Starting /dee2/code/volunteer_pipeline.sh SRR6031164 current disk space = 1523542728704 free memory = 1566786868 SRR6031164 SRAfilesize 87b9599b740dccb3c931f8b58846cfa2 SRR6031164.sra SRR6031164.sra file validated SRR6031164 is paired end SRR6031164 is conventional basespace SRR6031164 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031164_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.33325 32.0 30.0 33.0 25.0 33.0 2 31.86825 33.0 31.0 33.0 29.0 34.0 3 32.2765 33.0 31.0 33.0 31.0 33.0 4 32.441 33.0 32.0 33.0 32.0 34.0 5 32.93225 33.0 33.0 33.0 33.0 34.0 6 37.3125 38.0 38.0 38.0 37.0 38.0 7 37.71675 38.0 38.0 38.0 38.0 38.0 8 37.82825 38.0 38.0 38.0 38.0 38.0 9 37.87175 38.0 38.0 38.0 38.0 38.0 10-14 37.8515 38.0 38.0 38.0 38.0 38.0 15-19 37.88765 38.0 38.0 38.0 38.0 38.0 20-24 37.9003 38.0 38.0 38.0 38.0 38.0 25-29 37.8999 38.0 38.0 38.0 38.0 38.0 30-34 37.879599999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.860949999999995 38.0 38.0 38.0 38.0 38.0 40-44 37.83639999999999 38.0 38.0 38.0 38.0 38.0 45-49 37.84119999999999 38.0 38.0 38.0 38.0 38.0 50-54 37.835449999999994 38.0 38.0 38.0 38.0 38.0 55-59 37.79965 38.0 38.0 38.0 38.0 38.0 60-64 37.7481 38.0 38.0 38.0 38.0 38.0 65-69 37.74765 38.0 38.0 38.0 38.0 38.0 70-74 37.72345 38.0 38.0 38.0 38.0 38.0 75-79 37.70264999999999 38.0 38.0 38.0 38.0 38.0 80-84 37.6815 38.0 38.0 38.0 38.0 38.0 85-89 37.639250000000004 38.0 38.0 38.0 38.0 38.0 90-94 37.584900000000005 38.0 38.0 38.0 38.0 38.0 95-99 37.58819999999999 38.0 38.0 38.0 38.0 38.0 100-104 37.5264 38.0 38.0 38.0 38.0 38.0 105-109 37.485049999999994 38.0 38.0 38.0 38.0 38.0 110-114 37.46115 38.0 38.0 38.0 37.8 38.0 115-119 37.3719 38.0 38.0 38.0 37.2 38.0 120-124 37.266 38.0 38.0 38.0 36.4 38.0 125-129 37.241899999999994 38.0 38.0 38.0 36.4 38.0 130-134 37.116249999999994 38.0 38.0 38.0 36.0 38.0 135-139 37.03009999999999 38.0 38.0 38.0 35.8 38.0 140-144 36.863 38.0 38.0 38.0 35.4 38.0 145-149 36.58245000000001 38.0 38.0 38.0 35.0 38.0 150-151 34.76025 38.0 36.0 38.0 29.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 1.0 16 1.0 17 0.0 18 0.0 19 2.0 20 0.0 21 4.0 22 0.0 23 1.0 24 1.0 25 2.0 26 5.0 27 4.0 28 5.0 29 1.0 30 12.0 31 13.0 32 25.0 33 16.0 34 34.0 35 63.0 36 233.0 37 3575.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.17794486215539 14.912280701754385 11.228070175438596 32.68170426065163 2 23.549999999999997 15.75 32.550000000000004 28.15 3 20.4 21.224999999999998 27.0 31.374999999999996 4 23.25 25.575 23.575 27.6 5 23.517638228671505 31.198398799099326 22.81711283462597 22.466850137603203 6 23.844221105527637 32.58793969849246 24.020100502512562 19.547738693467338 7 17.474999999999998 22.925 39.225 20.375 8 20.575 24.45 27.750000000000004 27.224999999999998 9 20.150000000000002 23.175 31.175000000000004 25.5 10-14 21.959999999999997 27.634999999999998 25.974999999999998 24.43 15-19 21.37 26.47 