Starting /dee2/code/volunteer_pipeline.sh SRR6031159 current disk space = 1523568599040 free memory = 1570057956 SRR6031159 SRAfilesize 367f4122ce9a951235484b93d6fb67fa SRR6031159.sra SRR6031159.sra file validated SRR6031159 is paired end SRR6031159 is conventional basespace SRR6031159 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031159_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.07375 30.0 18.0 33.0 18.0 33.0 2 24.38075 25.0 18.0 30.0 18.0 33.0 3 29.07025 29.0 27.0 31.0 25.0 33.0 4 31.89775 33.0 31.0 33.0 30.0 33.0 5 32.79075 33.0 33.0 33.0 32.0 33.0 6 37.42425 38.0 38.0 38.0 36.0 38.0 7 37.55975 38.0 38.0 38.0 37.0 38.0 8 37.7465 38.0 38.0 38.0 38.0 38.0 9 37.76425 38.0 38.0 38.0 38.0 38.0 10-14 37.81625 38.0 38.0 38.0 38.0 38.0 15-19 37.84075 38.0 38.0 38.0 38.0 38.0 20-24 37.86155 38.0 38.0 38.0 38.0 38.0 25-29 37.8442 38.0 38.0 38.0 38.0 38.0 30-34 37.8489 38.0 38.0 38.0 38.0 38.0 35-39 37.84915 38.0 38.0 38.0 38.0 38.0 40-44 37.844049999999996 38.0 38.0 38.0 38.0 38.0 45-49 37.829049999999995 38.0 38.0 38.0 38.0 38.0 50-54 37.8281 38.0 38.0 38.0 38.0 38.0 55-59 37.754900000000006 38.0 38.0 38.0 38.0 38.0 60-64 37.73745 38.0 38.0 38.0 38.0 38.0 65-69 37.735400000000006 38.0 38.0 38.0 38.0 38.0 70-74 37.7257 38.0 38.0 38.0 38.0 38.0 75-79 37.689550000000004 38.0 38.0 38.0 38.0 38.0 80-84 37.660700000000006 38.0 38.0 38.0 38.0 38.0 85-89 37.672450000000005 38.0 38.0 38.0 38.0 38.0 90-94 37.63615 38.0 38.0 38.0 38.0 38.0 95-99 37.58835 38.0 38.0 38.0 38.0 38.0 100-104 37.552550000000004 38.0 38.0 38.0 38.0 38.0 105-109 37.5031 38.0 38.0 38.0 38.0 38.0 110-114 37.4619 38.0 38.0 38.0 37.6 38.0 115-119 37.42515 38.0 38.0 38.0 37.0 38.0 120-124 37.36045 38.0 38.0 38.0 36.8 38.0 125-129 37.2999 38.0 38.0 38.0 36.0 38.0 130-134 37.1391 38.0 38.0 38.0 35.8 38.0 135-139 37.16315 38.0 38.0 38.0 36.0 38.0 140-144 36.98335 38.0 38.0 38.0 35.2 38.0 145-149 36.70795 38.0 38.0 38.0 35.0 38.0 150-151 34.873125 38.0 36.0 38.0 29.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 1.0 19 0.0 20 0.0 21 0.0 22 1.0 23 0.0 24 2.0 25 2.0 26 3.0 27 7.0 28 4.0 29 7.0 30 7.0 31 8.0 32 17.0 33 25.0 34 42.0 35 75.0 36 323.0 37 3475.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.434826119589694 13.41005754315737 9.181886414811109 30.97322992244183 2 23.65 15.35 34.4 26.6 3 19.575 20.599999999999998 27.925 31.900000000000002 4 22.35 25.7 24.05 27.900000000000002 5 24.3 29.95 23.75 22.0 6 23.67959949937422 31.1639549436796 23.92991239048811 21.226533166458072 7 17.2 25.650000000000002 37.775 19.375 8 19.625 25.224999999999998 27.474999999999998 27.675 9 19.375 23.325000000000003 32.7 24.6 10-14 21.695 27.189999999999998 26.505000000000003 24.610000000000003 15-19 21.7 25.924999999999997 27.450000000000003 24.925 20-24 21.75 26.865 26.515 24.87 25-29 21.595 26.08 27.084999999999997 25.240000000000002 30-34 21.81 26.655 26.245 25.290000000000003 35-39 22.165000000000003 26.724999999999998 25.655 25.455 40-44 21.92 26.729999999999997 26.915 24.435000000000002 45-49 22.259999999999998 26.275 26.200000000000003 25.264999999999997 50-54 21.695 26.419999999999998 26.91 24.975 55-59 21.990000000000002 26.72 26.700000000000003 24.59 60-64 22.085 26.889999999999997 