Starting /dee2/code/volunteer_pipeline.sh SRR6031162 current disk space = 1523525390336 free memory = 1559568196 SRR6031162 SRAfilesize 58423f9f2ed7a5aa7738a71dbb8b6be2 SRR6031162.sra SRR6031162.sra file validated SRR6031162 is paired end SRR6031162 is conventional basespace SRR6031162 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031162_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.209 32.0 27.0 33.0 18.0 33.0 2 31.69375 33.0 31.0 33.0 29.0 33.0 3 31.62325 33.0 31.0 33.0 29.0 33.0 4 31.93325 33.0 32.0 33.0 31.0 33.0 5 32.8905 33.0 33.0 33.0 33.0 34.0 6 37.1085 38.0 38.0 38.0 36.0 38.0 7 37.60575 38.0 38.0 38.0 37.0 38.0 8 37.6975 38.0 38.0 38.0 38.0 38.0 9 37.82475 38.0 38.0 38.0 38.0 38.0 10-14 37.82585 38.0 38.0 38.0 38.0 38.0 15-19 37.876250000000006 38.0 38.0 38.0 38.0 38.0 20-24 37.8366 38.0 38.0 38.0 38.0 38.0 25-29 37.83045 38.0 38.0 38.0 38.0 38.0 30-34 37.8396 38.0 38.0 38.0 38.0 38.0 35-39 37.82905 38.0 38.0 38.0 38.0 38.0 40-44 37.8153 38.0 38.0 38.0 38.0 38.0 45-49 37.7943 38.0 38.0 38.0 38.0 38.0 50-54 37.7571 38.0 38.0 38.0 38.0 38.0 55-59 37.72965 38.0 38.0 38.0 38.0 38.0 60-64 37.702200000000005 38.0 38.0 38.0 38.0 38.0 65-69 37.6558 38.0 38.0 38.0 38.0 38.0 70-74 37.64235 38.0 38.0 38.0 38.0 38.0 75-79 37.6444 38.0 38.0 38.0 38.0 38.0 80-84 37.62895000000001 38.0 38.0 38.0 38.0 38.0 85-89 37.589549999999996 38.0 38.0 38.0 38.0 38.0 90-94 37.56045 38.0 38.0 38.0 38.0 38.0 95-99 37.521100000000004 38.0 38.0 38.0 38.0 38.0 100-104 37.46395 38.0 38.0 38.0 37.8 38.0 105-109 37.46035 38.0 38.0 38.0 37.6 38.0 110-114 37.44565 38.0 38.0 38.0 37.8 38.0 115-119 37.367149999999995 38.0 38.0 38.0 37.2 38.0 120-124 37.21955 38.0 38.0 38.0 36.4 38.0 125-129 37.14405 38.0 38.0 38.0 36.0 38.0 130-134 37.059900000000006 38.0 38.0 38.0 35.8 38.0 135-139 37.0553 38.0 38.0 38.0 36.0 38.0 140-144 36.83735 38.0 38.0 38.0 35.0 38.0 145-149 36.61125 38.0 38.0 38.0 35.0 38.0 150-151 34.6425 38.0 36.0 38.0 29.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 0.0 18 1.0 19 3.0 20 1.0 21 0.0 22 1.0 23 2.0 24 2.0 25 3.0 26 1.0 27 5.0 28 5.0 29 7.0 30 16.0 31 12.0 32 20.0 33 31.0 34 45.0 35 80.0 36 272.0 37 3491.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.89669007021063 12.487462387161484 7.3219658976930795 31.293881644934807 2 21.8 13.450000000000001 34.575 30.175 3 20.075000000000003 19.225 27.250000000000004 33.45 4 24.125 24.4 23.0 28.475 5 25.025 28.225 23.625 23.125 6 23.25346784363178 32.232030264817155 21.89155107187894 22.62295081967213 7 16.775000000000002 24.65 40.275 18.3 8 20.474999999999998 25.124999999999996 27.675 26.724999999999998 9 18.8 22.8 33.025 25.374999999999996 10-14 21.51 27.334999999999997 26.595000000000002 24.560000000000002 15-19 21.985 26.185000000000002 26.979999999999997 24.85 20-24 22.1 26.33 26.91 24.66 25-29 21.965 26.77 26.724999999999998 24.54 30-34 21.855 26.275 26.995 24.875 35-39 21.785 26.015 26.82 25.380000000000003 40-44 21.925 26.445 26.755000000000003 24.875 45-49 22.125 26.619999999999997 26.525 24.73 50-54 21.945 26.57 26.32 25.165 55-59 22.005 26.255 26.275 25.465 60-64 22.105 26.400000000000002 26.255 25.240000000000002 