Starting /dee2/code/volunteer_pipeline.sh SRR6031163 current disk space = 1523540885504 free memory = 1561417616 SRR6031163 SRAfilesize 2502ec153f4dafed2673cd659f26469b SRR6031163.sra SRR6031163.sra file validated SRR6031163 is paired end SRR6031163 is conventional basespace SRR6031163 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031163_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.14875 32.0 30.0 33.0 25.0 33.0 2 31.221 33.0 29.0 33.0 27.0 34.0 3 32.7415 33.0 33.0 33.0 31.0 34.0 4 33.21075 33.0 33.0 34.0 33.0 34.0 5 33.5705 34.0 33.0 34.0 33.0 34.0 6 37.56175 38.0 38.0 38.0 37.0 38.0 7 37.8275 38.0 38.0 38.0 38.0 38.0 8 37.85375 38.0 38.0 38.0 38.0 38.0 9 37.9125 38.0 38.0 38.0 38.0 38.0 10-14 37.9072 38.0 38.0 38.0 38.0 38.0 15-19 37.9168 38.0 38.0 38.0 38.0 38.0 20-24 37.9071 38.0 38.0 38.0 38.0 38.0 25-29 37.90145 38.0 38.0 38.0 38.0 38.0 30-34 37.8817 38.0 38.0 38.0 38.0 38.0 35-39 37.876850000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.863600000000005 38.0 38.0 38.0 38.0 38.0 45-49 37.8486 38.0 38.0 38.0 38.0 38.0 50-54 37.838049999999996 38.0 38.0 38.0 38.0 38.0 55-59 37.814249999999994 38.0 38.0 38.0 38.0 38.0 60-64 37.796800000000005 38.0 38.0 38.0 38.0 38.0 65-69 37.80715 38.0 38.0 38.0 38.0 38.0 70-74 37.7823 38.0 38.0 38.0 38.0 38.0 75-79 37.7688 38.0 38.0 38.0 38.0 38.0 80-84 37.720150000000004 38.0 38.0 38.0 38.0 38.0 85-89 37.7093 38.0 38.0 38.0 38.0 38.0 90-94 37.69765 38.0 38.0 38.0 38.0 38.0 95-99 37.62655 38.0 38.0 38.0 38.0 38.0 100-104 37.583299999999994 38.0 38.0 38.0 38.0 38.0 105-109 37.57785 38.0 38.0 38.0 38.0 38.0 110-114 37.539750000000005 38.0 38.0 38.0 38.0 38.0 115-119 37.5137 38.0 38.0 38.0 38.0 38.0 120-124 37.411899999999996 38.0 38.0 38.0 37.6 38.0 125-129 37.35465000000001 38.0 38.0 38.0 37.0 38.0 130-134 37.242200000000004 38.0 38.0 38.0 36.0 38.0 135-139 37.1248 38.0 38.0 38.0 36.0 38.0 140-144 37.0834 38.0 38.0 38.0 36.0 38.0 145-149 36.897299999999994 38.0 38.0 38.0 35.2 38.0 150-151 35.196124999999995 38.0 36.0 38.0 31.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 1.0 17 0.0 18 1.0 19 0.0 20 0.0 21 2.0 22 0.0 23 0.0 24 1.0 25 1.0 26 4.0 27 1.0 28 3.0 29 8.0 30 7.0 31 9.0 32 17.0 33 15.0 34 27.0 35 47.0 36 192.0 37 3662.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.903807615230455 11.648296593186373 6.2374749498997994 30.210420841683366 2 21.775 12.1 34.025 32.1 3 18.875 16.275000000000002 25.825 39.025 4 22.25 21.099999999999998 23.799999999999997 32.85 5 24.875 27.125 24.625 23.375 6 24.041113060917525 31.160691902732513 24.241664577588367 20.556530458761593 7 17.474999999999998 26.3 37.8 18.425 8 19.875 24.7 29.375 26.05 9 19.0 23.05 33.2 24.75 10-14 21.634999999999998 27.57 27.450000000000003 23.345 15-19 21.455 26.005 27.229999999999997 25.31 20-24 21.925 26.195 27.284999999999997 24.595 25-29 21.73 26.705000000000002 26.71 24.855 30-34 21.515 26.375 26.8 25.31 35-39 