26.810000000000002 25.35 20-24 22.225 26.36 26.740000000000002 24.675 25-29 22.235 26.334999999999997 26.875 24.555 30-34 21.6 26.534999999999997 26.805 25.06 35-39 21.955 26.255 26.33 25.46 40-44 21.78 26.76 26.35 25.11 45-49 21.641082054102707 26.741337066853344 26.466323316165806 25.151257562878143 50-54 21.861093054652734 26.871343567178357 25.981299064953244 25.28626431321566 55-59 22.28 26.229999999999997 26.490000000000002 25.0 60-64 21.67 26.68 26.16 25.490000000000002 65-69 21.915000000000003 26.340000000000003 26.419999999999998 25.324999999999996 70-74 21.82 26.784999999999997 26.11 25.285000000000004 75-79 21.925 26.945000000000004 25.83 25.3 80-84 22.155 26.290000000000003 26.295 25.259999999999998 85-89 22.065 26.179999999999996 26.555 25.2 90-94 22.35 25.965 26.71 24.975 95-99 22.015 26.290000000000003 26.479999999999997 25.215 100-104 22.155 26.424999999999997 26.369999999999997 25.05 105-109 22.195 26.369999999999997 25.995 25.44 110-114 22.495 25.655 26.515 25.335 115-119 22.845 26.16 26.27 24.725 120-124 22.185 26.314999999999998 25.905 25.595000000000002 125-129 22.615 25.605 25.83 25.95 130-134 22.67 26.085 26.105 25.14 135-139 22.405 25.235000000000003 27.02 25.34 140-144 22.605 25.765 26.400000000000002 25.230000000000004 145-149 22.95229522952295 25.83258325832583 26.067606760676064 25.147514751475146 150-151 22.240280035004375 26.26578322290286 25.928241030128767 25.565695711963997 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 0.5 27 2.5 28 3.0 29 6.0 30 8.5 31 7.5 32 16.5 33 23.5 34 31.5 35 46.5 36 64.0 37 80.5 38 86.5 39 110.5 40 138.0 41 160.0 42 189.5 43 219.5 44 224.0 45 223.0 46 235.0 47 232.0 48 219.5 49 207.0 50 190.5 51 158.0 52 133.5 53 124.0 54 133.5 55 124.0 56 81.5 57 71.0 58 74.5 59 59.0 60 49.5 61 41.5 62 26.0 63 31.0 64 36.5 65 24.0 66 18.0 67 19.5 68 20.5 69 13.5 70 6.0 71 4.5 72 6.0 73 7.0 74 4.0 75 1.5 76 1.5 77 1.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.075 6 0.5 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.005 50-54 0.005 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.01 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.40190906807334836 0.8 3 0.0 0.0 4 0.025119316754584273 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.075 0.0 0.0 0.0 0.0 110-111 0.075 0.0 0.0 0.0 0.0 112-113 0.075 0.0 0.0 0.0 0.0 114-115 0.075 0.0 0.0 0.0 0.0 116-117 0.125 0.0 0.0 0.0 0.0 118-119 0.125 0.0 0.0 0.0 0.0 120-121 0.1375 0.0 0.0 0.0 0.0 122-123 0.16249999999999998 0.0 0.0 0.0 0.0 124-125 0.175 0.0 0.0 0.0 0.0 126-127 0.2 0.0 0.0 0.0 0.0 128-129 0.2 0.0 0.0 0.0 0.0 130-131 0.2 0.0 0.0 0.0 0.0 132-133 0.21250000000000002 0.0 0.0 0.0 0.0 134-135 0.2625 0.0 0.0 0.0 0.0 136-137 0.3125 0.0 0.0 0.0 0.0 138-139 0.