.0 0.0 136-137 0.7 0.0 0.0 0.0 0.0 138-139 0.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGTTC 10 0.006830828 145.0 3 ATACATC 10 0.006830828 145.0 7 >>END_MODULE SRR6031156 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031156_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.491 33.0 33.0 34.0 32.0 34.0 2 32.738 34.0 33.0 34.0 32.0 34.0 3 32.812 34.0 33.0 34.0 33.0 34.0 4 32.79675 34.0 33.0 34.0 33.0 34.0 5 32.78475 34.0 33.0 34.0 33.0 34.0 6 36.938 38.0 38.0 38.0 38.0 38.0 7 36.94325 38.0 38.0 38.0 38.0 38.0 8 36.94425 38.0 38.0 38.0 38.0 38.0 9 37.01275 38.0 38.0 38.0 38.0 38.0 10-14 36.93580000000001 38.0 38.0 38.0 37.8 38.0 15-19 36.85029999999999 38.0 38.0 38.0 37.4 38.0 20-24 36.821949999999994 38.0 38.0 38.0 37.0 38.0 25-29 36.888799999999996 38.0 38.0 38.0 37.6 38.0 30-34 37.0515 38.0 38.0 38.0 37.8 38.0 35-39 37.14545 38.0 38.0 38.0 37.8 38.0 40-44 37.16045 38.0 38.0 38.0 37.6 38.0 45-49 37.1286 38.0 38.0 38.0 37.4 38.0 50-54 37.06345 38.0 38.0 38.0 37.2 38.0 55-59 36.88215 38.0 38.0 38.0 37.0 38.0 60-64 36.9209 38.0 38.0 38.0 37.0 38.0 65-69 36.81825 38.0 38.0 38.0 37.0 38.0 70-74 36.67115 38.0 38.0 38.0 36.4 38.0 75-79 36.7407 38.0 38.0 38.0 36.0 38.0 80-84 36.887750000000004 38.0 38.0 38.0 36.6 38.0 85-89 36.83415 38.0 38.0 38.0 36.0 38.0 90-94 36.66585 38.0 38.0 38.0 35.8 38.0 95-99 36.6871 38.0 38.0 38.0 35.8 38.0 100-104 36.53395 38.0 38.0 38.0 35.2 38.0 105-109 36.38135 38.0 38.0 38.0 35.2 38.0 110-114 36.19975000000001 38.0 38.0 38.0 34.4 38.0 115-119 36.05535 38.0 38.0 38.0 34.0 38.0 120-124 35.99825 38.0 38.0 38.0 34.0 38.0 125-129 36.052550000000004 38.0 38.0 38.0 34.0 38.0 130-134 35.893150000000006 38.0 38.0 38.0 33.2 38.0 135-139 35.721199999999996 38.0 38.0 38.0 32.4 38.0 140-144 35.5235 38.0 37.6 38.0 31.4 38.0 145-149 35.196600000000004 38.0 36.0 38.0 31.0 38.0 150-151 31.011374999999997 35.5 29.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 23.0 3 6.0 4 0.0 5 0.0 6 1.0 7 4.0 8 3.0 9 1.0 10 0.0 11 3.0 12 3.0 13 2.0 14 3.0 15 3.0 16 3.0 17 6.0 18 4.0 19 8.0 20 5.0 21 9.0 22 5.0 23 7.0 24 15.0 25 11.0 26 10.0 27 8.0 28 16.0 29 18.0 30 22.0 31 24.0 32 46.0 33 53.0 34 78.0 35 149.0 36 406.0 37 3045.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.016343207354446 21.782431052093973 7.814096016343207 24.387129724208375 2 28.01724137931034 29.006085192697768 24.746450304259636 18.23022312373225 3 22.946247464503042 28.372210953346855 28.397565922920894 20.28397565922921 4 26.192893401015226 32.15736040609137 20.17766497461929 21.472081218274113 5 27.358012170385393 32.834685598377284 20.562880324543613 19.244421906693713 6 23.770907247845923 35.98580841358338 20.12164216928535 20.12164216928535 7 22.250380131779014 21.66751140395337 33.60364926507856 22.478459199189054 8 24.049670552458185 24.22706538266599 23.542828180435883 28.18043588443994 9 22.641032127498104 24.84189223374652 28.054642044017204 24.462433594738172 10-14 26.080567519635167 27.337218140359766 24.03851026095769 22.543704079047377 15-19 25.61916362159968 25.923670320747057 25.64961429151441 22.807551766138857 20-24 25.575019040365575 26.864686468646866 24.935262757044935 22.625031733942624 25-29 25.567605919318876 26.51023717818772 25.243259679708093 22.678897222785324 30-34 25.04158475729624 26.866273501688593 25.202883209839204 22.889258531175965 35-39 