Starting /dee2/code/volunteer_pipeline.sh SRR6031158 current disk space = 1523520753664 free memory = 1601799092 SRR6031158 SRAfilesize 3299119a3a1e6ac69957e69c0a51beb0 SRR6031158.sra SRR6031158.sra file validated SRR6031158 is paired end SRR6031158 is conventional basespace SRR6031158 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031158_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.217 30.0 18.0 33.0 18.0 33.0 2 28.56 30.0 27.0 31.0 18.0 33.0 3 31.30975 33.0 31.0 33.0 29.0 33.0 4 32.391 33.0 33.0 33.0 31.0 33.0 5 33.041 33.0 33.0 34.0 33.0 34.0 6 37.30425 38.0 38.0 38.0 36.0 38.0 7 37.68725 38.0 38.0 38.0 38.0 38.0 8 37.72825 38.0 38.0 38.0 38.0 38.0 9 37.76225 38.0 38.0 38.0 38.0 38.0 10-14 37.778150000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.75085 38.0 38.0 38.0 38.0 38.0 20-24 37.750750000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.74550000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.7147 38.0 38.0 38.0 38.0 38.0 35-39 37.71040000000001 38.0 38.0 38.0 38.0 38.0 40-44 37.6941 38.0 38.0 38.0 38.0 38.0 45-49 37.60935 38.0 38.0 38.0 38.0 38.0 50-54 37.550850000000004 38.0 38.0 38.0 37.8 38.0 55-59 37.51055 38.0 38.0 38.0 37.8 38.0 60-64 37.474849999999996 38.0 38.0 38.0 37.4 38.0 65-69 37.46874999999999 38.0 38.0 38.0 37.0 38.0 70-74 37.4073 38.0 38.0 38.0 37.0 38.0 75-79 37.34165 38.0 38.0 38.0 36.8 38.0 80-84 37.284499999999994 38.0 38.0 38.0 36.8 38.0 85-89 37.244499999999995 38.0 38.0 38.0 36.4 38.0 90-94 37.196799999999996 38.0 38.0 38.0 36.2 38.0 95-99 37.06345 38.0 38.0 38.0 36.0 38.0 100-104 36.9903 38.0 38.0 38.0 35.8 38.0 105-109 36.7795 38.0 38.0 38.0 35.0 38.0 110-114 36.80995 38.0 38.0 38.0 35.0 38.0 115-119 36.548 38.0 38.0 38.0 34.0 38.0 120-124 36.43755 38.0 38.0 38.0 34.0 38.0 125-129 36.2632 38.0 37.6 38.0 33.6 38.0 130-134 35.89375 38.0 36.4 38.0 32.6 38.0 135-139 35.8088 38.0 36.2 38.0 32.6 38.0 140-144 35.5828 38.0 36.0 38.0 32.2 38.0 145-149 35.15085 38.0 35.6 38.0 30.6 38.0 150-151 31.5915 36.5 31.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 2.0 17 1.0 18 1.0 19 5.0 20 1.0 21 2.0 22 4.0 23 4.0 24 2.0 25 6.0 26 11.0 27 5.0 28 9.0 29 14.0 30 22.0 31 17.0 32 43.0 33 55.0 34 94.0 35 192.0 36 744.0 37 2765.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.872561439067645 11.553078287306816 8.71548011147707 30.858880162148466 2 22.7 12.6 33.875 30.825000000000003 3 19.3 16.325 26.825 37.55 4 23.425 22.525000000000002 22.375 31.674999999999997 5 24.45 25.7 25.474999999999998 24.375 6 22.975 30.85 23.275000000000002 22.900000000000002 7 16.650000000000002 25.624999999999996 38.85 18.875 8 20.25 24.5 29.325000000000003 25.924999999999997 9 19.15 22.525000000000002 32.45 25.874999999999996 10-14 21.265 27.855 26.91 23.97 15-19 21.43 25.724999999999998 27.24 25.605 20-24 21.675 26.655 27.205000000000002 24.465 25-29 21.68 27.05 26.345000000000002 24.925 30-34 21.465 27.08 26.095000000000002 25.36 35-39 21.615000000000002 26.290000000000003 26.58 25.515 40-44 22.02 26.279999999999998 26.674999999999997 25.025 45-49 21.83 26.009999999999998 