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGAAGAG 10 0.006830828 145.0 7 GCCGCTG 10 0.006830828 145.0 1 >>END_MODULE SRR6031164 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031164_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.5275 34.0 33.0 34.0 33.0 34.0 2 33.569 34.0 33.0 34.0 33.0 34.0 3 33.584 34.0 34.0 34.0 33.0 34.0 4 33.458 34.0 34.0 34.0 33.0 34.0 5 33.49875 34.0 34.0 34.0 33.0 34.0 6 37.663 38.0 38.0 38.0 38.0 38.0 7 37.648 38.0 38.0 38.0 38.0 38.0 8 37.621 38.0 38.0 38.0 38.0 38.0 9 37.68575 38.0 38.0 38.0 38.0 38.0 10-14 37.63785 38.0 38.0 38.0 38.0 38.0 15-19 37.594849999999994 38.0 38.0 38.0 38.0 38.0 20-24 37.5516 38.0 38.0 38.0 38.0 38.0 25-29 37.6216 38.0 38.0 38.0 38.0 38.0 30-34 37.75945 38.0 38.0 38.0 38.0 38.0 35-39 37.7485 38.0 38.0 38.0 38.0 38.0 40-44 37.74655 38.0 38.0 38.0 38.0 38.0 45-49 37.73335 38.0 38.0 38.0 38.0 38.0 50-54 37.69160000000001 38.0 38.0 38.0 38.0 38.0 55-59 37.622350000000004 38.0 38.0 38.0 38.0 38.0 60-64 37.6697 38.0 38.0 38.0 38.0 38.0 65-69 37.6553 38.0 38.0 38.0 38.0 38.0 70-74 37.532900000000005 38.0 38.0 38.0 38.0 38.0 75-79 37.63250000000001 38.0 38.0 38.0 38.0 38.0 80-84 37.63625 38.0 38.0 38.0 38.0 38.0 85-89 37.585449999999994 38.0 38.0 38.0 38.0 38.0 90-94 37.56605 38.0 38.0 38.0 38.0 38.0 95-99 37.51885 38.0 38.0 38.0 38.0 38.0 100-104 37.49565 38.0 38.0 38.0 38.0 38.0 105-109 37.3467 38.0 38.0 38.0 38.0 38.0 110-114 37.23780000000001 38.0 38.0 38.0 38.0 38.0 115-119 37.1896 38.0 38.0 38.0 38.0 38.0 120-124 37.21085 38.0 38.0 38.0 38.0 38.0 125-129 37.2718 38.0 38.0 38.0 38.0 38.0 130-134 37.21375 38.0 38.0 38.0 37.0 38.0 135-139 37.192750000000004 38.0 38.0 38.0 36.8 38.0 140-144 37.07455 38.0 38.0 38.0 36.0 38.0 145-149 36.91930000000001 38.0 38.0 38.0 36.0 38.0 150-151 34.825874999999996 38.0 36.0 38.0 29.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 3.0 4 0.0 5 0.0 6 1.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 1.0 16 0.0 17 0.0 18 2.0 19 0.0 20 2.0 21 4.0 22 4.0 23 4.0 24 6.0 25 5.0 26 5.0 27 7.0 28 10.0 29 5.0 30 16.0 31 11.0 32 7.0 33 23.0 34 23.0 35 52.0 36 175.0 37 3630.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.92994746059544 21.891418563922944 12.95971978984238 25.21891418563923 2 29.74731048286215 26.82011508631474 24.168126094570926 19.264448336252187 3 23.240671174555473 27.823691460055095 27.973954420235415 20.96168294515402 4 26.601356443104745 31.273549359457427 21.15046470735996 20.97462949007787 5 25.470987189148453 32.9063049485054 20.472243154986185 21.15046470735996 6 24.153498871331827 34.08577878103837 20.290945573112616 21.46977677451718 7 21.07769423558897 20.37593984962406 33.83458646616541 24.711779448621556 8 23.248807431584233 24.303288978157166 23.976901832789355 28.471001757469246 9 24.385964912280702 23.182957393483708 26.56641604010025 25.86466165413534 10-14 25.090288924558585 26.088483146067414 24.137239165329053 24.683988764044944 15-19 24.758987748543884 26.129744928700543 24.678650331391847 24.43261699136373 20-24 25.04900236216515 26.50650851887219 24.83288938030859 