21.795 26.63 27.07 24.505 40-44 21.8 26.275 26.57 25.355 45-49 21.595 26.029999999999998 26.76 25.615 50-54 21.59 26.355 27.11 24.945 55-59 21.72 25.965 26.555 25.759999999999998 60-64 21.63 26.07 27.169999999999998 25.130000000000003 65-69 21.845 26.174999999999997 26.650000000000002 25.330000000000002 70-74 22.505 26.43 26.235000000000003 24.83 75-79 21.785 26.095000000000002 26.51 25.61 80-84 21.279999999999998 26.235000000000003 27.13 25.355 85-89 21.395 26.19 26.740000000000002 25.674999999999997 90-94 22.11 26.240000000000002 26.38 25.27 95-99 21.285 26.14 26.884999999999998 25.69 100-104 21.955 26.305 26.334999999999997 25.405 105-109 22.040000000000003 25.83 26.575 25.555 110-114 22.38 25.91 26.735 24.975 115-119 22.185 26.215 26.700000000000003 24.9 120-124 22.134999999999998 26.205000000000002 26.3 25.36 125-129 21.795 25.745 26.85 25.61 130-134 22.46 25.424999999999997 26.525 25.590000000000003 135-139 22.505 25.665 26.724999999999998 25.105 140-144 22.264999999999997 26.240000000000002 26.305 25.19 145-149 22.264999999999997 25.35 26.77 25.615 150-151 21.587500000000002 26.3625 25.974999999999998 26.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 1.0 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.0 24 0.5 25 1.0 26 1.0 27 0.5 28 3.5 29 5.5 30 7.5 31 11.5 32 16.5 33 27.0 34 36.5 35 51.5 36 64.0 37 72.5 38 90.5 39 106.5 40 141.5 41 155.0 42 163.5 43 204.0 44 216.0 45 201.0 46 203.0 47 226.0 48 228.5 49 219.5 50 205.0 51 180.5 52 165.0 53 139.0 54 115.5 55 108.0 56 101.5 57 93.0 58 80.0 59 71.5 60 62.0 61 46.0 62 38.0 63 32.0 64 23.5 65 22.0 66 14.5 67 10.5 68 13.0 69 9.5 70 5.0 71 2.5 72 0.5 73 1.0 74 1.0 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.27499999999999997 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.0 #Duplication Level Percentage of deduplicated Percentage of total 1 97.68041237113401 94.75 2 1.8556701030927836 3.5999999999999996 3 0.28350515463917525 0.8250000000000001 4 0.12886597938144329 0.5 5 0.025773195876288662 0.125 6 0.0 0.0 7 0.0 0.0 8 0.025773195876288662 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCAACTACGAGCTTTTTAACTGCAACAACTTAAATATACGCTATTGGA 8 0.2 No Hit GTACAAAGGGCAGGGACGTAGTCAACGCGAGCTGATGACTCGCGCTTACT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.2375 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.4375 0.0 0.0 0.0 0.0 116-117 0.4875 0.0 0.0 0.0 0.0 118-119 0.5125 0.0 0.0 0.0 0.0 120-121 0.575 0.0 0.0 0.0 0.0 122-123 0.6125 0.0 0.0 0.0 0.0 124-125 0.625 0.0 0.0 0.0 0.0 126-127 0.6625000000000001 0.0 0.0 0.0 0.0 128-129 0.725 0.0 0.0 0.0 0.0 130-131 0.775 0.0 0.0 0.0 0.0 132-133 0.8 0.0 0.0 0.0 0.0 134-135 0.8125 0.0 0.0 0.0 0.0 136-137 0.9125000000000001 0.0 0.0 0.0 0.0 138-139 0.95 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATTAAT 10 0.006830828 145.0 7 >>END_MODULE SRR6031163 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031163_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.444 