25.47492210272389 26.650919690421148 24.896974570308576 22.977183636546386 40-44 25.85194479297365 25.75658720200753 25.962358845671268 22.429109159347554 45-49 25.780074245008528 25.880405337614125 25.88542189224441 22.45409852513294 50-54 25.58069381598793 26.907993966817497 25.279034690799396 22.232277526395173 55-59 26.09860935524652 25.845764854614412 25.238938053097343 22.81668773704172 60-64 26.255293405928615 25.28231498285945 25.781407541843116 22.680984069368822 65-69 25.78724263221639 25.938635446104158 24.944489301574485 23.329632620104963 70-74 25.600486470051685 26.461943853248197 25.08361204013378 22.85395763656633 75-79 25.392260733565408 25.367034962918115 25.53857020331971 23.702134100196762 80-84 26.18079606484967 25.34758821462631 26.095467550067763 22.376148170456254 85-89 25.950255741650786 25.729615886069602 25.57416507872831 22.7459632935513 90-94 25.959175485229952 25.623150609358543 26.17483324138623 22.242840664025277 95-99 26.385264003212207 26.184501104195945 25.150572174262198 22.27966271832965 100-104 25.99114509961763 26.5445763735158 25.764741396659286 21.699537130207286 105-109 25.26454356741431 26.13032251531568 26.0391878892208 22.565946028049215 110-114 25.841784989858013 26.44523326572008 25.263691683569977 22.449290060851926 115-119 26.042617960426178 26.0984271943176 25.073566717402336 22.78538812785388 120-124 25.773456883892855 25.61648691072966 25.46458048508785 23.145475720289635 125-129 25.705959200080393 26.655612501256154 25.133152446990252 22.505275851673197 130-134 25.425003761095233 26.081941728097892 25.620580713103656 22.872473797703226 135-139 25.827150591538 26.007619811509926 26.20312813314618 21.962101463805894 140-144 25.876753507014026 26.25751503006012 25.28056112224449 22.585170340681362 145-149 25.21142971525797 26.502527148075867 25.186408447180103 23.099634689486063 150-151 25.643278523911135 25.944521149742688 25.291828793774318 23.12037153257186 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 10.0 1 5.5 2 1.5 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 2.0 12 3.0 13 1.0 14 0.5 15 1.5 16 1.0 17 0.5 18 1.5 19 2.0 20 1.5 21 1.5 22 3.0 23 2.5 24 2.0 25 4.0 26 4.5 27 4.5 28 6.0 29 7.5 30 8.5 31 14.0 32 19.5 33 19.0 34 28.5 35 41.0 36 41.5 37 58.5 38 80.5 39 106.5 40 134.0 41 156.5 42 168.0 43 184.5 44 211.5 45 214.0 46 212.5 47 206.0 48 191.5 49 181.5 50 182.0 51 165.5 52 152.0 53 147.5 54 124.5 55 103.5 56 79.5 57 69.5 58 68.0 59 59.5 60 50.5 61 41.0 62 39.0 63 41.5 64 39.0 65 40.5 66 43.5 67 47.5 68 47.0 69 32.5 70 23.0 71 16.0 72 10.5 73 9.5 74 9.0 75 6.5 76 4.0 77 1.5 78 2.5 79 2.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.1 2 1.4000000000000001 3 1.4000000000000001 4 1.5 5 1.4000000000000001 6 1.35 7 1.35 8 1.35 9 1.175 10-14 1.325 15-19 1.48 20-24 1.525 25-29 1.34 30-34 0.8049999999999999 35-39 0.51 40-44 0.375 45-49 0.33 50-54 0.5499999999999999 55-59 1.125 60-64 0.8200000000000001 65-69 0.9199999999999999 70-74 1.3299999999999998 75-79 0.895 80-84 0.385 85-89 0.29 90-94 0.305 95-99 0.38 100-104 0.62 105-109 1.2449999999999999 110-114 1.4000000000000001 115-119 1.4500000000000002 120-124 1.2550000000000001 125-129 0.49 130-134 0.295 135-139 0.26 140-144 0.2 145-149 0.08499999999999999 150-151 0.41250000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.45 #Duplication Level