23.611599738654068 25-29 25.260677762181672 26.333467014237016 24.49368357730098 23.912171646280328 30-34 25.540000000000003 25.305 25.345000000000002 23.810000000000002 35-39 25.119999999999997 25.82 25.14 23.919999999999998 40-44 25.195 25.615 24.775 24.415 45-49 25.2 25.94 25.14 23.72 50-54 25.665 26.07 25.03 23.235 55-59 25.769269319434702 25.889545955698107 24.807056229327454 23.53412849553974 60-64 25.22 25.5 25.91 23.369999999999997 65-69 25.546495923165423 26.036716522435093 25.11630233605122 23.300485218348257 70-74 26.000601865783928 26.050757347778113 24.646403851941017 23.30223693449694 75-79 25.40754075407541 25.902590259025903 25.087508750875088 23.602360236023603 80-84 25.46 26.02 25.185000000000002 23.335 85-89 26.005 25.535000000000004 24.865000000000002 23.595 90-94 25.740000000000002 25.645 25.865 22.75 95-99 25.89 25.895000000000003 25.319999999999997 22.895 100-104 25.830664531625303 26.060848678943156 25.065052041633308 23.043434747798237 105-109 25.794946501230726 25.719596121967147 25.60908223238057 22.87637514442156 110-114 25.811157502892502 26.218622667136177 25.41878364102822 22.551436188943104 115-119 26.26649209386645 25.657165877731895 25.28452009265787 22.79182193574378 120-124 25.506824568446408 25.742673625050184 25.853071055800886 22.89743075070253 125-129 26.026506626656666 26.056514128532132 24.641160290072516 23.275818954738682 130-134 25.89 25.974999999999998 25.335 22.8 135-139 25.759999999999998 26.16 25.430000000000003 22.650000000000002 140-144 25.605 26.47 25.34 22.585 145-149 26.14 25.965 25.385 22.509999999999998 150-151 25.0625 26.875 25.387500000000003 22.675 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 1.0 24 1.0 25 1.5 26 1.5 27 1.5 28 4.0 29 6.0 30 10.0 31 12.0 32 12.5 33 15.5 34 22.0 35 31.0 36 38.0 37 46.5 38 66.0 39 98.0 40 133.5 41 167.5 42 186.0 43 197.0 44 203.0 45 203.0 46 211.0 47 228.5 48 211.5 49 172.5 50 165.0 51 166.0 52 154.0 53 119.0 54 95.5 55 93.0 56 79.5 57 69.5 58 74.5 59 78.0 60 74.0 61 67.5 62 58.0 63 58.5 64 57.5 65 48.0 66 40.0 67 38.5 68 36.5 69 33.0 70 29.0 71 17.5 72 16.5 73 17.5 74 12.0 75 8.0 76 3.5 77 2.0 78 2.5 79 1.5 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.075 3 0.17500000000000002 4 0.475 5 0.475 6 0.325 7 0.25 8 0.42500000000000004 9 0.25 10-14 0.32 15-19 0.42 20-24 0.515 25-29 0.26 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.22999999999999998 60-64 0.0 65-69 0.045 70-74 0.31 75-79 0.01 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.08 105-109 0.46499999999999997 110-114 0.605 115-119 0.7100000000000001 120-124 0.36 125-129 0.025 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24395161290323 98.45 2 0.7308467741935484 1.4500000000000002 3 0.0 0.0 4 0.025201612903225805 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.037500000000000006 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.075 0.0 0.0 0.0 