34.0 33.0 34.0 33.0 34.0 2 33.537 34.0 33.0 34.0 33.0 34.0 3 33.55375 34.0 33.0 34.0 33.0 34.0 4 33.48575 34.0 33.0 34.0 33.0 34.0 5 33.5335 34.0 34.0 34.0 33.0 34.0 6 37.6815 38.0 38.0 38.0 38.0 38.0 7 37.73175 38.0 38.0 38.0 38.0 38.0 8 37.714 38.0 38.0 38.0 38.0 38.0 9 37.742 38.0 38.0 38.0 38.0 38.0 10-14 37.7291 38.0 38.0 38.0 38.0 38.0 15-19 37.687400000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.6496 38.0 38.0 38.0 38.0 38.0 25-29 37.6847 38.0 38.0 38.0 38.0 38.0 30-34 37.76685 38.0 38.0 38.0 38.0 38.0 35-39 37.763549999999995 38.0 38.0 38.0 38.0 38.0 40-44 37.739000000000004 38.0 38.0 38.0 38.0 38.0 45-49 37.7568 38.0 38.0 38.0 38.0 38.0 50-54 37.74955 38.0 38.0 38.0 38.0 38.0 55-59 37.685449999999996 38.0 38.0 38.0 38.0 38.0 60-64 37.70345 38.0 38.0 38.0 38.0 38.0 65-69 37.71265 38.0 38.0 38.0 38.0 38.0 70-74 37.64805 38.0 38.0 38.0 38.0 38.0 75-79 37.7264 38.0 38.0 38.0 38.0 38.0 80-84 37.699349999999995 38.0 38.0 38.0 38.0 38.0 85-89 37.65195 38.0 38.0 38.0 38.0 38.0 90-94 37.648450000000004 38.0 38.0 38.0 38.0 38.0 95-99 37.6115 38.0 38.0 38.0 38.0 38.0 100-104 37.59125 38.0 38.0 38.0 38.0 38.0 105-109 37.47895 38.0 38.0 38.0 38.0 38.0 110-114 37.3857 38.0 38.0 38.0 38.0 38.0 115-119 37.2937 38.0 38.0 38.0 38.0 38.0 120-124 37.29615 38.0 38.0 38.0 38.0 38.0 125-129 37.36409999999999 38.0 38.0 38.0 38.0 38.0 130-134 37.3263 38.0 38.0 38.0 38.0 38.0 135-139 37.2495 38.0 38.0 38.0 37.0 38.0 140-144 37.219 38.0 38.0 38.0 36.0 38.0 145-149 37.00535 38.0 38.0 38.0 36.0 38.0 150-151 35.037875 38.0 36.0 38.0 29.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 0.0 5 0.0 6 3.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 0.0 18 0.0 19 2.0 20 0.0 21 1.0 22 1.0 23 4.0 24 2.0 25 3.0 26 11.0 27 2.0 28 6.0 29 10.0 30 4.0 31 12.0 32 15.0 33 18.0 34 30.0 35 48.0 36 136.0 37 3687.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.62062062062062 23.0980980980981 8.458458458458457 22.822822822822822 2 27.652652652652655 28.703703703703702 24.424424424424423 19.21921921921922 3 23.190583521162033 27.02228900576008 28.299524167292763 21.487603305785125 4 26.472800200551518 30.759588869390825 21.283529706693407 21.484081223364253 5 26.529588766298893 34.10230692076229 19.50852557673019 19.859578736208626 6 24.173346693386772 36.37274549098196 19.739478957915832 19.71442885771543 7 22.678347934918648 23.62953692115144 32.66583229036296 21.026282853566958 8 24.30468554247056 24.25457278877474 24.480080180405913 26.960661488348787 9 24.430538172715895 24.6558197747184 27.183979974968707 23.729662077597 10-14 25.668636682360013 27.321446458980265 24.426525092657517 22.583391766002205 15-19 25.49746879855646 25.93854944614305 25.42729687734951 23.13668487795098 20-24 25.195626003210275 27.00140449438202 25.115369181380416 22.687600321027286 25-29 26.052776525962646 26.748785739322017 24.60067097291072 