65-69 22.36 26.13 26.805 24.705 70-74 22.18 26.355 26.295 25.169999999999998 75-79 22.75 26.119999999999997 25.595000000000002 25.535000000000004 80-84 22.065 26.479999999999997 26.515 24.94 85-89 21.985 26.085 26.484999999999996 25.445 90-94 21.785 26.805 26.14 25.27 95-99 21.884999999999998 26.384999999999998 26.325 25.405 100-104 22.2 25.840000000000003 26.665 25.295 105-109 22.009999999999998 26.355 26.02 25.615 110-114 22.17 25.745 26.61 25.474999999999998 115-119 22.275 26.075 26.650000000000002 25.0 120-124 22.185 26.665 26.14 25.009999999999998 125-129 22.095000000000002 25.915 26.365 25.624999999999996 130-134 22.73 26.19 25.97 25.11 135-139 21.93 25.755 26.755000000000003 25.56 140-144 22.03 26.43 26.375 25.165 145-149 21.975 26.05 26.724999999999998 25.25 150-151 21.915239404925615 25.740717589698715 27.50343792974122 24.840605075634453 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 2.0 27 2.5 28 2.5 29 4.5 30 7.0 31 10.5 32 13.5 33 19.0 34 29.5 35 38.5 36 52.0 37 70.0 38 83.0 39 104.5 40 133.0 41 172.0 42 197.5 43 218.0 44 232.0 45 231.0 46 240.0 47 245.0 48 228.5 49 209.0 50 187.0 51 174.5 52 163.5 53 123.5 54 105.5 55 95.5 56 71.5 57 70.5 58 72.0 59 55.5 60 47.5 61 49.0 62 48.5 63 34.5 64 25.0 65 23.5 66 26.0 67 21.5 68 13.5 69 15.0 70 11.5 71 8.0 72 4.5 73 2.0 74 1.5 75 1.0 76 1.5 77 0.5 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.8750000000000001 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77443609022556 99.52499999999999 2 0.20050125313283207 0.4 3 0.02506265664160401 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.1125 0.0 0.0 0.0 0.0 114-115 0.125 0.0 0.0 0.0 0.0 116-117 0.15 0.0 0.0 0.0 0.0 118-119 0.1875 0.0 0.0 0.0 0.0 120-121 0.275 0.0 0.0 0.0 0.0 122-123 0.275 0.0 0.0 0.0 0.0 124-125 0.275 0.0 0.0 0.0 0.0 126-127 0.3125 0.0 0.0 0.0 0.0 128-129 0.325 0.0 0.0 0.0 0.0 130-131 0.3375 0.0 0.0 0.0 0.0 132-133 0.35 0.0 0.0 0.0 0.0 134-135 0.375 0.0 0.0 0.0 0.0 136-137 0.42500000000000004 0.0 0.0 0.0 0.0 138-139 0.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATCTGT 10 0.006830828 145.0 1 >>END_MODULE SRR6031162 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031162_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.31525 34.0 33.0 34.0 33.0 34.0 2 33.31975 34.0 33.0 34.0 33.0 34.0 3 33.278 34.0 33.0 34.0 33.0 34.0 4 33.23625 34.0 33.0 34.0 33.0 34.0 5 33.24525 34.0 33.0 34.0 33.0 34.0 6 37.393 38.0 38.0 38.0 38.0 38.0 7 37.40575 38.0 38.0 38.0 38.0 38.0 8 37.34275 38.0 38.0 38.0 38.0 38.0 9 37.38125 38.0 38.0 38.0 38.0 38.0 10-14 37.28445 38.0 38.0 38.0 38.0 38.0 15-19 37.185649999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.04995 38.0 38.0 38.0 38.0 38.0 25-29 37.21145 38.0 38.0 38.0 38.0 38.0 30-34 37.4782 38.0 38.0 38.0 38.0 38.0 35-39 37.4793 38.0 38.0 38.0 38.0 38.0 40-44 37.4693 38.0 38.0 38.0 38.0 38.0 45-49 37.47145 38.0 38.0 38.0 38.0 38.0 50-54 37.411350000000006 38.0 38.0 38.0 38.0 38.0 55-59 37.2671 38.0 38.0 38.0 38.0 38.0 60-64 37.37955 38.0 38.0 38.0 38.0 38.0 65-69 37.35135 38.0 38.0 38.0 38.0 38.0 70-74 37.150999999999996 38.0 38.0 38.0 38.0 38.0 75-79 37.3168 38.0 38.0 38.0 38.0 