27.21 24.95 50-54 22.38 26.26 26.31 25.05 55-59 21.955 26.205000000000002 26.405 25.435000000000002 60-64 21.6 26.224999999999998 27.145000000000003 25.03 65-69 21.32 26.085 26.995 25.6 70-74 21.83 26.145000000000003 26.125 25.900000000000002 75-79 22.11 26.66 26.13 25.1 80-84 21.315 26.545 26.32 25.82 85-89 21.959999999999997 25.96 26.82 25.259999999999998 90-94 21.205 26.950000000000003 26.71 25.135 95-99 21.9 25.645 27.060000000000002 25.395 100-104 21.785 26.6 26.265 25.35 105-109 22.49 26.085 26.63 24.795 110-114 22.57 26.534999999999997 26.340000000000003 24.555 115-119 22.56 26.365 26.125 24.95 120-124 22.31 25.865 26.369999999999997 25.455 125-129 21.895 26.93 26.009999999999998 25.165 130-134 22.08 25.814999999999998 26.284999999999997 25.82 135-139 22.035 26.345000000000002 26.19 25.430000000000003 140-144 23.3 25.865 25.490000000000002 25.345000000000002 145-149 22.255 25.785000000000004 26.575 25.385 150-151 22.225 26.2125 25.8125 25.75 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 1.5 27 2.5 28 4.0 29 5.0 30 7.5 31 9.0 32 12.5 33 20.5 34 29.0 35 38.5 36 50.0 37 76.5 38 114.5 39 131.0 40 140.0 41 168.0 42 185.5 43 199.5 44 223.5 45 211.0 46 209.5 47 214.5 48 199.5 49 204.0 50 205.0 51 180.0 52 159.5 53 149.5 54 138.0 55 117.5 56 89.5 57 72.0 58 62.0 59 54.0 60 49.5 61 47.5 62 36.5 63 26.5 64 28.5 65 30.0 66 22.0 67 17.5 68 14.5 69 11.0 70 8.0 71 5.0 72 3.5 73 3.0 74 1.5 75 2.5 76 2.0 77 0.5 78 0.0 79 0.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.55 #Duplication Level Percentage of deduplicated Percentage of total 1 98.18042029728345 95.775 2 1.4351614556637622 2.8000000000000003 3 0.2562788313685289 0.75 4 0.05125576627370579 0.2 5 0.05125576627370579 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025627883136852894 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCGCAGGCTCCACGCCTGGTGGTGCCCTTCCGTCAATTCCTTTAAGTTT 9 0.22499999999999998 No Hit GTTACGACTTCTCCTTCCTCTAAATGATAAGGTTCAATGGACTTCTCGCG 5 0.125 No Hit GTCGCTATGAACGCTTGGCTGCCACAAGCCAGTTATCCCTGTGGTAACTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.07500000000000001 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.2875 0.0 0.0 0.0 0.0 114-115 0.325 0.0 0.0 0.0 0.0 116-117 0.325 0.0 0.0 0.0 0.0 118-119 0.35 0.0 0.0 0.0 0.0 120-121 0.3625 0.0 0.0 0.0 0.0 122-123 0.375 0.0 0.0 0.0 0.0 124-125 0.375 0.0 0.0 0.0 0.0 126-127 0.375 0.0 0.0 0.0 0.0 128-129 0.4 0.0 0.0 0.0 0.0 130-131 0.4 0.0 0.0 0.0 0.0 132-133 0.4 0.0 0.0 0.0 0.0 134-135 0.475 0.0 0.0 0.0 0.0 136-137 0.575 0.0 0.0 0.0 0.0 138-139 0.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATAAGA 10 0.006832588 144.9875 7 >>END_MODULE SRR6031158 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031158_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.09575 33.0 33.0 34.0 32.0 34.0 2 32.43675 34.0 33.0 34.0 32.0 34.0 3 32.47875 34.0 33.0 34.0 32.0 34.0 4 32.3945 34.0 33.0 34.0 32.0 34.0 5 32.525 34.0 33.0 34.0 33.0 34.0 6 36.6345 38.0 38.0 38.0 37.0 38.0 7 36.60025 38.0 38.0 38.0 37.0 38.0 8 36.6155 38.0 38.0 38.0 37.0 38.0 9 36.63525 38.0 38.0 