26.55 24.474999999999998 65-69 22.525000000000002 26.240000000000002 26.6 24.635 70-74 21.365000000000002 26.68 26.400000000000002 25.555 75-79 22.295 25.83 26.35 25.525 80-84 21.92 26.200000000000003 26.640000000000004 25.240000000000002 85-89 22.32 26.365 26.08 25.235000000000003 90-94 22.15 25.94 26.61 25.3 95-99 22.15 26.334999999999997 26.655 24.86 100-104 22.525000000000002 26.56 25.979999999999997 24.935 105-109 22.775000000000002 26.119999999999997 26.009999999999998 25.095 110-114 21.790000000000003 26.41 26.44 25.36 115-119 22.865 26.085 26.115 24.935 120-124 21.92 26.029999999999998 26.685 25.365 125-129 22.255 25.759999999999998 26.265 25.72 130-134 22.595000000000002 26.125 25.705 25.575 135-139 22.16 26.215 26.115 25.509999999999998 140-144 22.23 25.995 26.119999999999997 25.655 145-149 23.0 25.319999999999997 26.650000000000002 25.03 150-151 22.46530816352044 26.090761345168147 26.990873859232405 24.453056632079008 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.0 27 3.0 28 4.0 29 4.0 30 6.5 31 11.0 32 17.5 33 22.5 34 31.5 35 36.0 36 52.0 37 72.5 38 97.0 39 120.5 40 141.5 41 169.5 42 184.5 43 209.0 44 233.5 45 238.5 46 245.5 47 237.5 48 214.0 49 195.0 50 195.5 51 180.0 52 143.5 53 127.0 54 117.5 55 99.0 56 82.5 57 75.0 58 64.0 59 55.5 60 51.5 61 46.0 62 33.0 63 29.5 64 25.5 65 19.0 66 18.5 67 19.0 68 18.0 69 14.0 70 8.0 71 5.0 72 6.5 73 7.0 74 4.5 75 2.5 76 2.0 77 1.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.125 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57286432160805 99.075 2 0.37688442211055273 0.75 3 0.02512562814070352 0.075 4 0.02512562814070352 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.16249999999999998 0.0 0.0 0.0 0.0 114-115 0.175 0.0 0.0 0.0 0.0 116-117 0.2 0.0 0.0 0.0 0.0 118-119 0.225 0.0 0.0 0.0 0.0 120-121 0.25 0.0 0.0 0.0 0.0 122-123 0.25 0.0 0.0 0.0 0.0 124-125 0.2625 0.0 0.0 0.0 0.0 126-127 0.3 0.0 0.0 0.0 0.0 128-129 0.3 0.0 0.0 0.0 0.0 130-131 0.3 0.0 0.0 0.0 0.0 132-133 0.3375 0.0 0.0 0.0 0.0 134-135 0.35 0.0 0.0 0.0 0.0 136-137 0.35 0.0 0.0 0.0 0.0 138-139 0.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGAGGA 10 0.006830828 145.0 145 >>END_MODULE SRR6031159 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031159_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2155 34.0 33.0 34.0 33.0 34.0 2 33.405 34.0 33.0 34.0 33.0 34.0 3 33.473 34.0 33.0 34.0 33.0 34.0 4 33.4095 34.0 33.0 34.0 33.0 34.0 5 33.4475 34.0 33.0 34.0 33.0 34.0 6 37.68 38.0 38.0 38.0 38.0 38.0 7 37.1195 38.0 38.0 38.0 37.0 38.0 8 37.54675 38.0 38.0 38.0 38.0 38.0 9 37.615 38.0 38.0 38.0 38.0 38.0 10-14 37.6331 38.0 38.0 38.0 38.0 38.0 15-19 37.59045 38.0 38.0 38.0 38.0 38.0 20-24 37.52184999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.6238 38.0 38.0 38.0 38.0 38.0 30-34 37.68615 38.0 38.0 38.0 38.0 38.0 35-39 37.699149999999996 38.0 38.0 38.0 38.0 38.0 40-44 37.68175 38.0 38.0 38.0 38.0 38.0 45-49 37.6756 38.0 38.0 38.0 38.0 38.0 50-54 37.6634 38.0 38.0 38.0 38.0 38.0 55-59 37.64295 38.0 38.0 38.0 38.0 38.0 60-64 37.65395 38.0 38.0 38.0 38.0 38.0 65-69 37.61725 38.0 38.0 38.0 38.0 38.0 70-74 37.50665 38.0 38.0 38.0 38.0 38.0 75-79 37.572199999999995 38.0 38.0 38.0 38.0 38.0 80-84 