38.0 80-84 37.308299999999996 38.0 38.0 38.0 38.0 38.0 85-89 37.216 38.0 38.0 38.0 37.4 38.0 90-94 37.1305 38.0 38.0 38.0 37.0 38.0 95-99 37.1068 38.0 38.0 38.0 37.0 38.0 100-104 37.0595 38.0 38.0 38.0 37.0 38.0 105-109 36.8444 38.0 38.0 38.0 36.2 38.0 110-114 36.66315 38.0 38.0 38.0 36.0 38.0 115-119 36.463800000000006 38.0 38.0 38.0 35.6 38.0 120-124 36.54345 38.0 38.0 38.0 35.0 38.0 125-129 36.67035 38.0 38.0 38.0 35.0 38.0 130-134 36.602 38.0 38.0 38.0 35.0 38.0 135-139 36.5734 38.0 38.0 38.0 35.0 38.0 140-144 36.455999999999996 38.0 38.0 38.0 34.8 38.0 145-149 36.28625000000001 38.0 38.0 38.0 34.8 38.0 150-151 33.703374999999994 37.0 35.5 38.0 18.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 1.0 5 0.0 6 1.0 7 0.0 8 0.0 9 3.0 10 1.0 11 3.0 12 0.0 13 0.0 14 2.0 15 3.0 16 0.0 17 2.0 18 1.0 19 4.0 20 1.0 21 7.0 22 5.0 23 11.0 24 14.0 25 9.0 26 13.0 27 17.0 28 18.0 29 25.0 30 14.0 31 23.0 32 30.0 33 31.0 34 56.0 35 91.0 36 251.0 37 3357.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.125 22.3 9.4 23.175 2 28.19614711033275 27.045283962972228 24.168126094570926 20.590442832124094 3 22.01305220883534 27.434738955823295 28.76506024096386 21.78714859437751 4 25.357770524730107 32.086367060005024 21.240271152397693 21.315591262867187 5 26.17314930991217 33.07402760351317 20.37641154328733 20.37641154328733 6 24.13447064726543 36.026091319618665 20.572002007024587 19.26743602609132 7 23.632714500752634 20.296036126442548 34.194681384846966 21.876567987957852 8 24.33517310587055 23.98394380331159 23.08078273958856 28.6001003512293 9 23.55889724310777 24.235588972431078 27.719298245614034 24.486215538847116 10-14 24.614997483643684 27.352793155510817 24.338198288877706 23.69401107196779 15-19 24.82230175933861 25.4221908554721 26.092655139385997 23.662852245803297 20-24 25.183312262958278 25.88116308470291 25.051833122629585 23.88369152970923 25-29 25.02013287698812 25.85564727199517 25.377491443527276 23.74672840748943 30-34 24.825 26.029999999999998 25.724999999999998 23.419999999999998 35-39 25.6 25.779999999999998 25.064999999999998 23.555 40-44 25.569999999999997 25.575 25.14 23.715 45-49 25.28 25.72 25.595000000000002 23.405 50-54 25.28 25.490000000000002 25.545 23.685000000000002 55-59 25.122930255895636 25.8705469141997 25.243351731058706 23.763171098845962 60-64 24.985 26.14 25.480000000000004 23.395 65-69 26.024518388791595 26.169627220415308 24.788591443582686 23.01726294721041 70-74 25.37313432835821 26.036484245439468 25.307804412282024 23.282577013920296 75-79 25.31 25.985000000000003 25.405 23.3 80-84 25.55 25.91 25.395 23.145 85-89 25.805 26.44 24.775 22.98 90-94 24.855 26.52 25.445 23.18 95-99 25.259999999999998 26.495 25.305 22.939999999999998 100-104 25.52755275527553 25.817581758175816 25.65256525652565 23.002300230023 105-109 25.97637597386278 25.217391304347824 26.29303845187233 22.513194269917065 110-114 25.32506803749622 26.161677250277187 25.687934684003626 22.82532002822296 115-119 25.463079796093474 26.189875334376417 25.099682026952003 23.247362842578106 120-124 25.28129395218003 26.732971669680534 25.16073940124573 22.824994976893713 125-129 