38.0 37.0 38.0 10-14 36.62055 38.0 38.0 38.0 37.4 38.0 15-19 36.48225 38.0 38.0 38.0 37.0 38.0 20-24 36.426300000000005 38.0 38.0 38.0 37.0 38.0 25-29 36.515550000000005 38.0 38.0 38.0 37.0 38.0 30-34 36.7929 38.0 38.0 38.0 37.0 38.0 35-39 36.881299999999996 38.0 38.0 38.0 37.2 38.0 40-44 36.889149999999994 38.0 38.0 38.0 37.6 38.0 45-49 36.85314999999999 38.0 38.0 38.0 37.2 38.0 50-54 36.816449999999996 38.0 38.0 38.0 37.0 38.0 55-59 36.5614 38.0 38.0 38.0 36.8 38.0 60-64 36.659 38.0 38.0 38.0 37.0 38.0 65-69 36.53724999999999 38.0 38.0 38.0 36.0 38.0 70-74 36.3682 38.0 38.0 38.0 36.2 38.0 75-79 36.526250000000005 38.0 38.0 38.0 36.0 38.0 80-84 36.62555 38.0 38.0 38.0 36.0 38.0 85-89 36.52435 38.0 38.0 38.0 36.0 38.0 90-94 36.33425 38.0 38.0 38.0 35.2 38.0 95-99 36.3788 38.0 38.0 38.0 35.4 38.0 100-104 36.26819999999999 38.0 38.0 38.0 35.0 38.0 105-109 35.9845 38.0 38.0 38.0 34.6 38.0 110-114 35.75429999999999 38.0 38.0 38.0 34.0 38.0 115-119 35.573750000000004 38.0 38.0 38.0 33.4 38.0 120-124 35.60015 38.0 38.0 38.0 33.4 38.0 125-129 35.62515 38.0 38.0 38.0 33.0 38.0 130-134 35.4927 38.0 37.8 38.0 32.8 38.0 135-139 35.36355 38.0 38.0 38.0 32.0 38.0 140-144 35.0082 38.0 36.6 38.0 31.0 38.0 145-149 34.6472 38.0 36.0 38.0 29.8 38.0 150-151 30.938875 35.5 30.0 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 64.0 3 3.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 2.0 10 2.0 11 2.0 12 2.0 13 1.0 14 2.0 15 5.0 16 5.0 17 6.0 18 9.0 19 9.0 20 7.0 21 7.0 22 8.0 23 7.0 24 6.0 25 13.0 26 12.0 27 9.0 28 11.0 29 15.0 30 32.0 31 23.0 32 39.0 33 56.0 34 90.0 35 161.0 36 386.0 37 3005.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.48731227343345 21.077162092180217 11.574313827032626 27.861211807353705 2 26.767418032786882 29.43135245901639 24.56454918032787 19.236680327868854 3 23.218862121988725 27.268067657611482 28.113787801127625 21.39928241927217 4 27.49935749164739 30.609097918272937 20.43176561295297 21.459778977126703 5 27.887323943661972 32.01024327784891 20.998719590268884 19.10371318822023 6 23.329065300896286 36.41485275288092 20.486555697823302 19.769526248399487 7 23.11236242641413 21.167135909905298 33.1968262093678 22.523675454312773 8 25.287944714614795 23.880214998720245 23.777834655746098 27.054005630918866 9 23.983635898747124 23.548964459217594 27.767834313474815 24.69956532856047 10-14 25.534855154058754 26.773467089773774 23.676937250486233 24.014740505681235 15-19 25.448010269576383 25.694480102695767 25.637997432605903 23.219512195121954 20-24 25.557382102126784 26.11219562313778 25.475187506421452 22.855234768313984 25-29 25.56841458418681 26.269971323228187 24.933428922572716 23.22818517001229 30-34 25.462962962962965 25.844525844525844 25.524013024013026 23.168498168498168 35-39 25.455098625830335 26.25120429998479 24.83139800212971 23.46229907205517 40-44 25.95593821220562 26.37629779691061 24.588503418586985 23.079260572296782 45-49 25.471078555190708 26.31977772164688 25.223541298307655 22.98560242485476 50-54 24.269924964510242 26.500709795173393 25.730075035489758 