37.57365 38.0 38.0 38.0 38.0 38.0 85-89 37.5347 38.0 38.0 38.0 38.0 38.0 90-94 37.4651 38.0 38.0 38.0 38.0 38.0 95-99 37.456 38.0 38.0 38.0 38.0 38.0 100-104 37.38255 38.0 38.0 38.0 38.0 38.0 105-109 37.28605 38.0 38.0 38.0 37.8 38.0 110-114 37.18675 38.0 38.0 38.0 37.2 38.0 115-119 37.1075 38.0 38.0 38.0 37.0 38.0 120-124 37.133449999999996 38.0 38.0 38.0 36.2 38.0 125-129 37.13465 38.0 38.0 38.0 36.2 38.0 130-134 37.05884999999999 38.0 38.0 38.0 36.0 38.0 135-139 36.984100000000005 38.0 38.0 38.0 36.0 38.0 140-144 36.86165 38.0 38.0 38.0 35.4 38.0 145-149 36.71425000000001 38.0 38.0 38.0 35.0 38.0 150-151 34.71925 38.0 36.0 38.0 29.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 0.0 13 1.0 14 1.0 15 0.0 16 1.0 17 0.0 18 2.0 19 3.0 20 1.0 21 0.0 22 1.0 23 4.0 24 7.0 25 5.0 26 5.0 27 10.0 28 10.0 29 9.0 30 9.0 31 13.0 32 22.0 33 31.0 34 40.0 35 76.0 36 222.0 37 3521.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.725 21.375 11.525 25.374999999999996 2 28.349999999999998 27.35 25.324999999999996 18.975 3 22.005501375343837 27.956989247311824 28.907226806701676 21.13028257064266 4 26.194645984488368 32.04903677758319 20.515386539904927 21.240930698023515 5 26.063031515757878 34.19209604802401 19.809904952476238 19.93496748374187 6 23.63090772693173 35.75893973493373 20.705176294073517 19.904976244061015 7 21.95 21.15 34.5 22.400000000000002 8 23.54854854854855 24.474474474474476 23.323323323323322 28.653653653653656 9 24.44944944944945 23.973973973973976 26.55155155155155 25.025025025025027 10-14 26.07695001751138 26.55225896832941 24.140691449442137 23.230099564717065 15-19 25.033795624092527 26.225404295799333 25.27912682120863 23.461673258899516 20-24 25.40884920236781 26.361994582121 25.04264071435738 23.186515501153806 25-29 25.168876657493122 26.229672254190646 25.31898924193145 23.282461846384788 30-34 25.324999999999996 27.134999999999998 24.95 22.59 35-39 25.235000000000003 26.455000000000002 25.290000000000003 23.02 40-44 25.41 26.13 25.105 23.355 45-49 25.66 26.115 25.025 23.200000000000003 50-54 25.27 26.229999999999997 25.25 23.25 55-59 25.67128356417821 26.32131606580329 24.866243312165608 23.141157057852894 60-64 25.474999999999998 26.06 25.14 23.325000000000003 65-69 25.64 26.27 25.22 22.869999999999997 70-74 25.7235853780671 26.39959939909865 25.037556334501755 22.8392588883325 75-79 25.585 26.384999999999998 25.465 22.564999999999998 80-84 25.28 26.505000000000003 24.98 23.235 85-89 25.924999999999997 25.945 25.330000000000002 22.8 90-94 26.06 26.075 25.580000000000002 22.285 95-99 26.145000000000003 26.029999999999998 25.1 22.725 100-104 25.185000000000002 26.75 25.135 22.93 105-109 25.469948368339264 26.23189132287333 25.921098801944957 22.37706150684245 110-114 24.83302365289007 26.25922764023502 25.3251644654246 23.58258424145031 115-119 25.417607223476296 25.798846250313517 25.407574617506896 23.375971908703285 120-124 25.764476252439817 25.889595115359594 25.72443821630549 22.621490415895103 125-129 25.540000000000003 26.605 24.925 22.93 130-134 26.155 25.86 25.4 22.585 135-139 25.465 26.135 25.805 22.595000000000002 140-144 25.55 26.584999999999997 25.380000000000003 22.485 145-149 25.53 26.314999999999998 