25.174999999999997 26.205000000000002 25.72 22.900000000000002 130-134 25.44 26.135 25.6 22.825 135-139 25.345000000000002 26.33 25.745 22.58 140-144 24.965 26.625 25.795 22.615 145-149 25.53 26.245 25.6 22.625 150-151 26.006501625406354 25.918979744936234 25.93148287071768 22.143035758939735 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 2.0 25 2.5 26 2.5 27 2.0 28 3.0 29 7.5 30 11.0 31 7.5 32 12.0 33 17.5 34 22.5 35 36.5 36 51.0 37 62.0 38 74.5 39 101.5 40 132.0 41 154.0 42 189.0 43 212.5 44 217.0 45 233.5 46 233.0 47 227.0 48 203.0 49 168.5 50 170.5 51 147.5 52 114.0 53 104.5 54 102.0 55 99.5 56 86.5 57 77.5 58 74.5 59 62.5 60 56.0 61 61.5 62 58.0 63 55.0 64 53.0 65 44.0 66 38.5 67 39.5 68 41.0 69 33.0 70 24.5 71 22.5 72 16.5 73 10.5 74 7.5 75 6.5 76 2.5 77 1.5 78 2.0 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.4 4 0.42500000000000004 5 0.375 6 0.35000000000000003 7 0.35000000000000003 8 0.35000000000000003 9 0.25 10-14 0.65 15-19 0.815 20-24 1.125 25-29 0.66 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.35000000000000003 60-64 0.0 65-69 0.075 70-74 0.505 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.01 105-109 0.525 110-114 0.79 115-119 0.935 120-124 0.45999999999999996 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69887076537015 99.325 2 0.2509410288582183 0.5 3 0.02509410288582183 0.075 4 0.02509410288582183 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.1125 0.0 0.0 0.0 0.0 114-115 0.125 0.0 0.0 0.0 0.0 116-117 0.15 0.0 0.0 0.0 0.0 118-119 0.1875 0.0 0.0 0.0 0.0 120-121 0.275 0.0 0.0 0.0 0.0 122-123 0.275 0.0 0.0 0.0 0.0 124-125 0.275 0.0 0.0 0.0 0.0 126-127 0.3125 0.0 0.0 0.0 0.0 128-129 0.325 0.0 0.0 0.0 0.0 130-131 0.3375 0.0 0.0 0.0 0.0 132-133 0.35 0.0 0.0 0.0 0.0 134-135 0.3625 0.0 0.0 0.0 0.0 136-137 0.4 0.0 0.0 0.0 0.0 138-139 0.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 747804 spots for SRR6031162.sra Written 747804 spots for SRR6031162.sra Read 747804 spots for SRR6031162.sra Written 747804 spots for SRR6031162.sra Read 747804 spots for SRR6031162.sra Written 747804 spots for SRR6031162.sra Read 747804 spots for SRR6031162.sra Written 747804 spots for SRR6031162.sra Read 747804 spots for SRR6031162.sra Written 747804 spots for SRR6031162.sra Read 747804 spots for SRR6031162.sra Written 747804 spots for SRR6031162.sra Read 747804 spots for SRR6031162.sra Written 747804 spots for SRR6031162.sra Read 747804 spots for SRR6031162.sra Written 747804 spots for SRR6031162.sra Read 747804 spots for SRR6031162.sra Written 747804 spots for SRR6031162.sra Read 747804 spots for SRR6031162.sra Written 747804 spots for SRR6031162.sra Read 747804 spots for SRR6031162.sra Written 747804 spots for SRR6031162.sra Read 747804 spots for SRR6031162.sra Written 747804 spots for SRR6031162.sra Read 747814 spots for SRR6031162.sra Written 747814 spots for SRR6031162.sra Read 747804 spots for SRR6031162.sra Written 747804 spots for SRR6031162.sra Read 747804 spots for SRR6031162.sra Written 747804 spots for SRR6031162.sra Read 747804 spots for SRR6031162.sra Written 747804 spots for SRR6031162.sra Read 747804 spots for SRR6031162.sra Written 747804 spots for SRR6031162.sra Read 747804 spots for SRR6031162.sra Written 747804 spots for SRR6031162.sra Read 747804 spots for SRR6031162.sra Written 747804 spots for SRR6031162.sra Read 747804 spots for SRR6031162.sra Written 747804 spots for SRR6031162.sra SRR ids: ['SRR6031162.