23.499290204826607 55-59 25.421305280359512 25.814523542028393 25.947298539475028 22.816872638137063 60-64 25.785107141039344 25.62223240189342 25.505166183132282 23.087494273934954 65-69 25.914230416624225 26.40827136599776 24.64092900071305 23.03656921666497 70-74 25.501843506759524 25.80909463334699 25.419909873002865 23.26915198689062 75-79 25.146407292356265 25.849162295666346 25.630187910576975 23.374242501400417 80-84 25.625473843821077 25.494061157442506 25.873136214303766 23.00732878443265 85-89 25.598991172761664 26.254728877679696 25.19041614123581 22.955863808322825 90-94 25.489602261255804 26.261861498081974 25.499697153240458 22.748839087421764 95-99 25.10103051121439 26.646797332794502 25.737522731865027 22.514649424126084 100-104 25.23724942907891 26.333417914234964 26.140573458513067 22.288759198173054 105-109 26.164544664314565 25.310630464795214 26.15943140563481 22.365393465255405 110-114 25.171671620375115 26.201701342625803 25.750743056267293 22.875883980731782 115-119 25.927446251731745 26.302016522140693 25.46051618861922 22.31002103750834 120-124 26.066277999386315 25.887286488697963 25.21223279124476 22.834202720670962 125-129 25.466436828229565 27.098965727033058 25.040559724193876 22.3940377205435 130-134 25.475649760282614 25.803684077718902 26.17209184960888 22.548574312389604 135-139 25.1449019706668 26.616601985787007 25.87571190968197 22.36278413386422 140-144 26.109043355799216 25.822351876068804 25.862589276732724 22.206015491399256 145-149 25.537998495109104 26.260346124905944 25.788813644344117 22.412841735640832 150-151 24.90188631472338 27.130016457779465 25.699455627294594 22.268641600202557 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 32.0 1 16.0 2 0.5 3 0.5 4 1.5 5 2.0 6 0.5 7 0.0 8 1.0 9 2.5 10 2.0 11 1.0 12 2.0 13 3.0 14 2.5 15 3.5 16 5.0 17 3.0 18 1.5 19 1.0 20 2.0 21 3.5 22 2.0 23 2.0 24 2.0 25 0.5 26 2.0 27 4.5 28 5.5 29 6.5 30 6.5 31 11.0 32 15.0 33 26.0 34 33.5 35 36.0 36 44.0 37 66.0 38 89.5 39 112.0 40 141.5 41 163.5 42 169.0 43 178.5 44 202.0 45 211.0 46 201.0 47 206.0 48 203.5 49 163.0 50 155.0 51 153.0 52 124.5 53 121.5 54 118.5 55 96.5 56 86.0 57 83.0 58 79.0 59 68.0 60 58.0 61 51.5 62 52.0 63 51.0 64 42.5 65 46.0 66 52.5 67 43.5 68 34.5 69 28.5 70 17.5 71 18.0 72 16.5 73 7.0 74 5.0 75 6.5 76 5.0 77 2.5 78 1.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.45 2 2.4 3 2.45 4 2.725 5 2.375 6 2.375 7 2.325 8 2.325 9 2.225 10-14 2.31 15-19 2.625 20-24 2.67 25-29 2.36 30-34 1.72 35-39 1.395 40-44 1.275 45-49 1.0250000000000001 50-54 1.38 55-59 2.09 60-64 1.765 65-69 1.83 70-74 2.36 75-79 1.815 80-84 1.075 85-89 0.8750000000000001 90-94 0.9400000000000001 95-99 1.02 100-104 1.4749999999999999 105-109 2.215 110-114 2.4299999999999997 115-119 2.555 120-124 2.23 125-129 1.38 130-134 0.9249999999999999 135-139 0.795 140-144 0.59 145-149 0.325 150-151 1.2625000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.6 #Duplication Level Percentage of deduplicated Percentage of total 1 98.11076604554866 94.77499999999999 2 1.4751552795031055 2.85 3 0.2070393374741201 