0.0 108-109 0.075 0.0 0.0 0.0 0.0 110-111 0.075 0.0 0.0 0.0 0.0 112-113 0.075 0.0 0.0 0.0 0.0 114-115 0.075 0.0 0.0 0.0 0.0 116-117 0.125 0.0 0.0 0.0 0.0 118-119 0.125 0.0 0.0 0.0 0.0 120-121 0.1375 0.0 0.0 0.0 0.0 122-123 0.16249999999999998 0.0 0.0 0.0 0.0 124-125 0.175 0.0 0.0 0.0 0.0 126-127 0.2 0.0 0.0 0.0 0.0 128-129 0.2 0.0 0.0 0.0 0.0 130-131 0.2 0.0 0.0 0.0 0.0 132-133 0.21250000000000002 0.0 0.0 0.0 0.0 134-135 0.2625 0.0 0.0 0.0 0.0 136-137 0.3125 0.0 0.0 0.0 0.0 138-139 0.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAAGGT 10 0.006830828 145.0 8 >>END_MODULE Read 447589 spots for SRR6031164.sra Written 447589 spots for SRR6031164.sra Read 447589 spots for SRR6031164.sra Written 447589 spots for SRR6031164.sra Read 447589 spots for SRR6031164.sra Written 447589 spots for SRR6031164.sra Read 447589 spots for SRR6031164.sra Written 447589 spots for SRR6031164.sra Read 447589 spots for SRR6031164.sra Written 447589 spots for SRR6031164.sra Read 447589 spots for SRR6031164.sra Written 447589 spots for SRR6031164.sra Read 447589 spots for SRR6031164.sra Written 447589 spots for SRR6031164.sra Read 447589 spots for SRR6031164.sra Written 447589 spots for SRR6031164.sra Read 447589 spots for SRR6031164.sra Written 447589 spots for SRR6031164.sra Read 447589 spots for SRR6031164.sra Written 447589 spots for SRR6031164.sra Read 447589 spots for SRR6031164.sra Written 447589 spots for SRR6031164.sra Read 447589 spots for SRR6031164.sra Written 447589 spots for SRR6031164.sra Read 447589 spots for SRR6031164.sra Written 447589 spots for SRR6031164.sra Read 447589 spots for SRR6031164.sra Written 447589 spots for SRR6031164.sra Read 447589 spots for SRR6031164.sra Written 447589 spots for SRR6031164.sra Read 447589 spots for SRR6031164.sra Written 447589 spots for SRR6031164.sra Read 447589 spots for SRR6031164.sra Written 447589 spots for SRR6031164.sra Read 447589 spots for SRR6031164.sra Written 447589 spots for SRR6031164.sra Read 447600 spots for SRR6031164.sra Written 447600 spots for SRR6031164.sra Read 447589 spots for SRR6031164.sra Written 447589 spots for SRR6031164.sra SRR ids: ['SRR6031164.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_aqmd5z7f SRR6031164.sra spots: 8951791 blocks: [[1, 447589], [447590, 895178], [895179, 1342767], [1342768, 1790356], [1790357, 2237945], [2237946, 2685534], [2685535, 3133123], [3133124, 3580712], [3580713, 4028301], [4028302, 4475890], [4475891, 4923479], [4923480, 5371068], [5371069, 5818657], [5818658, 6266246], [6266247, 6713835], [6713836, 7161424], [7161425, 7609013], [7609014, 8056602], [8056603, 8504191], [8504192, 8951791]] SRR6031164 file size 3013815 SRR6031164 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031164 SRR6031164_1.fastq SRR6031164_2.fastq Input file: SRR6031164_1.fastq Paired file: SRR6031164_2.fastq trimmed: SRR6031164-trimmed-pair1.fastq, SRR6031164-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 00:25:23 2024 >> started Tue Dec 10 00:25:32 2024 >> done (8.891s) 8951791 read pairs processed; of these: 4009 ( 0.04%) short read pairs filtered out after trimming by size control 3686 ( 0.04%) empty read pairs filtered out after trimming by size control 8944096 (99.91%) read pairs available; of these: 1886407 (21.09%) trimmed read pairs available after processing 7057689 (78.