22.597766761804618 30-34 25.53 26.93 25.21 22.33 35-39 24.955 27.534999999999997 24.495 23.015 40-44 26.0 26.395000000000003 24.365000000000002 23.24 45-49 25.47 26.040000000000003 25.64 22.85 50-54 25.759999999999998 26.490000000000002 25.385 22.365 55-59 25.183961555789157 26.300245282074385 25.60444511187866 22.911348050257796 60-64 26.13 25.81 25.46 22.6 65-69 25.937593759375936 25.922592259225922 25.79257925792579 22.347234723472347 70-74 25.891426282051285 26.65264423076923 25.33553685897436 22.120392628205128 75-79 25.661283064153206 26.14130706535327 25.531276563828193 22.666133306665333 80-84 25.665 27.08 25.19 22.065 85-89 25.835 25.97 25.605 22.59 90-94 25.39 26.305 25.53 22.775000000000002 95-99 25.779999999999998 26.045 25.605 22.57 100-104 25.441360340085023 26.03150787696924 26.061515378844714 22.465616404101024 105-109 25.523914569337208 26.43637822119723 25.854807981550188 22.184899227915373 110-114 25.471887550200805 26.506024096385545 25.968875502008032 22.053212851405625 115-119 25.292787132445337 26.44885649660719 25.413420457401358 22.844935913546117 120-124 25.95840641443247 26.078677023302433 25.387121022300175 22.575795539964922 125-129 25.84629231461573 26.75133756687834 25.101255062753136 22.30111505575279 130-134 25.380000000000003 26.834999999999997 25.1 22.685 135-139 25.779999999999998 26.584999999999997 25.28 22.355 140-144 26.040000000000003 26.545 25.135 22.28 145-149 25.905 26.384999999999998 25.7 22.009999999999998 150-151 25.6125 26.887499999999996 25.074999999999996 22.425 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 1.5 23 1.0 24 0.5 25 1.0 26 2.0 27 2.5 28 2.0 29 4.0 30 7.0 31 9.5 32 17.5 33 26.5 34 31.0 35 43.0 36 56.5 37 67.0 38 83.0 39 105.0 40 129.0 41 158.5 42 181.0 43 190.5 44 195.0 45 198.0 46 210.5 47 205.0 48 195.0 49 186.0 50 172.0 51 171.0 52 151.5 53 125.0 54 120.0 55 117.5 56 99.0 57 85.0 58 90.0 59 83.0 60 63.0 61 50.5 62 52.5 63 58.0 64 49.0 65 36.0 66 34.0 67 35.5 68 30.5 69 22.5 70 13.5 71 9.5 72 7.0 73 4.0 74 3.5 75 3.0 76 1.5 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.1 3 0.17500000000000002 4 0.27499999999999997 5 0.3 6 0.2 7 0.125 8 0.22499999999999998 9 0.125 10-14 0.16999999999999998 15-19 0.245 20-24 0.32 25-29 0.145 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.11499999999999999 60-64 0.0 65-69 0.01 70-74 0.16 75-79 0.005 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.025 105-109 0.27 110-114 0.4 115-119 0.525 120-124 0.22499999999999998 125-129 0.005 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.275 #Duplication Level Percentage of deduplicated Percentage of total 1 98.12387561038294 95.45 2 1.3364173734258544 2.6 3 0.3341043433564636 0.975 4 0.10280133641737343 0.4 5 0.07710100231303006 0.375 6 0.0 0.0 7 0.0 0.0 8 0.02570033410434336 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCCATGCATGTGCAA 8 0.2 No Hit GTGAAATACCACTACTTTTAACGTTATTTTACTTATTCCGTGGGTCGGAA 