Percentage of deduplicated Percentage of total 1 96.61196400211752 91.25 2 2.3292747485442034 4.3999999999999995 3 0.5558496559025939 1.575 4 0.18528321863419797 0.7000000000000001 5 0.10587612493382743 0.5 6 0.07940709370037057 0.44999999999999996 7 0.02646903123345686 0.17500000000000002 8 0.02646903123345686 0.2 9 0.05293806246691372 0.44999999999999996 >10 0.02646903123345686 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 12 0.3 No Hit GGCGGGACTACCCGCTGAGTTTAAGCATATAAATAAGCGGAGGAGAAGAA 9 0.22499999999999998 No Hit CTTACCAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTT 9 0.22499999999999998 No Hit GGTCAGGCGGGACTACCCGCTGAGTTTAAGCATATAAATAAGCGGAGGAG 8 0.2 No Hit GGAGTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCA 7 0.17500000000000002 No Hit GTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCAAGG 6 0.15 No Hit GTACAATCTAAATCCCTTAACGAGGATCCATTGGAGGGCAAGTCTGGTGC 6 0.15 No Hit CTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCAAGGAA 6 0.15 No Hit CGGGACTACCCGCTGAGTTTAAGCATATAAATAAGCGGAGGAGAAGAAAC 5 0.125 No Hit CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 5 0.125 No Hit GAACGGGCTTGGCGGAATCAGCGGGGAAAGAAGACCCTGTTGAGCTTGAC 5 0.125 No Hit AAGGAGTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.0875 0.0 0.0 0.0 0.0 102-103 0.1 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.1875 0.0 0.0 0.0 0.0 110-111 0.2 0.0 0.0 0.0 0.0 112-113 0.2375 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.3125 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.4125 0.0 0.0 0.0 0.0 122-123 0.425 0.0 0.0 0.0 0.0 124-125 0.45 0.0 0.0 0.0 0.0 126-127 0.45 0.0 0.0 0.0 0.0 128-129 0.4625 0.0 0.0 0.0 0.0 130-131 0.5625 0.0 0.0 0.0 0.0 132-133 0.6125 0.0 0.0 0.0 0.0 134-135 0.675 0.0 0.0 0.0 0.0 136-137 0.725 0.0 0.0 0.0 0.0 138-139 0.7875000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAGAC 10 0.006832588 144.9875 6 >>END_MODULE Read 603954 spots for SRR6031156.sra Written 603954 spots for SRR6031156.sra Read 603954 spots for SRR6031156.sra Written 603954 spots for SRR6031156.sra Read 603954 spots for SRR6031156.sra Written 603954 spots for SRR6031156.sra Read 603954 spots for SRR6031156.sra Written 603954 spots for SRR6031156.sra Read 603954 spots for SRR6031156.sra Written 603954 spots for SRR6031156.sra Read 603954 spots for SRR6031156.sra Written 603954 spots for SRR6031156.sra Read 603954 spots for SRR6031156.sra Written 603954 spots for SRR6031156.sra Read 603954 spots for SRR6031156.sra Written 603954 spots for SRR6031156.sra Read 603954 spots for SRR6031156.sra Written 603954 spots for SRR6031156.sra Read 603954 spots for SRR6031156.sra Written 603954 spots for SRR6031156.sra Read 603954 spots for SRR6031156.sra Written 603954 spots for SRR6031156.sra Read 603954 spots for SRR6031156.sra Written 603954 spots for SRR6031156.sra Read 603954 spots for SRR6031156.sra Written 603954 spots for SRR6031156.sra Read 603954 spots for SRR6031156.sra Written 603954 spots for SRR6031156.sra Read 603955 spots for SRR6031156.sra Written 603955 spots for SRR6031156.sra Read 603954 spots for SRR6031156.sra Written 603954 spots for SRR6031156.sra Read 603954 spots for SRR6031156.sra Written 603954 spots for SRR6031156.sra Read 603954 spots for SRR6031156.sra Written 603954 spots for SRR6031156.sra Read 603954 spots for SRR6031156.sra Written 603954 spots for SRR6031156.sra Read 603954 spots for SRR6031156.sra Written 603954 spots for SRR6031156.sra SRR ids: ['SRR6031156.