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wkti726v SRR6031162.sra spots: 14956090 blocks: [[1, 747804], [747805, 1495608], [1495609, 2243412], [2243413, 2991216], [2991217, 3739020], [3739021, 4486824], [4486825, 5234628], [5234629, 5982432], [5982433, 6730236], [6730237, 7478040], [7478041, 8225844], [8225845, 8973648], [8973649, 9721452], [9721453, 10469256], [10469257, 11217060], [11217061, 11964864], [11964865, 12712668], [12712669, 13460472], [13460473, 14208276], [14208277, 14956090]] SRR6031162 file size 5046427 SRR6031162 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031162 SRR6031162_1.fastq SRR6031162_2.fastq Input file: SRR6031162_1.fastq Paired file: SRR6031162_2.fastq trimmed: SRR6031162-trimmed-pair1.fastq, SRR6031162-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:26:05 2024 >> started Tue Dec 10 00:26:55 2024 >> done (49.942s) 14956090 read pairs processed; of these: 11988 ( 0.08%) short read pairs filtered out after trimming by size control 8758 ( 0.06%) empty read pairs filtered out after trimming by size control 14935344 (99.86%) read pairs available; of these: 3563080 (23.86%) trimmed read pairs available after processing 11372264 (76.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 10 0.00% 20 5 0.00% 21 6 0.00% 22 7 0.00% 23 5 0.00% 24 4 0.00% 25 4 0.00% 26 12 0.00% 27 7 0.00% 28 8 0.00% 29 11 0.00% 30 7 0.00% 31 11 0.00% 32 8 0.00% 33 7 0.00% 34 6 0.00% 35 8 0.00% 36 8 0.00% 37 7 0.00% 38 5 0.00% 39 9 0.00% 40 12 0.00% 41 12 0.00% 42 17 0.00% 43 15 0.00% 44 7 0.00% 45 7 0.00% 46 11 0.00% 47 11 0.00% 48 12 0.00% 49 15 0.00% 50 23 0.00% 51 18 0.00% 52 21 0.00% 53 16 0.00% 54 27 0.00% 55 23 0.00% 56 40 0.00% 57 31 0.00% 58 35 0.00% 59 44 0.00% 60 55 0.00% 61 64 0.00% 62 64 0.00% 63 75 0.00% 64 75 0.00% 65 77 0.00% 66 99 0.00% 67 110 0.00% 68 115 0.00% 69 112 0.00% 70 152 0.00% 71 158 0.00% 72 166 0.00% 73 210 0.00% 74 220 0.00% 75 261 0.00% 76 296 0.00% 77 348 0.00% 78 345 0.00% 79 361 0.00% 80 358 0.00% 81 419 0.00% 82 531 0.00% 83 521 0.00% 84 1090 0.01% 85 1423 0.01% 86 1604 0.01% 87 1603 0.01% 88 1630 0.01% 89 1551 0.01% 90 1653 0.01% 91 1658 0.01% 92 1687 0.01% 93 1690 0.01% 94 1708 0.01% 95 1825 0.01% 96 1821 0.01% 97 1961 0.01% 98 2012 0.01% 99 2045 0.01% 100 2219 0.01% 101 2280 0.02% 102 2439 0.02% 103 2583 0.02% 104 2625 0.02% 105 2750 0.02% 106 2902 0.02% 107 2963 0.02% 108 3006 0.02% 109 3155 0.02% 110 3394 0.02% 111 3778 0.03% 112 3909 0.03% 113 4000 0.03% 114 4262 0.03% 115 4505 0.03% 116 4790 0.03% 117 4963 0.03% 118 5337 0.04% 119 5603 0.04% 120 5896 0.04% 121 6273 0.04% 122 6465 0.04% 123 6600 0.04% 124 7056 0.05% 125 7490 0.05% 126 7926 0.05% 127 8366 0.06% 128 9008 0.06% 129 9149 0.06% 130 10011 0.07% 131 10568 0.07% 132 11339 0.08% 133 12319 0.08% 134 13004 0.09% 135 14038 0.09% 136 15399 0.10% 137 16725 0.11% 138 18479 