25.474999999999998 22.68 150-151 25.15 26.724999999999998 25.8 22.325 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.5 29 2.0 30 7.0 31 11.0 32 14.5 33 18.0 34 23.5 35 33.0 36 49.0 37 68.0 38 87.0 39 117.5 40 140.0 41 157.0 42 182.0 43 208.5 44 226.0 45 222.0 46 205.0 47 197.5 48 199.5 49 187.5 50 166.5 51 154.5 52 139.5 53 122.5 54 108.5 55 87.5 56 85.5 57 78.5 58 66.5 59 66.0 60 70.5 61 65.0 62 45.0 63 53.5 64 64.0 65 53.0 66 44.0 67 39.5 68 40.0 69 32.5 70 16.5 71 13.0 72 9.0 73 3.5 74 5.5 75 5.0 76 2.5 77 1.5 78 1.0 79 1.5 80 0.5 81 0.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.025 4 0.075 5 0.05 6 0.025 7 0.0 8 0.1 9 0.1 10-14 0.065 15-19 0.135 20-24 0.33 25-29 0.075 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.0 70-74 0.15 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.255 110-114 0.43499999999999994 115-119 0.325 120-124 0.095 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11526794742164 98.02499999999999 2 0.7330637007077857 1.4500000000000002 3 0.10111223458038424 0.3 4 0.02527805864509606 0.1 5 0.02527805864509606 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.16249999999999998 0.0 0.0 0.0 0.0 114-115 0.175 0.0 0.0 0.0 0.0 116-117 0.2 0.0 0.0 0.0 0.0 118-119 0.225 0.0 0.0 0.0 0.0 120-121 0.25 0.0 0.0 0.0 0.0 122-123 0.25 0.0 0.0 0.0 0.0 124-125 0.2625 0.0 0.0 0.0 0.0 126-127 0.3 0.0 0.0 0.0 0.0 128-129 0.3 0.0 0.0 0.0 0.0 130-131 0.3 0.0 0.0 0.0 0.0 132-133 0.3375 0.0 0.0 0.0 0.0 134-135 0.35 0.0 0.0 0.0 0.0 136-137 0.35 0.0 0.0 0.0 0.0 138-139 0.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGGTGC 10 0.0068449317 144.90001 5 TGACATG 10 0.0068449317 144.90001 4 CTGACAT 10 0.0068449317 144.90001 3 CATGCGT 10 0.0068449317 144.90001 7 >>END_MODULE Read 336045 spots for SRR6031159.sra Written 336045 spots for SRR6031159.sra Read 336045 spots for SRR6031159.sra Written 336045 spots for SRR6031159.sra Read 336045 spots for SRR6031159.sra Written 336045 spots for SRR6031159.sra Read 336045 spots for SRR6031159.sra Written 336045 spots for SRR6031159.sra Read 336045 spots for SRR6031159.sra Written 336045 spots for SRR6031159.sra Read 336045 spots for SRR6031159.sra Written 336045 spots for SRR6031159.sra Read 336045 spots for SRR6031159.sra Written 336045 spots for SRR6031159.sra Read 336045 spots for SRR6031159.sra Written 336045 spots for SRR6031159.sra Read 336045 spots for SRR6031159.sra Written 336045 spots for SRR6031159.sra Read 336045 spots for SRR6031159.sra Written 336045 spots for SRR6031159.sra Read 336045 spots for SRR6031159.sra Written 336045 spots for SRR6031159.sra Read 336045 spots for SRR6031159.sra Written 336045 spots for SRR6031159.sra Read 336045 spots for SRR6031159.sra Written 336045 spots for SRR6031159.sra Read 336045 spots for SRR6031159.sra Written 336045 spots for SRR6031159.sra Read 336045 spots for SRR6031159.sra Written 336045 spots for SRR6031159.sra Read 336045 spots for SRR6031159.sra Written 336045 spots for SRR6031159.sra Read 336045 spots for SRR6031159.sra Written 336045 spots for SRR6031159.sra Read 336057 spots for SRR6031159.sra Written 336057 spots for SRR6031159.sra Read 336045 spots for SRR6031159.sra Written 336045 spots for SRR6031159.sra Read 336045 spots for SRR6031159.sra Written 336045 spots for SRR6031159.sra SRR ids: ['SRR6031159.