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w_x8q1zq SRR6031156.sra spots: 12079081 blocks: [[1, 603954], [603955, 1207908], [1207909, 1811862], [1811863, 2415816], [2415817, 3019770], [3019771, 3623724], [3623725, 4227678], [4227679, 4831632], [4831633, 5435586], [5435587, 6039540], [6039541, 6643494], [6643495, 7247448], [7247449, 7851402], [7851403, 8455356], [8455357, 9059310], [9059311, 9663264], [9663265, 10267218], [10267219, 10871172], [10871173, 11475126], [11475127, 12079081]] SRR6031156 file size 4071503 SRR6031156 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031156 SRR6031156_1.fastq SRR6031156_2.fastq Input file: SRR6031156_1.fastq Paired file: SRR6031156_2.fastq trimmed: SRR6031156-trimmed-pair1.fastq, SRR6031156-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:17:42 2024 >> started Tue Dec 10 00:18:20 2024 >> done (38.156s) 12079081 read pairs processed; of these: 10625 ( 0.09%) short read pairs filtered out after trimming by size control 15501 ( 0.13%) empty read pairs filtered out after trimming by size control 12052955 (99.78%) read pairs available; of these: 3818629 (31.68%) trimmed read pairs available after processing 8234326 (68.32%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 7 0.00% 21 4 0.00% 22 3 0.00% 23 1 0.00% 24 5 0.00% 25 3 0.00% 26 7 0.00% 27 7 0.00% 28 12 0.00% 29 4 0.00% 30 3 0.00% 31 4 0.00% 32 3 0.00% 33 6 0.00% 34 2 0.00% 35 3 0.00% 36 4 0.00% 37 1 0.00% 38 4 0.00% 39 4 0.00% 40 3 0.00% 41 5 0.00% 42 5 0.00% 43 7 0.00% 44 4 0.00% 45 9 0.00% 46 9 0.00% 47 10 0.00% 48 15 0.00% 49 7 0.00% 50 7 0.00% 51 21 0.00% 52 19 0.00% 53 15 0.00% 54 22 0.00% 55 31 0.00% 56 30 0.00% 57 28 0.00% 58 29 0.00% 59 33 0.00% 60 31 0.00% 61 42 0.00% 62 44 0.00% 63 46 0.00% 64 52 0.00% 65 61 0.00% 66 66 0.00% 67 56 0.00% 68 72 0.00% 69 83 0.00% 70 94 0.00% 71 96 0.00% 72 122 0.00% 73 134 0.00% 74 141 0.00% 75 175 0.00% 76 161 0.00% 77 208 0.00% 78 205 0.00% 79 214 0.00% 80 268 0.00% 81 278 0.00% 82 355 0.00% 83 369 0.00% 84 819 0.01% 85 1095 0.01% 86 1260 0.01% 87 1372 0.01% 88 1496 0.01% 89 1311 0.01% 90 1378 0.01% 91 1328 0.01% 92 1318 0.01% 93 1392 0.01% 94 1475 0.01% 95 1456 0.01% 96 1575 0.01% 97 1567 0.01% 98 1648 0.01% 99 1661 0.01% 100 1720 0.01% 101 1973 0.02% 102 2020 0.02% 103 2056 0.02% 104 2156 0.02% 105 2941 0.02% 106 2692 0.02% 107 2448 0.02% 108 2846 0.02% 109 2774 0.02% 110 3084 0.03% 111 3118 0.03% 112 3560 0.03% 113 3857 0.03% 114 4320 0.04% 115 4563 0.04% 116 4732 0.04% 117 4585 0.04% 118 4663 0.04% 119 4759 0.04% 120 5136 0.04% 121 5031 0.04% 122 5350 0.04% 123 5631 0.05% 124 6097 0.05% 125 6504 0.05% 126 6856 0.06% 127 7063 0.06% 128 7639 0.06% 129 8243 0.07% 130 9007 0.07% 131 9501 0.08% 132 10077 0.08% 133 10928 0.09% 134 11785 0.10% 135 12862 0.11% 136 14161 0.12% 137 15521 0.13% 138 16814 0.14% 139 18307 0.15% 140 20648 0.17% 141 22987 0.19% 142 26205 0.22% 143 31377 0.26% 144 37592 0.31% 145 47563 0.39% 146 63654 0.53% 147 92450 0.77% 148 157979 1.31% 149 387622 3.22% 150 2647245 21.96% 151 8234326 68.32% 12052955 reads passed initial QC criterion=sequence-density sequence-density=1.26 sequence-density-rank=1 fanout-score=2.45 fanout-score-rank=27 prefix-density=1.30 prefix-fanout=2.4 