5 0.125 No Hit GGCGGGACTACCCGCTGAGTTTAAGCATATAAATAAGCGGAGGAGAAGAA 5 0.125 No Hit AAGGAGTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0125 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.4125 0.0 0.0 0.0 0.0 116-117 0.4625 0.0 0.0 0.0 0.0 118-119 0.4875 0.0 0.0 0.0 0.0 120-121 0.55 0.0 0.0 0.0 0.0 122-123 0.5874999999999999 0.0 0.0 0.0 0.0 124-125 0.6 0.0 0.0 0.0 0.0 126-127 0.6375 0.0 0.0 0.0 0.0 128-129 0.7 0.0 0.0 0.0 0.0 130-131 0.75 0.0 0.0 0.0 0.0 132-133 0.775 0.0 0.0 0.0 0.0 134-135 0.7875000000000001 0.0 0.0 0.0 0.0 136-137 0.8875 0.0 0.0 0.0 0.0 138-139 0.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 386390 spots for SRR6031163.sra Written 386390 spots for SRR6031163.sra Read 386390 spots for SRR6031163.sra Written 386390 spots for SRR6031163.sra Read 386390 spots for SRR6031163.sra Written 386390 spots for SRR6031163.sra Read 386390 spots for SRR6031163.sra Written 386390 spots for SRR6031163.sra Read 386390 spots for SRR6031163.sra Written 386390 spots for SRR6031163.sra Read 386390 spots for SRR6031163.sra Written 386390 spots for SRR6031163.sra Read 386390 spots for SRR6031163.sra Written 386390 spots for SRR6031163.sra Read 386390 spots for SRR6031163.sra Written 386390 spots for SRR6031163.sra Read 386390 spots for SRR6031163.sra Written 386390 spots for SRR6031163.sra Read 386390 spots for SRR6031163.sra Written 386390 spots for SRR6031163.sra Read 386390 spots for SRR6031163.sra Written 386390 spots for SRR6031163.sra Read 386390 spots for SRR6031163.sra Written 386390 spots for SRR6031163.sra Read 386390 spots for SRR6031163.sra Written 386390 spots for SRR6031163.sra Read 386390 spots for SRR6031163.sra Written 386390 spots for SRR6031163.sra Read 386390 spots for SRR6031163.sra Written 386390 spots for SRR6031163.sra Read 386390 spots for SRR6031163.sra Written 386390 spots for SRR6031163.sra Read 386390 spots for SRR6031163.sra Written 386390 spots for SRR6031163.sra Read 386408 spots for SRR6031163.sra Written 386408 spots for SRR6031163.sra Read 386390 spots for SRR6031163.sra Written 386390 spots for SRR6031163.sra Read 386390 spots for SRR6031163.sra Written 386390 spots for SRR6031163.sra SRR ids: ['SRR6031163.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__fw86bry SRR6031163.sra spots: 7727818 blocks: [[1, 386390], [386391, 772780], [772781, 1159170], [1159171, 1545560], [1545561, 1931950], [1931951, 2318340], [2318341, 2704730], [2704731, 3091120], [3091121, 3477510], [3477511, 3863900], [3863901, 4250290], [4250291, 4636680], [4636681, 5023070], [5023071, 5409460], [5409461, 5795850], [5795851, 6182240], [6182241, 6568630], [6568631, 6955020], [6955021, 7341410], [7341411, 7727818]] SRR6031163 file size 2601441 SRR6031163 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031163 SRR6031163_1.fastq SRR6031163_2.fastq Input file: SRR6031163_1.fastq Paired file: SRR6031163_2.fastq