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 2 0.00% 21 1 0.00% 22 3 0.00% 23 6 0.00% 24 8 0.00% 25 9 0.00% 26 5 0.00% 27 6 0.00% 28 10 0.00% 29 6 0.00% 30 8 0.00% 31 3 0.00% 32 5 0.00% 33 8 0.00% 34 7 0.00% 35 6 0.00% 36 6 0.00% 37 5 0.00% 38 10 0.00% 39 5 0.00% 40 3 0.00% 41 5 0.00% 42 9 0.00% 43 5 0.00% 44 4 0.00% 45 8 0.00% 46 7 0.00% 47 8 0.00% 48 8 0.00% 49 10 0.00% 50 11 0.00% 51 9 0.00% 52 9 0.00% 53 10 0.00% 54 10 0.00% 55 16 0.00% 56 20 0.00% 57 23 0.00% 58 19 0.00% 59 23 0.00% 60 19 0.00% 61 24 0.00% 62 20 0.00% 63 27 0.00% 64 41 0.00% 65 44 0.00% 66 34 0.00% 67 38 0.00% 68 42 0.00% 69 75 0.00% 70 65 0.00% 71 78 0.00% 72 82 0.00% 73 78 0.00% 74 87 0.00% 75 96 0.00% 76 108 0.00% 77 144 0.00% 78 137 0.00% 79 145 0.00% 80 163 0.00% 81 176 0.00% 82 209 0.00% 83 226 0.00% 84 396 0.00% 85 514 0.01% 86 569 0.01% 87 643 0.01% 88 676 0.01% 89 621 0.01% 90 642 0.01% 91 623 0.01% 92 709 0.01% 93 706 0.01% 94 739 0.01% 95 780 0.01% 96 801 0.01% 97 844 0.01% 98 847 0.01% 99 877 0.01% 100 974 0.01% 101 967 0.01% 102 1059 0.01% 103 1059 0.01% 104 1200 0.01% 105 1232 0.01% 106 1300 0.01% 107 1359 0.02% 108 1363 0.02% 109 1419 0.02% 110 1492 0.02% 111 1506 0.02% 112 1652 0.02% 113 1753 0.02% 114 1834 0.02% 115 1991 0.02% 116 2043 0.02% 117 2041 0.02% 118 2124 0.02% 119 2327 0.03% 120 2329 0.03% 121 2473 0.03% 122 2686 0.03% 123 2703 0.03% 124 2854 0.03% 125 3092 0.03% 126 3050 0.03% 127 3242 0.04% 128 3450 0.04% 129 3742 0.04% 130 3836 0.04% 131 4200 0.05% 132 4346 0.05% 133 4800 0.05% 134 5058 0.06% 135 5491 0.06% 136 5916 0.07% 137 6247 0.07% 138 6950 0.08% 139 7604 0.09% 140 8176 0.09% 141 9093 0.10% 142 10293 0.12% 143 11985 0.13% 144 14411 0.16% 145 17687 0.20% 146 23807 0.27% 147 35110 0.39% 148 61461 0.69% 149 155961 1.74% 150 1410168 15.77% 151 7057689 78.91% 8944096 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.66 fanout-score-rank=32 prefix-density=0.32 prefix-fanout=2.5 sequence=CCCAGCTCACGTTCCCTATTGGTGGGTGAACAATCCAACACTTGGTGAATTCTGCTTCACAATGATAGGAAGAGCCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCACAAGCCAGTTATCCCTGTGGTAACTTTTCTGACACCTCTAGCTTCAAACTCCGAAGATCTAAAGGATCGATAGGCCACGCTTTCACGGTTCGTATTCGTACTGGAAATCAGAATCAAACGAGCTTTTACCCTTTTGTTCCACACGAGATTTCTGTTCTCGTTGAGCTCATCTTAGGACACCTGCGTTATCTTTTAACAGATGTGCCGCCCCAGCCAAACTCCCCACCTGACAATGTCTTCCGCCCGGATCGGCCCGGTCAGACCGGGCCTTGGAGCCAAAAGGAGGGGACTTGCCCCGCTTCCGACCCACGGAATAAGTAAAATAACGTTAAAAGTAGTGGTATTTCACTTGCGCCCGTAAAGGCTCCCACTTATCCTACACCTCTC criterion=fanout-score