sequence=CCCAGCTCACGTTCCCTATTGGTGGGTGAACAATCCAACACTTGGTGAATTCTGCTTCACAATGATAGGAAGAGCCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCACAAGCCAGTTATCCCTGTGGTAACTTTTCTGACACCTCTAGCTTCAAACTCCGAAGATCTAAAGGATCGATAGGCCACGCTTTCACGGTTCGTATTCGTACTGGAAATCAGAATCAAACGAGCTTTTACCCTTTTGTTCCACACGAGATTTCTGTTCTCGTTGAGCTCATCTTAGGACACCTGCGTTATCTTTTAACAGATGTGCCGCCCCAGCCAAACTCCCCACCTGACAATGTCTTCCGCCCGGATCGGCCCGGTCAGACCGGGCCTTGGAGCCAAAAGGAGGGGACTTGCCCCGCTTCCGACCCACGGAATAAGTAAAATAACGTTAAAAGTAGTGGTATTTCACTTGCGCCCGTAAAGGCTCCCACTTATCCTACACCTCTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=13 fanout-score=93.47 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=20.8 sequence=ATCTTCTTCTTGTCGTCCGC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=6.31 fanout-score-rank=20 prefix-density=0.22 prefix-fanout=4.6 sequence=GGCAAGACCATCAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=450.58 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=18.6 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR6031156 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:19:37 Started mapping on | Dec 10 00:19:38 Finished on | Dec 10 00:21:20 Mapping speed, Million of reads per hour | 425.40 Number of input reads | 12052955 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 9437333 Uniquely mapped reads % | 78.30% Average mapped length | 299.39 Number of splices: Total | 10686370 Number of splices: Annotated (sjdb) | 10181932 Number of splices: GT/AG | 10551421 Number of splices: GC/AG | 120935 Number of splices: AT/AC | 7637 Number of splices: Non-canonical | 6377 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.42 Insertion rate per base | 0.00% Insertion average length | 1.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 111510 % of reads mapped to multiple loci | 0.93% Number of reads mapped to too many loci | 215922 % of reads mapped to too many loci | 1.79% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.72% % of reads unmapped: other | 15.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2510385 2510385 2510385 N_multimapping 111510 111510 111510 N_noFeature 395595 9187752 463324 N_ambiguous 221940 2065 40339 UnstrandedReadsAssigned:8819798 PositiveStrandReadsAssigned:247516 NegativeStrandReadsAssigned:8933670 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6031156 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6031156-trimmed-pair1.fastq SRR6031156-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,052,955 reads, 9,063,539 reads pseudoaligned [quant] estimated average fragment length: 423.421 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,061 rounds 52973 SRR6031156.ke.tsv 35125 SRR6031156.se.tsv 88098 total ==> SRR6031156.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 514.502 0 0 PNS24247 1044 621.579 57.8025 14.8971 PNS24249 1928 1505.58 23.5494 2.50569 PNS24246 1044 621.579 57.8025 14.8971 PNS24248 1044 621.579 57.8025 14.8971 PNS24244 1471 1048.58 48.0432 7.33975 PNS24243 293 61.6952 0 0 KQK14069 1603 1180.58 1037.28 140.752 KQK14071 474 130.813 3.63596 4.45265 ==> SRR6031156.se.tsv <== BRADI_1g14170v3 1104 BRADI_1g53295v3 55 BRADI_1g59795v3 297 BRADI_1g07683v3 0 BRADI_1g00485v3 28 BRADI_1g20270v3 460 BRADI_1g74790v3 137 BRADI_1g09890v3 1 BRADI_1g77505v3 94 BRADI_1g48960v3 0 SRR6031156 completed mapping pipeline successfully