0.12% 139 19891 0.13% 140 22298 0.15% 141 24753 0.17% 142 27904 0.19% 143 31784 0.21% 144 37358 0.25% 145 47429 0.32% 146 61429 0.41% 147 85948 0.58% 148 140316 0.94% 149 324096 2.17% 150 2439594 16.33% 151 11372264 76.14% 14935344 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=9.25 fanout-score-rank=12 prefix-density=0.50 prefix-fanout=5.0 sequence=CTCCAGCTCCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=72.71 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=8.6 sequence=GCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACG criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=3.75 fanout-score-rank=20 prefix-density=0.33 prefix-fanout=3.2 sequence=GGCAAGACCATCAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=544.28 fanout-score-rank=1 prefix-density=0.59 prefix-fanout=20.5 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR6031162 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:27:53 Started mapping on | Dec 10 00:27:53 Finished on | Dec 10 00:29:06 Mapping speed, Million of reads per hour | 736.54 Number of input reads | 14935344 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 14163162 Uniquely mapped reads % | 94.83% Average mapped length | 299.73 Number of splices: Total | 16286681 Number of splices: Annotated (sjdb) | 15462617 Number of splices: GT/AG | 16076419 Number of splices: GC/AG | 190876 Number of splices: AT/AC | 9385 Number of splices: Non-canonical | 10001 Mismatch rate per base, % | 0.08% Deletion rate per base | 0.00% Deletion average length | 1.37 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 147352 % of reads mapped to multiple loci | 0.99% Number of reads mapped to too many loci | 16423 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.21% % of reads unmapped: other | 0.86% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 634941 634941 634941 N_multimapping 147352 147352 147352 N_noFeature 471117 13785340 563416 N_ambiguous 346512 3080 61488 UnstrandedReadsAssigned:13345533 PositiveStrandReadsAssigned:374742 NegativeStrandReadsAssigned:13538258 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6031162 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6031162-trimmed-pair1.fastq SRR6031162-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,935,344 reads, 13,593,866 reads pseudoaligned [quant] estimated average fragment length: 459.159 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,182 rounds 52973 SRR6031162.ke.tsv 35125 SRR6031162.se.tsv 88098 total ==> SRR6031162.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 479.891 0 0 PNS24247 1044 585.841 85.4768 15.0953 PNS24249 1928 1469.84 21.6939 1.527 PNS24246 1044 585.841 85.4768 15.0953 PNS24248 1044 585.841 85.4768 15.0953 PNS24244 1471 1012.84 63.8757 6.52479 PNS24243 293 65.1147 0 0 KQK14069 1603 1144.84 4973.66 449.472 KQK14071 474 126.035 18.7906 15.4248 ==> SRR6031162.se.tsv <== BRADI_1g14170v3 5252 BRADI_1g53295v3 80 BRADI_1g59795v3 405 BRADI_1g07683v3 0 BRADI_1g00485v3 23 BRADI_1g20270v3 806 BRADI_1g74790v3 205 BRADI_1g09890v3 0 BRADI_1g77505v3 191 BRADI_1g48960v3 0 SRR6031162 completed mapping pipeline successfully