sequence-density=0.07 sequence-density-rank=13 fanout-score=302.67 fanout-score-rank=1 prefix-density=0.76 prefix-fanout=28.7 sequence=CTTCTTCTTGAT criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=38.23 fanout-score-rank=7 prefix-density=0.56 prefix-fanout=13.9 sequence=AGGAAGAAGAAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=32 fanout-score=272.58 fanout-score-rank=1 prefix-density=0.70 prefix-fanout=18.2 sequence=CCGCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR6031164 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 00:26:18 Started mapping on | Dec 10 00:26:18 Finished on | Dec 10 00:26:58 Mapping speed, Million of reads per hour | 804.97 Number of input reads | 8944096 Average input read length | 300 UNIQUE READS: Uniquely mapped reads number | 8097321 Uniquely mapped reads % | 90.53% Average mapped length | 300.33 Number of splices: Total | 9475650 Number of splices: Annotated (sjdb) | 9007110 Number of splices: GT/AG | 9353451 Number of splices: GC/AG | 110362 Number of splices: AT/AC | 6771 Number of splices: Non-canonical | 5066 Mismatch rate per base, % | 0.06% Deletion rate per base | 0.00% Deletion average length | 1.38 Insertion rate per base | 0.00% Insertion average length | 1.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 99810 % of reads mapped to multiple loci | 1.12% Number of reads mapped to too many loci | 47333 % of reads mapped to too many loci | 0.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.37% % of reads unmapped: other | 4.45% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 750187 750187 750187 N_multimapping 99810 99810 99810 N_noFeature 249686 7884009 303190 N_ambiguous 190339 1717 30531 UnstrandedReadsAssigned:7657296 PositiveStrandReadsAssigned:211595 NegativeStrandReadsAssigned:7763600 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR6031164 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR6031164-trimmed-pair1.fastq SRR6031164-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 8,944,096 reads, 7,840,253 reads pseudoaligned [quant] estimated average fragment length: 453.153 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,167 rounds 52973 SRR6031164.ke.tsv 35125 SRR6031164.se.tsv 88098 total ==> SRR6031164.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 485.186 0.617012 0.216201 PNS24247 1044 591.847 54.7217 15.7189 PNS24249 1928 1475.85 6.55662 0.755287 PNS24246 1044 591.847 54.7217 15.7189 PNS24248 1044 591.847 54.7217 15.7189 PNS24244 1471 1018.85 43.6612 7.28551 PNS24243 293 62.6877 0 0 KQK14069 1603 1150.85 2597.05 383.651 KQK14071 474 120.44 8.28646 11.6969 ==> SRR6031164.se.tsv <== BRADI_1g14170v3 2819 BRADI_1g53295v3 36 BRADI_1g59795v3 226 BRADI_1g07683v3 0 BRADI_1g00485v3 36 BRADI_1g20270v3 564 BRADI_1g74790v3 78 BRADI_1g09890v3 0 BRADI_1g77505v3 104 BRADI_1g48960v3 0 SRR6031164 completed mapping pipeline successfully