0.6 4 0.07763975155279502 0.3 5 0.025879917184265012 0.125 6 0.025879917184265012 0.15 7 0.025879917184265012 0.17500000000000002 8 0.025879917184265012 0.2 9 0.0 0.0 >10 0.025879917184265012 0.8250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 33 0.8250000000000001 No Hit GGCGGGACTACCCGCTGAGTTTAAGCATATAAATAAGCGGAGGAGAAGAA 8 0.2 No Hit GGAGTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCA 7 0.17500000000000002 No Hit CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 6 0.15 No Hit AAGGAGTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.07500000000000001 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.3 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.3125 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.3875 0.0 0.0 0.0 0.0 122-123 0.4 0.0 0.0 0.0 0.0 124-125 0.4 0.0 0.0 0.0 0.0 126-127 0.4 0.0 0.0 0.0 0.0 128-129 0.425 0.0 0.0 0.0 0.0 130-131 0.425 0.0 0.0 0.0 0.0 132-133 0.425 0.0 0.0 0.0 0.0 134-135 0.5125 0.0 0.0 0.0 0.0 136-137 0.625 0.0 0.0 0.0 0.0 138-139 0.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 739318 spots for SRR6031158.sra Written 739318 spots for SRR6031158.sra Read 739318 spots for SRR6031158.sra Written 739318 spots for SRR6031158.sra Read 739318 spots for SRR6031158.sra Written 739318 spots for SRR6031158.sra Read 739318 spots for SRR6031158.sra Written 739318 spots for SRR6031158.sra Read 739318 spots for SRR6031158.sra Written 739318 spots for SRR6031158.sra Read 739318 spots for SRR6031158.sra Written 739318 spots for SRR6031158.sra Read 739318 spots for SRR6031158.sra Written 739318 spots for SRR6031158.sra Read 739318 spots for SRR6031158.sra Written 739318 spots for SRR6031158.sra Read 739318 spots for SRR6031158.sra Written 739318 spots for SRR6031158.sra Read 739318 spots for SRR6031158.sra Written 739318 spots for SRR6031158.sra Read 739318 spots for SRR6031158.sra Written 739318 spots for SRR6031158.sra Read 739318 spots for SRR6031158.sra Written 739318 spots for SRR6031158.sra Read 739318 spots for SRR6031158.sra Written 739318 spots for SRR6031158.sra Read 739318 spots for SRR6031158.sra Written 739318 spots for SRR6031158.sra Read 739318 spots for SRR6031158.sra Written 739318 spots for SRR6031158.sra Read 739318 spots for SRR6031158.sra Written 739318 spots for SRR6031158.sra Read 739318 spots for SRR6031158.sra Written 739318 spots for SRR6031158.sra Read 739318 spots for SRR6031158.sra Written 739318 spots for SRR6031158.sra Read 739318 spots for SRR6031158.sra Written 739318 spots for SRR6031158.sra Read 739318 spots for SRR6031158.sra Written 739318 spots for SRR6031158.sra SRR ids: ['SRR6031158.