trimmed: SRR6031163-trimmed-pair1.fastq, SRR6031163-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:24:13 2024 >> started Tue Dec 10 00:24:21 2024 >> done (8.559s) 7727818 read pairs processed; of these: 3525 ( 0.05%) short read pairs filtered out after trimming by size control 3283 ( 0.04%) empty read pairs filtered out after trimming by size control 7721010 (99.91%) read pairs available; of these: 1619930 (20.98%) trimmed read pairs available after processing 6101080 (79.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 5 0.00% 21 4 0.00% 22 11 0.00% 23 7 0.00% 24 7 0.00% 25 5 0.00% 26 5 0.00% 27 8 0.00% 28 10 0.00% 29 5 0.00% 30 5 0.00% 31 7 0.00% 32 6 0.00% 33 8 0.00% 34 11 0.00% 35 2 0.00% 36 6 0.00% 37 13 0.00% 38 15 0.00% 39 5 0.00% 40 10 0.00% 41 9 0.00% 42 7 0.00% 43 11 0.00% 44 5 0.00% 45 11 0.00% 46 12 0.00% 47 11 0.00% 48 11 0.00% 49 9 0.00% 50 14 0.00% 51 23 0.00% 52 17 0.00% 53 20 0.00% 54 19 0.00% 55 24 0.00% 56 30 0.00% 57 20 0.00% 58 30 0.00% 59 31 0.00% 60 32 0.00% 61 30 0.00% 62 43 0.00% 63 44 0.00% 64 53 0.00% 65 58 0.00% 66 59 0.00% 67 63 0.00% 68 75 0.00% 69 84 0.00% 70 93 0.00% 71 108 0.00% 72 110 0.00% 73 146 0.00% 74 123 0.00% 75 144 0.00% 76 183 0.00% 77 189 0.00% 78 219 0.00% 79 211 0.00% 80 225 0.00% 81 286 0.00% 82 278 0.00% 83 330 0.00% 84 510 0.01% 85 610 0.01% 86 715 0.01% 87 798 0.01% 88 824 0.01% 89 781 0.01% 90 826 0.01% 91 843 0.01% 92 869 0.01% 93 886 0.01% 94 933 0.01% 95 956 0.01% 96 1010 0.01% 97 1078 0.01% 98 1191 0.02% 99 1156 0.01% 100 1234 0.02% 101 1249 0.02% 102 1343 0.02% 103 1368 0.02% 104 1432 0.02% 105 1590 0.02% 106 1590 0.02% 107 1623 0.02% 108 1686 0.02% 109 1711 0.02% 110 1764 0.02% 111 1893 0.02% 112 2021 0.03% 113 2039 0.03% 114 2157 0.03% 115 2196 0.03% 116 2345 0.03% 117 2412 0.03% 118 2601 0.03% 119 2611 0.03% 120 2838 0.04% 121 2831 0.04% 122 2922 0.04% 123 3111 0.04% 124 3265 0.04% 125 3291 0.04% 126 3513 0.05% 127 3569 0.05% 128 3658 0.05% 129 3969 0.05% 130 4237 0.05% 131 4392 0.06% 132 4637 0.06% 133 4867 0.06% 134 5199 0.07% 135 5403 0.07% 136 5837 0.08% 137 6201 0.08% 138 6563 0.09% 139 7241 0.09% 140 7758 0.10% 141 8234 0.11% 142 9556 0.12% 143 10814 0.14% 144 12738 0.16% 145 15592 0.20% 146 20396 0.26% 147 29600 0.38% 148 50246 0.65% 149 128320 1.66% 150 1184616 15.34% 151 6101080 79.02% 7721010 reads passed initial QC criterion=sequence-density sequence-density=1.00 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=36 prefix-density=1.00 prefix-fanout=2.0 sequence=TACCCTTTTGTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=28 fanout-score=23.10 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=2.1 sequence=CCAGCTCACGTACCGCATTAATGGGCGAACAGCCCAACCCTTGGAACCACCTACAGCTCCAGGTGGCGAAGAGCCGAC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=5.70 fanout-score-rank=14 prefix-density=1.25 prefix-fanout=1.8 