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_475b81pe SRR6031159.sra spots: 6720912 blocks: [[1, 336045], [336046, 672090], [672091, 1008135], [1008136, 1344180], [1344181, 1680225], [1680226, 2016270], [2016271, 2352315], [2352316, 2688360], [2688361, 3024405], [3024406, 3360450], [3360451, 3696495], [3696496, 4032540], [4032541, 4368585], [4368586, 4704630], [4704631, 5040675], [5040676, 5376720], [5376721, 5712765], [5712766, 6048810], [6048811, 6384855], [6384856, 6720912]] SRR6031159 file size 2262200 SRR6031159 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031159 SRR6031159_1.fastq SRR6031159_2.fastq Input file: SRR6031159_1.fastq Paired file: SRR6031159_2.fastq trimmed: SRR6031159-trimmed-pair1.fastq, SRR6031159-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:20:16 2024 >> started Tue Dec 10 00:20:24 2024 >> done (8.642s) 6720912 read pairs processed; of these: 3191 ( 0.05%) short read pairs filtered out after trimming by size control 2484 ( 0.04%) empty read pairs filtered out after trimming by size control 6715237 (99.92%) read pairs available; of these: 1344044 (20.01%) trimmed read pairs available after processing 5371193 (79.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 3 0.00% 21 5 0.00% 22 2 0.00% 23 3 0.00% 24 2 0.00% 25 3 0.00% 26 2 0.00% 27 2 0.00% 28 2 0.00% 29 6 0.00% 30 1 0.00% 31 5 0.00% 32 5 0.00% 33 2 0.00% 34 3 0.00% 35 3 0.00% 36 2 0.00% 37 4 0.00% 38 4 0.00% 39 3 0.00% 40 3 0.00% 41 4 0.00% 42 3 0.00% 43 6 0.00% 44 3 0.00% 45 4 0.00% 46 3 0.00% 47 4 0.00% 48 5 0.00% 49 9 0.00% 50 4 0.00% 51 4 0.00% 52 6 0.00% 53 11 0.00% 54 4 0.00% 55 7 0.00% 56 10 0.00% 57 13 0.00% 58 17 0.00% 59 13 0.00% 60 18 0.00% 61 18 0.00% 62 23 0.00% 63 19 0.00% 64 25 0.00% 65 16 0.00% 66 24 0.00% 67 25 0.00% 68 44 0.00% 69 41 0.00% 70 40 0.00% 71 45 0.00% 72 55 0.00% 73 52 0.00% 74 54 0.00% 75 64 0.00% 76 61 0.00% 77 97 0.00% 78 78 0.00% 79 107 0.00% 80 98 0.00% 81 124 0.00% 82 152 0.00% 83 147 0.00% 84 280 0.00% 85 370 0.01% 86 431 0.01% 87 442 0.01% 88 487 0.01% 89 469 0.01% 90 511 0.01% 91 477 0.01% 92 499 0.01% 93 534 0.01% 94 518 0.01% 95 607 0.01% 96 550 0.01% 97 611 0.01% 98 607 0.01% 99 687 0.01% 100 730 0.01% 101 685 0.01% 102 745 0.01% 103 760 0.01% 104 882 0.01% 105 909 0.01% 106 920 0.01% 107 1007 0.01% 108 984 0.01% 109 1045 0.02% 110 1104 0.02% 111 1197 0.02% 112 1248 0.02% 113 1260 0.02% 114 1332 0.02% 115 1413 0.02% 116 1480 0.02% 117 1498 0.02% 118 1668 0.02% 119 1703 0.03% 120 1890 0.03% 121 1916 0.03% 122 2187 0.03% 123 2236 0.03% 124 2244 0.03% 125 2372 0.04% 126 2427 0.04% 127 2668 0.04% 128 2705 0.04% 129 2856 0.04% 130 3148 0.05% 131 3152 0.05% 132 3620 0.05% 133 3826 0.06% 134 3944 0.06% 135 4427 0.07% 136 4741 0.07% 137 5191 0.08% 138 5528 0.08% 139 6217 0.09% 140 6887 0.10% 141 7597 0.11% 142 8521 0.13% 143 10003 0.15% 144 11836 0.18% 145 15228 0.23% 146 19939 0.30% 147 28659 0.43% 148 48379 0.72% 149 109024 1.62% 150 978400 14.57% 151 5371193 79.99% 6715237 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.47 fanout-score-rank=29 prefix-density=0.50 prefix-fanout=2.4 