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hpp103gv SRR6031158.sra spots: 14786360 blocks: [[1, 739318], [739319, 1478636], [1478637, 2217954], [2217955, 2957272], [2957273, 3696590], [3696591, 4435908], [4435909, 5175226], [5175227, 5914544], [5914545, 6653862], [6653863, 7393180], [7393181, 8132498], [8132499, 8871816], [8871817, 9611134], [9611135, 10350452], [10350453, 11089770], [11089771, 11829088], [11829089, 12568406], [12568407, 13307724], [13307725, 14047042], [14047043, 14786360]] SRR6031158 file size 4988911 SRR6031158 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031158 SRR6031158_1.fastq SRR6031158_2.fastq Input file: SRR6031158_1.fastq Paired file: SRR6031158_2.fastq trimmed: SRR6031158-trimmed-pair1.fastq, SRR6031158-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:19:42 2024 >> started Tue Dec 10 00:19:59 2024 >> done (16.785s) 14786360 read pairs processed; of these: 12791 ( 0.09%) short read pairs filtered out after trimming by size control 21552 ( 0.15%) empty read pairs filtered out after trimming by size control 14752017 (99.77%) read pairs available; of these: 4635366 (31.42%) trimmed read pairs available after processing 10116651 (68.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 4 0.00% 21 5 0.00% 22 5 0.00% 23 1 0.00% 24 1 0.00% 25 3 0.00% 26 6 0.00% 27 6 0.00% 28 8 0.00% 29 5 0.00% 30 6 0.00% 31 6 0.00% 32 4 0.00% 33 7 0.00% 34 3 0.00% 35 6 0.00% 36 3 0.00% 37 4 0.00% 38 8 0.00% 39 14 0.00% 40 6 0.00% 41 7 0.00% 42 5 0.00% 43 8 0.00% 44 6 0.00% 45 11 0.00% 46 12 0.00% 47 10 0.00% 48 9 0.00% 49 23 0.00% 50 16 0.00% 51 19 0.00% 52 24 0.00% 53 29 0.00% 54 31 0.00% 55 23 0.00% 56 43 0.00% 57 40 0.00% 58 41 0.00% 59 37 0.00% 60 52 0.00% 61 49 0.00% 62 46 0.00% 63 57 0.00% 64 60 0.00% 65 78 0.00% 66 93 0.00% 67 97 0.00% 68 113 0.00% 69 101 0.00% 70 123 0.00% 71 135 0.00% 72 175 0.00% 73 205 0.00% 74 186 0.00% 75 212 0.00% 76 250 0.00% 77 298 0.00% 78 345 0.00% 79 318 0.00% 80 383 0.00% 81 414 0.00% 82 462 0.00% 83 518 0.00% 84 1118 0.01% 85 1544 0.01% 86 1557 0.01% 87 1718 0.01% 88 2044 0.01% 89 1927 0.01% 90 1770 0.01% 91 1785 0.01% 92 1822 0.01% 93 1925 0.01% 94 1952 0.01% 95 1985 0.01% 96 1988 0.01% 97 1977 0.01% 98 2054 0.01% 99 2219 0.02% 100 2377 0.02% 101 2399 0.02% 102 2496 0.02% 103 2658 0.02% 104 2820 0.02% 105 3204 0.02% 106 3205 0.02% 107 3234 0.02% 108 3452 0.02% 109 3574 0.02% 110 3744 0.03% 111 4173 0.03% 112 4411 0.03% 113 5154 0.03% 114 5837 0.04% 115 6686 0.05% 116 6744 0.05% 117 6381 0.04% 118 6028 0.04% 119 5817 0.04% 120 6352 0.04% 121 6280 0.04% 122 6521 0.04% 123 7093 0.05% 124 7553 0.05% 125 7825 0.05% 126 8495 0.06% 127 8847 0.06% 128 9344 0.06% 129 10077 0.07% 130 10982 0.07% 131 11363 0.08% 132 12351 0.08% 133 13312 0.09% 134 14377 0.10% 135 15467 0.10% 136 16985 0.12% 137 18766 0.13% 138 20521 0.14% 139 22486 0.15% 140 25395 0.17% 141 27948 0.19% 142 31949 0.22% 143 37789 0.26% 144 45682 0.31% 145 56855 0.39% 146 76050 0.52% 147 110663 0.75% 148 188072 1.27% 149 460984 3.12% 150 3219920 21.83% 151 10116651 68.58% 14752017 reads passed initial QC criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=25 prefix-density=0.79 prefix-fanout=2.4 sequence=CCCAGCTCACGTTCCCTATTGGTGGGTGAACAATCCAACACTTGGTGAATTCTGCTTCACAATGATAGGAAGAGCCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCACAAGCCAGTTATCCCTGTGGTAACTTTTCTGACACCTCTAGCTTCAAACTCCGAAGATCTAAAGGATCGATAGGCCACGCTTTCACGGTTCGTATTCGTACTGGAAATCAGAATCAAACGAGCTTTTACCCTTTTGTTCCACACGAGATTTCTGTTCTCGTTGAGCTCATCTTAGGACACCTGCGTTATCTTTTAACAGATGTGCCGCCCCAGCCAAACTCCCCACCTGACAATGTCTTCCGCCCGGATCGGCCCGGTCAGACCGGGCCTTGGAGCCAAAAGGAGGGGACTTGCCCCGCTTCCGACCCACGGAATAAGTAAAATAACGTTAAAAGTAGTGGTATTTCACTTGCGCCCGTAAAGGCTCCCACTTATCCTACACCTCTC