sequence=TGGTGCATGGCTGTCGTCAGCTCGTGCCGTAAGGTGTTGGGTTAAGTCTCGCAACGAGCGCAACCCTCGTGTTTAGTTGCCACTATGAGTTTGGAACCCTGAACAGACCGCCGGTGTTAAGCCGGAGGAAGGAGAGGATGAGGCCAAGTCATCATGCCCCTTATGCCCTGGGCGACACACGTGCTACAATGGGCGGGACAAAGGGTCGCGATCTCGCGAGGGTGAGCTAACTCCAAAAACCCGTCCTCAGTTCGGATTGCAGGCTGCAACTCGCCTGCATGAAGCAGGAATCGCTAGTAATCGCCGGTCAGCCATACGGCGGTGAATCCGTTCCCGGGCCTTGTACACACC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=33.19 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=3.8 sequence=CCAAGGAGTCTAACATCTATGCGAGTGTTCGGGTGTCAAACCCCTACGCGTAATGAAAGTGAACGGAGGTGAGAACCGCAAGGTGCATCATCGACCGATCCTGATGTCTTCGGATGGATTTGAGTAAGAGCATAGCTGTTGGGACCCGAAA SRR6031163 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:25:12 Started mapping on | Dec 10 00:25:13 Finished on | Dec 10 00:26:33 Mapping speed, Million of reads per hour | 347.45 Number of input reads | 7721010 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 6057627 Uniquely mapped reads % | 78.46% Average mapped length | 299.95 Number of splices: Total | 6513378 Number of splices: Annotated (sjdb) | 6185397 Number of splices: GT/AG | 6429614 Number of splices: GC/AG | 75133 Number of splices: AT/AC | 3778 Number of splices: Non-canonical | 4853 Mismatch rate per base, % | 0.07% Deletion rate per base | 0.00% Deletion average length | 1.40 Insertion rate per base | 0.00% Insertion average length | 1.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 226510 % of reads mapped to multiple loci | 2.93% Number of reads mapped to too many loci | 86014 % of reads mapped to too many loci | 1.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.61% % of reads unmapped: other | 11.88% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1439762 1439762 1439762 N_multimapping 226510 226510 226510 N_noFeature 490844 5882726 542045 N_ambiguous 158508 1476 35935 UnstrandedReadsAssigned:5408275 PositiveStrandReadsAssigned:173425 NegativeStrandReadsAssigned:5479647 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6031163 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6031163-trimmed-pair1.fastq SRR6031163-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,721,010 reads, 5,666,298 reads pseudoaligned [quant] estimated average fragment length: 430.317 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 995 rounds 52973 SRR6031163.ke.tsv 35125 SRR6031163.se.tsv 88098 total ==> SRR6031163.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 507.944 0 0 PNS24247 1044 614.683 34.8413 13.821 PNS24249 1928 1498.68 3.29328 0.535814 PNS24246 1044 614.683 34.8413 13.821 PNS24248 1044 614.683 34.8413 13.821 PNS24244 1471 1041.68 32.1829 7.53329 PNS24243 293 66.615 0 0 KQK14069 1603 1173.68 912.165 189.504 KQK14071 474 135.845 0 0 ==> SRR6031163.se.tsv <== BRADI_1g14170v3 990 BRADI_1g53295v3 35 BRADI_1g59795v3 194 BRADI_1g07683v3 0 BRADI_1g00485v3 11 BRADI_1g20270v3 447 BRADI_1g74790v3 56 BRADI_1g09890v3 0 BRADI_1g77505v3 54 BRADI_1g48960v3 0 SRR6031163 completed mapping pipeline successfully