sequence=CCCAGCTCACGTTCCCTATTGGTGGGTGAACAATCCAACACTTGGTGAATTCTGCTTCACAATGATAGGAAGAGCCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCACAAGCCAGTTATCCCTGTGGTAACTTTTCTGACACCTCTAGCTTCAAACTCCGAAGATCTAAAGGATCGATAGGCCACGCTTTCACGGTTCGTATTCGTACTGGAAATCAGAATCAAACGAGCTTTTACCCTTTTGTTCCACACGAGATTTCTGTTCTCGTTGAGCTCATCTTAGGACACCTGCGTTATCTTTTAACAGATGTGCCGCCCCAGCCAAACTCCCCACCTGACAATGTCTTCCGCCCGGATCGGCCCGGTCAGACCGGGCCTTGGAGCCAAAAGGAGGGGACTTGCCCCGCTTCCGACCCACGGAATAAGTAAAATAACGTTAAAAGTAGTGGTATTTCACTTGCGCCCGTAAAGGCTCCCACTTATCCTACACCTCTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=14 fanout-score=295.63 fanout-score-rank=1 prefix-density=0.69 prefix-fanout=30.2 sequence=CTTCTTCTTGAT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=4.92 fanout-score-rank=22 prefix-density=0.33 prefix-fanout=3.9 sequence=GGCAAGACCATCAC criterion=fanout-score sequence-density=0.04 sequence-density-rank=33 fanout-score=259.69 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=17.7 sequence=CCGCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR6031159 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:21:12 Started mapping on | Dec 10 00:21:12 Finished on | Dec 10 00:21:46 Mapping speed, Million of reads per hour | 711.03 Number of input reads | 6715237 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 6071829 Uniquely mapped reads % | 90.42% Average mapped length | 300.30 Number of splices: Total | 7021696 Number of splices: Annotated (sjdb) | 6685110 Number of splices: GT/AG | 6932446 Number of splices: GC/AG | 80598 Number of splices: AT/AC | 4837 Number of splices: Non-canonical | 3815 Mismatch rate per base, % | 0.06% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 66989 % of reads mapped to multiple loci | 1.00% Number of reads mapped to too many loci | 39662 % of reads mapped to too many loci | 0.59% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.70% % of reads unmapped: other | 5.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 579341 579341 579341 N_multimapping 66989 66989 66989 N_noFeature 200948 5911303 242925 N_ambiguous 141407 1329 22924 UnstrandedReadsAssigned:5729474 PositiveStrandReadsAssigned:159197 NegativeStrandReadsAssigned:5805980 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6031159 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6031159-trimmed-pair1.fastq SRR6031159-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,715,237 reads, 5,852,639 reads pseudoaligned [quant] estimated average fragment length: 461.472 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,158 rounds 52973 SRR6031159.ke.tsv 35125 SRR6031159.se.tsv 88098 total ==> SRR6031159.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 477.425 0 0 PNS24247 1044 583.528 39.2634 16.3866 PNS24249 1928 1467.53 10.3195 1.71252 PNS24246 1044 583.528 39.2634 16.3866 PNS24248 1044 583.528 39.2634 16.3866 PNS24244 1471 1010.53 16.8903 4.07053 PNS24243 293 61.1444 0 0 KQK14069 1603 1142.53 836.439 178.291 KQK14071 474 122.564 0 0 ==> SRR6031159.se.tsv <== BRADI_1g14170v3 886 BRADI_1g53295v3 33 BRADI_1g59795v3 138 BRADI_1g07683v3 0 BRADI_1g00485v3 16 BRADI_1g20270v3 237 BRADI_1g74790v3 58 BRADI_1g09890v3 0 BRADI_1g77505v3 45 BRADI_1g48960v3 0 SRR6031159 completed mapping pipeline successfully