criterion=fanout-score sequence-density=0.06 sequence-density-rank=13 fanout-score=115.71 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=22.3 sequence=ATCTTCTTCTTGTCGTCCGC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=31.94 fanout-score-rank=5 prefix-density=0.43 prefix-fanout=12.6 sequence=AGGAAGAAGAAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=619.82 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=19.7 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR6031158 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:21:04 Started mapping on | Dec 10 00:21:04 Finished on | Dec 10 00:22:56 Mapping speed, Million of reads per hour | 474.17 Number of input reads | 14752017 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 12288568 Uniquely mapped reads % | 83.30% Average mapped length | 299.48 Number of splices: Total | 14258873 Number of splices: Annotated (sjdb) | 13595246 Number of splices: GT/AG | 14072059 Number of splices: GC/AG | 166890 Number of splices: AT/AC | 10379 Number of splices: Non-canonical | 9545 Mismatch rate per base, % | 0.09% Deletion rate per base | 0.00% Deletion average length | 1.41 Insertion rate per base | 0.00% Insertion average length | 1.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 130506 % of reads mapped to multiple loci | 0.88% Number of reads mapped to too many loci | 184896 % of reads mapped to too many loci | 1.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.73% % of reads unmapped: other | 10.83% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2340881 2340881 2340881 N_multimapping 130506 130506 130506 N_noFeature 468684 11960371 555047 N_ambiguous 289268 2467 47697 UnstrandedReadsAssigned:11530616 PositiveStrandReadsAssigned:325730 NegativeStrandReadsAssigned:11685824 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6031158 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6031158-trimmed-pair1.fastq SRR6031158-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,752,017 reads, 11,807,341 reads pseudoaligned [quant] estimated average fragment length: 432.937 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,081 rounds 52973 SRR6031158.ke.tsv 35125 SRR6031158.se.tsv 88098 total ==> SRR6031158.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 505.141 0 0 PNS24247 1044 612.063 81.6122 16.1747 PNS24249 1928 1496.06 26.9292 2.1835 PNS24246 1044 612.063 81.6122 16.1747 PNS24248 1044 612.063 81.6122 16.1747 PNS24244 1471 1039.06 61.2342 7.14876 PNS24243 293 62.0173 0 0 KQK14069 1603 1171.06 3223.41 333.898 KQK14071 474 131.025 3.77239 3.49254 ==> SRR6031158.se.tsv <== BRADI_1g14170v3 3299 BRADI_1g53295v3 49 BRADI_1g59795v3 350 BRADI_1g07683v3 0 BRADI_1g00485v3 49 BRADI_1g20270v3 599 BRADI_1g74790v3 163 BRADI_1g09890v3 0 BRADI_1g77505v3 141 BRADI_1g48960v3 0 SRR6031158 completed mapping pipeline successfully